ID: 990708654

View in Genome Browser
Species Human (GRCh38)
Location 5:58558374-58558396
Sequence CTTGATCAGAAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 391}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990708654 Original CRISPR CTTGATCAGAAGAAGGAGGA AGG (reversed) Intergenic
900149108 1:1170566-1170588 CCTGAGCAAAAGAAGGAGGGAGG - Intergenic
901169543 1:7246628-7246650 AGGGATCAGAGGAAGGAGGAGGG - Intronic
901825365 1:11857975-11857997 TTTGATAAGAAGTAGGAGGTGGG + Intronic
903651768 1:24926939-24926961 CTTGAGCAGCAGAAGGAAGGCGG - Intronic
904389476 1:30172499-30172521 CTAGATCAGAGGAAAGTGGATGG + Intergenic
905019025 1:34795696-34795718 CTTGAACAGTAGAACTAGGAAGG - Exonic
905642005 1:39596539-39596561 CCTGAGCAGAAGATTGAGGAAGG + Intergenic
905861034 1:41351605-41351627 CCTGATTAGAACAAAGAGGAGGG + Intergenic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
908799030 1:67859758-67859780 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
909025758 1:70480022-70480044 ATTGAAGAAAAGAAGGAGGAAGG - Intergenic
910025311 1:82643314-82643336 ATTAATGACAAGAAGGAGGATGG - Intergenic
910817328 1:91305111-91305133 CTTGAAAAGAAAAAGAAGGAAGG - Intronic
912412396 1:109487977-109487999 CTTGATCAGGAGACACAGGATGG - Intronic
912434881 1:109654774-109654796 CTTCTTCAGAAGGAGGAGTACGG - Intergenic
912687989 1:111782055-111782077 CTTGCTCAGAGCCAGGAGGAGGG - Intronic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
914568640 1:148892660-148892682 TTTGATGAGAAGGAAGAGGAGGG - Intronic
915585845 1:156843533-156843555 CAACATCAGAAGAAGGAAGAAGG + Intronic
916094226 1:161334207-161334229 CTGGTTCTGAAGATGGAGGAAGG - Intronic
916498072 1:165362953-165362975 ATCCATCAGAAGAATGAGGATGG - Intergenic
917693076 1:177488945-177488967 CTTGATTAGAAGAATGATGAGGG + Intergenic
917884677 1:179371771-179371793 CTGGCTTTGAAGAAGGAGGAAGG + Intronic
918321584 1:183370093-183370115 CCTGATCAGAAGCAGAAGGGTGG + Intronic
919486565 1:198155134-198155156 CTAAATCAGAAGAGGGAGTAGGG - Intergenic
919516525 1:198532276-198532298 CTTTAAGAAAAGAAGGAGGAAGG + Intronic
921295044 1:213693527-213693549 CTCGTTCAGAAAAAGGAAGAGGG + Intergenic
922061744 1:222099223-222099245 CTTAGCTAGAAGAAGGAGGAGGG + Intergenic
922194795 1:223350682-223350704 CTTGATTAGAAGAGGGCTGAAGG - Intronic
922224418 1:223632929-223632951 CCAGATGGGAAGAAGGAGGAAGG - Intronic
922342415 1:224668658-224668680 CTGGACCAGAAGAAGGAGGGAGG + Intronic
923286242 1:232498647-232498669 CTTGCTGTGAAGATGGAGGAAGG - Intronic
923976534 1:239270726-239270748 CCTGATCAGGAGAAGGAGGTAGG - Intergenic
924488280 1:244509129-244509151 CTGGATCAAAACAAGGATGAAGG - Intronic
1062908445 10:1195683-1195705 CTGGTTCAGAAGAAGAGGGATGG + Intronic
1063045218 10:2384890-2384912 GTTGATCTGAAGAAAGAGAATGG - Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063384584 10:5608058-5608080 CTTGTTCACATGCAGGAGGAGGG - Intergenic
1063585820 10:7351333-7351355 CTTAACCAGAAGAATGAGGATGG + Intronic
