ID: 990706247

View in Genome Browser
Species Human (GRCh38)
Location 5:58532796-58532818
Sequence CAAGCTAGACTAATTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990706241_990706247 25 Left 990706241 5:58532748-58532770 CCCTCTCTTCCTTTCTTCTTCTC No data
Right 990706247 5:58532796-58532818 CAAGCTAGACTAATTGATCTTGG No data
990706244_990706247 16 Left 990706244 5:58532757-58532779 CCTTTCTTCTTCTCATTTGGAGC No data
Right 990706247 5:58532796-58532818 CAAGCTAGACTAATTGATCTTGG No data
990706242_990706247 24 Left 990706242 5:58532749-58532771 CCTCTCTTCCTTTCTTCTTCTCA No data
Right 990706247 5:58532796-58532818 CAAGCTAGACTAATTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990706247 Original CRISPR CAAGCTAGACTAATTGATCT TGG Intergenic
No off target data available for this crispr