ID: 990703629

View in Genome Browser
Species Human (GRCh38)
Location 5:58502306-58502328
Sequence CTGTGTATGTAGCAGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990703626_990703629 13 Left 990703626 5:58502270-58502292 CCCTGGCTTCTGAGTGAGAAGCT No data
Right 990703629 5:58502306-58502328 CTGTGTATGTAGCAGCAAGAAGG No data
990703625_990703629 19 Left 990703625 5:58502264-58502286 CCTCTTCCCTGGCTTCTGAGTGA No data
Right 990703629 5:58502306-58502328 CTGTGTATGTAGCAGCAAGAAGG No data
990703627_990703629 12 Left 990703627 5:58502271-58502293 CCTGGCTTCTGAGTGAGAAGCTC No data
Right 990703629 5:58502306-58502328 CTGTGTATGTAGCAGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990703629 Original CRISPR CTGTGTATGTAGCAGCAAGA AGG Intergenic
No off target data available for this crispr