1063832048 10:9964440-9964462 CTTGAGCAGAAGCAGCAGCATGG - Intergenic
1063960827 10:11304244-11304266 CTGGCTCTGAAGATGGAGGAAGG - Intronic
1064359403 10:14650051-14650073 CCAGATAGGAAGAAGGAGGAAGG + Intronic
1066529028 10:36316119-36316141 ATTGAGGAGAATAAGGAGGAGGG - Intergenic
1067209993 10:44252108-44252130 CCAGATCTGAAGAATGAGGATGG + Intergenic
1069231834 10:66020264-66020286 CTTGAGCTGAAGAAAGTGGAAGG + Intronic
1070238671 10:74656136-74656158 AATGATCAGATGGAGGAGGATGG + Intronic
1071424214 10:85532119-85532141 CTTGAACAAAAGCAGCAGGAAGG + Intergenic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1073190705 10:101648891-101648913 CTTGATGATAAAAAGGAGGTGGG - Intronic
1074093822 10:110289682-110289704 ATTGTTCAGAAGTAGCAGGAAGG - Intergenic
1074297195 10:112201246-112201268 CTTGAACAGAGGAATGAGTAGGG - Intronic
1074734058 10:116409635-116409657 CTGGAACAGAAGAAAGAGGCAGG - Intergenic
1075738359 10:124678062-124678084 CGTGAACAGAAAAGGGAGGATGG + Intronic
1075860094 10:125667679-125667701 CTCTACCAGAAGAAGGATGATGG - Intronic
1076145425 10:128115449-128115471 CTTGACCAGAACAAGGGGAAGGG - Exonic
1078682558 11:13491131-13491153 CTAGATGAAAAGAAGTAGGAGGG - Intergenic
1079078831 11:17399893-17399915 GTTGATCAGAGAAAGGAGGCAGG - Intronic
1081129875 11:39365796-39365818 GTTGATGAGAAGATAGAGGAGGG + Intergenic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1082995758 11:59253957-59253979 ATTAATCAAAAGAAAGAGGATGG - Intergenic
1084220370 11:67674250-67674272 CTTGCTCAGGAGAGGGAGGTGGG - Intronic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1084902805 11:72322242-72322264 CTTTAGCAGCAAAAGGAGGATGG - Intronic
1085462390 11:76701990-76702012 CTGGATCAGAACGAGGAGAAGGG + Intergenic
1087387952 11:97497081-97497103 CCTGATTAGAAATAGGAGGAAGG + Intergenic
1088130600 11:106484634-106484656 CATGATGAGGAGAATGAGGATGG - Intergenic
1088338542 11:108736603-108736625 CTTGATCCCATTAAGGAGGAAGG - Intronic
1088731205 11:112684600-112684622 TTTGATTAGCAAAAGGAGGAAGG + Intergenic
1089147959 11:116344131-116344153 CTTACTCTGAAGATGGAGGAAGG - Intergenic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1090230411 11:125098868-125098890 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1091044434 11:132313059-132313081 CTTGATCAGAAAAGAGAGGCAGG - Intronic
1091067372 11:132528569-132528591 CTTGAGTGGAAGAAGGATGATGG - Intronic
1092144132 12:6202924-6202946 CTTCATCAGAGGCAGGAAGATGG + Intronic
1094363744 12:29658453-29658475 AATGATCAGGAGAAGAAGGAAGG - Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096759287 12:53826465-53826487 CTTAAACACAACAAGGAGGAGGG - Intergenic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1098652422 12:72990106-72990128 CTAGAACAGGAGTAGGAGGAAGG - Intergenic
1099464441 12:82965772-82965794 CTGGATCAGAACAAGGGGGAGGG - Intronic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1102924222 12:116814583-116814605 CTGGAGCAGAAGAAGGGGCAGGG + Intronic
1103205643 12:119126666-119126688 GTTGATGAGAAGAAGGAGGAAGG + Intronic
1103462677 12:121117515-121117537 CATGGTCAGCAGAATGAGGATGG + Intergenic
1104386065 12:128352619-128352641 ATTACTCAGATGAAGGAGGAAGG + Intronic
1104402423 12:128487246-128487268 GCTGATTAGAACAAGGAGGATGG - Intronic
1104724513 12:131067521-131067543 CCTGCTCAGAAGAAGGATCAGGG - Intronic
1104724530 12:131067623-131067645 CCTGCTCAGAAGAAGGATCAGGG - Intronic
1104724541 12:131067683-131067705 CCTGCTCAGAAGAAGGATCAGGG - Intronic
1104724552 12:131067743-131067765 CCTGCTCAGAAGAAGGATCAGGG - Intronic
1104724562 12:131067803-131067825 CCTGCTCAGAAGAAGGATCAGGG - Intronic
1104724573 12:131067863-131067885 CCTGCTCAGAAGAAGGATCAGGG - Intronic
1104724584 12:131067923-131067945 CCTGCTCAGAAGAAGGATCAGGG - Intronic
1104724595 12:131067983-131068005 CCTGCTCAGAAGAAGGATCAGGG - Intronic
1106321921 13:28648051-28648073 TTTGATCAGAAGAATGTGGGTGG - Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1107264286 13:38533866-38533888 AATGATCAGAAGAAGAAGAAAGG + Intergenic
1107368339 13:39711589-39711611 ACTGATGAGAAGGAGGAGGAAGG - Intronic
1110889899 13:80686126-80686148 GTAGAACATAAGAAGGAGGAAGG - Intergenic
1110907355 13:80908756-80908778 CTTTTTCAGAAGATGGAGAAAGG + Intergenic
1111354444 13:87080123-87080145 CGTGATCAGAACCAGGAGGCTGG + Intergenic
1113924963 13:113936436-113936458 CTTGCCCGGAAGAGGGAGGAAGG - Intergenic
1114587110 14:23825331-23825353 CTTGACTGGAATAAGGAGGAAGG - Intergenic
1118620423 14:67609779-67609801 CTTGAAGAGAAGAAGGGGAAGGG + Intergenic
1119451153 14:74712004-74712026 CTTGATCAGTAGCTGGAGAATGG + Intronic
1119757311 14:77128230-77128252 AGTGATCAGAGGAAGGAGGCAGG + Intronic
1119764054 14:77177245-77177267 CTTTATCAGCAGCATGAGGACGG - Intronic
1120449286 14:84645593-84645615 GTTCATCAGAGAAAGGAGGAAGG + Intergenic
1120692184 14:87605190-87605212 CTTTATCAGAAGCATGAAGATGG - Intergenic
1121571228 14:94947970-94947992 CTGGCTTTGAAGAAGGAGGATGG + Intergenic
1121936038 14:98019832-98019854 CTTGAGGAGAAGCAGCAGGATGG - Intergenic
1122357385 14:101131892-101131914 CCTAAGCAGAAGTAGGAGGAGGG - Intergenic
1124446086 15:29734273-29734295 TTGGCTCAGAAGAAGAAGGATGG - Exonic
1126670827 15:51113686-51113708 ATGGGTCAGAAGAAGCAGGAAGG - Intergenic
1127282361 15:57503227-57503249 CCTCATCAGGAGTAGGAGGAAGG - Intronic
1127321637 15:57852401-57852423 GTTGATCAAAAGAAAAAGGAGGG + Intergenic
1128050133 15:64656795-64656817 CTGGATCTAAAGAAAGAGGAAGG - Intronic
1128056408 15:64702978-64703000 CTGGAGCAGATGAGGGAGGATGG + Intronic
1128665220 15:69532584-69532606 CTTGAACAGAGGAAGGTGTAGGG + Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130161095 15:81401113-81401135 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1130415080 15:83686007-83686029 CCAGACCAGGAGAAGGAGGAGGG - Intronic
1130857678 15:87855530-87855552 AGTGAACAGAAGAAGGAGTAGGG - Intergenic
1131503313 15:92992130-92992152 GTTTATCAGAAGAAAGAGAAGGG - Intronic
1131940387 15:97558417-97558439 CTAGATTTGAAGATGGAGGAAGG - Intergenic
1132547289 16:539220-539242 CTTAATCAGAAGCTGGAAGAAGG + Intronic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133904068 16:10004641-10004663 CTTGCTTTGAAGATGGAGGAAGG - Intronic
1135073577 16:19373699-19373721 CTGGCTCAGAATATGGAGGAGGG + Intergenic
1135928096 16:26712842-26712864 TTTTACCAGAAGAAGGAAGATGG + Intergenic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1136062522 16:27736517-27736539 CCTGAACAGAAGAAGGAGCAAGG + Intronic
1136077589 16:27827663-27827685 CTTCATCAGAAGAAGGTGTCTGG + Intronic
1136077997 16:27830118-27830140 CTTGATCAGAGGAAACAGGCAGG - Intronic
1136142938 16:28298842-28298864 CCAGATCAGAAGGAGGAGGATGG - Intronic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1137828736 16:51523870-51523892 CTGGATCAGGAGCAGGAAGATGG + Intergenic
1138215647 16:55202830-55202852 CTAGAACAGAAAAAGGATGAGGG + Intergenic
1138590943 16:57999612-57999634 CCTGAGCAGAGGAAGAAGGAAGG + Exonic
1139031174 16:62882704-62882726 CTGGAGCAGAAGGACGAGGAAGG + Intergenic
1139188676 16:64836723-64836745 CCTGATCAGCAGGAGGAGGCGGG - Intergenic
1139421470 16:66851826-66851848 CTTGCTGAGACCAAGGAGGAGGG + Intronic
1139466672 16:67157752-67157774 TTTTGTCAGAAGATGGAGGAAGG - Intronic
1140122340 16:72094228-72094250 TTTGACCAGAGCAAGGAGGAAGG - Intronic
1141187867 16:81800935-81800957 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1142026725 16:87818405-87818427 CTCGGTCAGAAAGAGGAGGAGGG + Intergenic
1142160376 16:88554507-88554529 CTGGCTCTGAAGATGGAGGAGGG - Intergenic
1142637350 17:1266318-1266340 CTTGAGCAGAAGGAAGAGGCAGG + Intergenic
1143296142 17:5873419-5873441 ATGGAACAGAAGAAGGAAGAAGG - Intronic
1143525379 17:7468858-7468880 CTGGATGGGAAGAAGGAAGATGG + Intronic
1143874316 17:9980346-9980368 CTGGATCGGAAGAGGGAGGTGGG - Intronic
1144440126 17:15273712-15273734 CTTGCTCAGATGATGGTGGAAGG - Intergenic
1144535137 17:16081456-16081478 TTTGATCAGGAGAATGAGAATGG - Intronic
1145238733 17:21227088-21227110 CGGAGTCAGAAGAAGGAGGATGG + Intergenic
1148159204 17:45440542-45440564 ATTAATCATGAGAAGGAGGATGG + Intronic
1148336451 17:46845150-46845172 ACTGCTCAAAAGAAGGAGGAAGG - Intronic
1149199505 17:54166311-54166333 CTTGATCAGAATATGGAGAAAGG + Intergenic
1149507879 17:57211122-57211144 CTTCAGCAGAAAAAGGTGGAGGG + Intergenic
1149550120 17:57533681-57533703 CTTGATCAGGAGAGGGCAGAGGG + Intronic
1151734694 17:75931825-75931847 CCAGATCACAAGAGGGAGGAGGG + Intronic
1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG + Intronic
1154227193 18:12516169-12516191 CTTTATCAGAGGAAGGAGCAGGG - Intronic
1154337498 18:13477290-13477312 CATGGTCAGAAGAACAAGGAAGG + Intronic
1154507915 18:15060855-15060877 CTTGAACAGCAGTAGAAGGATGG + Intergenic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1157316520 18:46594387-46594409 CTGGATGAGAAGAAAGCGGATGG - Intronic
1158318415 18:56237379-56237401 CTGGGTTTGAAGAAGGAGGAAGG + Intergenic
1158405175 18:57154106-57154128 CTAGATGAAAAGCAGGAGGAGGG + Intergenic
1159195252 18:65105170-65105192 CTTTATCAGAATTTGGAGGAAGG - Intergenic
1159196763 18:65125812-65125834 CTTGATAATTAGAAGGGGGAAGG - Intergenic
1161539988 19:4844750-4844772 GTTGATCAGAAGCTGGTGGAAGG - Exonic
1161934568 19:7363755-7363777 ATTGATGAAAGGAAGGAGGATGG + Intronic
1162085129 19:8244133-8244155 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1163049483 19:14671387-14671409 CTGGATTTAAAGAAGGAGGAAGG - Intronic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1163162120 19:15470938-15470960 CTCGAAAAGAAGAAGGAGGCCGG - Intronic
1164220575 19:23189570-23189592 CTTGATAAAAATAAAGAGGATGG + Intergenic
1164404544 19:27932349-27932371 GATGAAGAGAAGAAGGAGGAAGG - Intergenic
1164945295 19:32288254-32288276 GTGGATCAGGAGAAGGAAGAAGG - Intergenic
1166321154 19:42019716-42019738 CTGGTTCTGAAGATGGAGGAAGG + Intronic
1167496935 19:49825078-49825100 CTTGAACAGAAGAAGCACTATGG - Intronic
1167718702 19:51162287-51162309 CTTGATAAGAACATGGAGCATGG - Intergenic
1167937659 19:52921084-52921106 CTAGATCTGAAGGAGGAGAAAGG + Intergenic
1168334859 19:55591997-55592019 CTTGATCTGGAGAATGTGGAGGG - Exonic
1168720031 19:58549771-58549793 CCTGACCTGAAGGAGGAGGATGG + Exonic
925063889 2:914498-914520 TGTGATCAGGAGAAGAAGGAAGG - Intergenic
925621809 2:5801232-5801254 CATGATCAGAACAAGGAAAAAGG + Intergenic
925942673 2:8835853-8835875 CTTGAGCAAAAGCAGGAAGAAGG + Intronic
927335765 2:21922443-21922465 TTTGATAACAGGAAGGAGGAGGG - Intergenic
928041940 2:27887219-27887241 CTGGCTCTGAAGATGGAGGAAGG + Intronic
928585970 2:32758440-32758462 CTTGTTCCGAAGATGAAGGAGGG - Exonic
928644427 2:33336722-33336744 TTTGCTCAGAATAAGGAAGAAGG + Intronic
928691589 2:33805051-33805073 CCTTACCAGAAGAAGGAGAAAGG + Intergenic
929073469 2:38057792-38057814 CTGGATCAGAAGGAAGAGGGAGG - Intronic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929871854 2:45765865-45765887 CTTGATTGGAAGTGGGAGGAGGG - Intronic
931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG + Intergenic
931653987 2:64493246-64493268 CCTGAGCAGAAGAAGAAGTAAGG + Intergenic
933033264 2:77359480-77359502 AATGATCAGGAGATGGAGGAGGG - Intronic
933572007 2:84025089-84025111 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
933660071 2:84920427-84920449 CAAGGTCAGAAGAAGAAGGATGG - Intergenic
933808009 2:86014145-86014167 CTTGATCAGTAGAAGTGGGGAGG + Intergenic
934159679 2:89236989-89237011 CATGATCAGTCGAATGAGGAAGG + Intergenic
934164392 2:89281111-89281133 CTTCATCACAAGAAGTATGAGGG - Intergenic
934202882 2:89901413-89901435 CTTCATCACAAGAAGTATGAGGG + Intergenic
934207600 2:89945442-89945464 CATGATCAGTCGAATGAGGAAGG - Intergenic
936092898 2:109512327-109512349 GGGCATCAGAAGAAGGAGGAAGG - Intergenic
936502293 2:113075583-113075605 TTTAATCACAAGAAGGAGGCAGG + Exonic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
940757426 2:157699228-157699250 CTGGGTCAGAAGAAGGAGCAGGG + Intergenic
941652778 2:168111260-168111282 CTTAATCTGAAGAAAGTGGAAGG - Intronic
941853280 2:170205767-170205789 TTTGGTCAGCAGATGGAGGATGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942025009 2:171901854-171901876 CTTGACCAGAAAGAGGAGTAAGG + Intronic
942662657 2:178282604-178282626 GTTCATCATAGGAAGGAGGAAGG + Intronic
943228292 2:185209738-185209760 CCTGATTATCAGAAGGAGGAAGG + Intergenic
943388394 2:187230628-187230650 CTAGATAAGAGGAAAGAGGAAGG + Intergenic
946001995 2:216490093-216490115 CTTGGTGAGAAGTGGGAGGATGG - Intergenic
1168880605 20:1203364-1203386 TCTGAACAGAACAAGGAGGAAGG - Intergenic
1169318592 20:4612715-4612737 AATGAACAGAAGAAGGAAGAGGG + Intergenic
1169437766 20:5608596-5608618 CTTGTTTAGAAGAAGGTGTATGG - Intronic
1170111620 20:12809846-12809868 CCTCATCAGATGAAGGAAGAAGG + Intergenic
1170396037 20:15926553-15926575 GTTGATCAGGATAAGAAGGATGG + Intronic
1170796606 20:19552873-19552895 CTTCATCAGAGGAAAGGGGAGGG + Intronic
1172027111 20:31956077-31956099 GTTGATCAGGAGTAGCAGGAGGG - Intergenic
1172356155 20:34281412-34281434 CTTGAGTTGAAGAATGAGGAAGG - Intronic
1172411304 20:34725467-34725489 TGTGATCAGAGGAATGAGGACGG + Intronic
1173997936 20:47353785-47353807 CTTGATGAGAAAAAGAAGGGGGG + Intronic
1174927335 20:54774691-54774713 ATTGTTCAGAAGCAGAAGGAAGG + Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1175989842 20:62782965-62782987 TTTGCTCTGAAGATGGAGGATGG + Intergenic
1176046467 20:63095362-63095384 CTGGCTCTGAAGACGGAGGATGG + Intergenic
1177231813 21:18331234-18331256 CTTGATCATCTGAAGGAGCAAGG + Intronic
1177989344 21:28019153-28019175 CTTGAACAGCAGGAGAAGGATGG - Intergenic
1178620687 21:34171767-34171789 CATGCTCAGGAGAAGGAGCAAGG - Intergenic
1178787391 21:35666414-35666436 CTTGGTGTGAAGGAGGAGGAAGG - Intronic
1179098029 21:38332996-38333018 CTTGATCAGAAGGTTGATGAAGG - Intergenic
1180974360 22:19839120-19839142 ATGGATCAGAAGGAGGGGGAGGG + Intronic
1181113166 22:20613618-20613640 CATGGTCAGAAGCAGGAGGTGGG + Intergenic
1181828477 22:25539349-25539371 CTGGAACAGAAGAAGGAGATTGG - Intergenic
1182041181 22:27240014-27240036 CTTAATCAGAAGAAGGTGAGAGG - Intergenic
1182126069 22:27816756-27816778 AAGGATCAGAAGAGGGAGGAGGG - Intergenic
1183553427 22:38506713-38506735 CTTGATAACAATATGGAGGACGG - Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184423122 22:44393188-44393210 CTTGACCAGAGGTGGGAGGAAGG + Intergenic
1185178375 22:49344831-49344853 CTGGAACAGAAGCGGGAGGAGGG + Intergenic
949361787 3:3240311-3240333 ACTGTTCAGAAGAAGGTGGAAGG + Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950904665 3:16527106-16527128 ATTGCAGAGAAGAAGGAGGAGGG + Intergenic
951665845 3:25122736-25122758 CATGTACAGAAGACGGAGGATGG + Intergenic
952053745 3:29418227-29418249 CTTGATTAGAAGACTGAGAATGG - Intronic
952258070 3:31712530-31712552 CTGGCTCTGAAGATGGAGGAAGG + Intronic
952282722 3:31938996-31939018 GTTGATCTGAAGCAGGAGGAAGG - Intronic
952629501 3:35448462-35448484 CCTGGTGAGAAGAATGAGGAAGG + Intergenic
954550885 3:51480668-51480690 CAGGATGAGAAAAAGGAGGATGG - Intronic
955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG + Exonic
955425941 3:58790161-58790183 AATAATTAGAAGAAGGAGGAAGG - Intronic
955755413 3:62220528-62220550 CTGGAACAGAAGAATAAGGAAGG + Intronic
956778946 3:72589479-72589501 CATGAGAAGAAGAAGAAGGATGG - Intergenic
957816413 3:85304254-85304276 CTTGATTACATGAAGGAGTACGG - Intronic
958173836 3:89970271-89970293 GTTGAGCAAAAGATGGAGGAAGG - Intergenic
959565057 3:107825604-107825626 CGTGGTCAGAATAGGGAGGATGG - Intergenic
961572964 3:127813542-127813564 ATTGATCAGAAGAAGGCATAAGG + Intronic
961833243 3:129635662-129635684 TTTGTTCACAAGAATGAGGATGG + Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963527553 3:146433443-146433465 CTTGCACAGTAGAAGAAGGAAGG + Exonic
963919780 3:150894209-150894231 CTAGTTCAGAAGAAGGATCATGG + Exonic
964515626 3:157504685-157504707 CTTGATGATAAGAAGGTGTAAGG + Intronic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
965857040 3:173101969-173101991 TTTGATGAGAAGAATGAGAAGGG - Intronic
967045670 3:185734475-185734497 TTTGCTCAGAAGAAGTAGAATGG - Intronic
967139027 3:186537809-186537831 CTTGAAGAGAAGAATGAAGAAGG - Intergenic
967348084 3:188480951-188480973 TATGATTAGAAGAAGGGGGAAGG - Intronic
967403864 3:189094865-189094887 CTCGACCAGAGCAAGGAGGAAGG - Intronic
968076280 3:195817431-195817453 CCTGGTAAGAAGAAGGAGGCTGG - Intergenic
968927842 4:3559209-3559231 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
969104444 4:4794628-4794650 CATTTTCAGAAGAAGCAGGATGG - Intergenic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
970010574 4:11454576-11454598 GTGTATCAGAAGAAGGAGGCTGG + Intergenic
970997675 4:22286111-22286133 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
971075226 4:23140351-23140373 TTTGATAAGAAGAAGGTAGATGG - Intergenic
971671756 4:29567451-29567473 GTTGATGATAAGGAGGAGGAAGG + Intergenic
972019275 4:34288981-34289003 TTTCATTAGAAGAAAGAGGAAGG + Intergenic
972568581 4:40290458-40290480 CTTGACCTGAGGAAGGAGGGTGG - Intergenic
973090261 4:46126833-46126855 GTGGTTCAAAAGAAGGAGGAGGG - Intergenic
974489724 4:62549209-62549231 TTTGAACAGAACAAGAAGGATGG - Intergenic
974783671 4:66589036-66589058 CTTGCTCAGATGAAGGCAGATGG - Intergenic
975242242 4:72074345-72074367 CTTCATCACAAGAAGAAGAAGGG + Intronic
976206338 4:82626564-82626586 CAACATCAGAAGCAGGAGGAGGG - Intergenic
977464601 4:97368029-97368051 CTTGCTTTGAAGATGGAGGAAGG - Intronic
977465406 4:97378254-97378276 CTAGATGACAAAAAGGAGGAAGG + Intronic
977853942 4:101865033-101865055 CTTGATCAGGGGCAGGAAGAAGG + Intronic
978613176 4:110566777-110566799 ATAGAACAGAAGATGGAGGAAGG - Intergenic
981985668 4:150852075-150852097 CTTGGTCAGATGCTGGAGGAAGG - Exonic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
984942541 4:184946270-184946292 CTTTTTCAGAAGATGGAGGCTGG - Intergenic
987137890 5:14916879-14916901 CTTTATCAGCAGCAGGAGAATGG + Intergenic
989342847 5:40396012-40396034 TTTGATCATCACAAGGAGGATGG - Intergenic
989806624 5:45615768-45615790 TCTGATCAGAAGAAAGATGAAGG + Intronic
990601826 5:57366770-57366792 CTTGAGCAGGAAGAGGAGGAAGG + Intergenic
990611036 5:57457083-57457105 CTTTATCAGAAAAAGGATGTAGG - Intergenic
990708654 5:58558374-58558396 CTTGATCAGAAGAAGGAGGAAGG - Intergenic
991377630 5:65983211-65983233 CTTGATCAGAATTAGGCTGATGG + Intronic
991601368 5:68354564-68354586 CTGGATGAGAGGAAGGAGGTAGG - Intergenic
991683188 5:69158636-69158658 CTTGACCAGAAGAAGGAATGAGG - Intergenic
992091232 5:73319108-73319130 CTTTATCAAAATAAGGAGTATGG + Intergenic
992832606 5:80609033-80609055 CTTGCTCACAAGAAGGGAGAGGG + Intergenic
993359198 5:86952753-86952775 TTTGATCAGAAAAAGAAGCAAGG - Intergenic
993693456 5:91031700-91031722 ATTGATCATAAGAAGAAGGAAGG - Intronic
995412404 5:111873572-111873594 CTTGCTTTGAAGATGGAGGAAGG - Intronic
995876091 5:116791714-116791736 CTTGAACTGAAGAAAGAGAAGGG + Intergenic
997490812 5:134274351-134274373 CTTGATCAGCAGGAGGAAGTAGG - Intergenic
998406984 5:141879481-141879503 CTAGGTCAAAAGAATGAGGAAGG + Intergenic
998811019 5:145966006-145966028 CTTGTGCAGAAGCGGGAGGAGGG + Intronic
998957607 5:147453618-147453640 CCGGAGCAGAAGAAGGAGGGAGG - Intronic
1000881576 5:166703869-166703891 CTTGATCACTTGCAGGAGGATGG + Intergenic
1001854920 5:175002852-175002874 CTTGATGGGAATAAGGAGCAAGG - Intergenic
1003133135 6:3412826-3412848 CTGGCTCTGAAGACGGAGGATGG + Intronic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003617957 6:7672511-7672533 TTTGATCAAAAGAAGAAGCAGGG + Intergenic
1006020652 6:31115830-31115852 TTTGAGAAGAGGAAGGAGGAAGG + Exonic
1006361173 6:33588236-33588258 GGGGATGAGAAGAAGGAGGAGGG - Intergenic
1006935422 6:37713866-37713888 GCTGGTCAGATGAAGGAGGATGG - Intergenic
1007118628 6:39362297-39362319 CTAGAACAGCAGGAGGAGGAGGG - Intronic
1008250623 6:49235448-49235470 CTTCATGAGAAAAAGGAGGAAGG - Intergenic
1008674349 6:53803657-53803679 CTAGATCAAAATAATGAGGAGGG - Intronic
1009938792 6:70265305-70265327 CATCATCAAAAGAAGGAGAAAGG + Intronic
1011533206 6:88347502-88347524 TTTGATGAGAAGAATGAGCAGGG + Intergenic
1011865899 6:91826561-91826583 GTTGAGTAGAGGAAGGAGGAAGG - Intergenic
1012187181 6:96233395-96233417 CTGGATTAGAAGAAGGTAGATGG - Intergenic
1014104158 6:117544520-117544542 CTTGATAGGAAGAAGAAGAAAGG + Exonic
1014337136 6:120150699-120150721 CTTCATCAGATGAAGTAGGGAGG - Intergenic
1015557295 6:134476402-134476424 CTGCATCAGAATAATGAGGAAGG - Intergenic
1015752617 6:136575522-136575544 CTTGATCAGAAAAAGGACATTGG - Intronic
1016355050 6:143209539-143209561 CTGGTTCTGAAGATGGAGGAGGG + Intronic
1018517817 6:164606209-164606231 CTGGATTAGAAGATGAAGGAAGG + Intergenic
1019534270 7:1520375-1520397 CTGGAACAGAAGGTGGAGGAAGG + Intergenic
1021454930 7:20819506-20819528 CTTGTTGAAATGAAGGAGGATGG - Intergenic
1021818474 7:24473246-24473268 CTAGATGAGGAGATGGAGGAAGG + Intergenic
1022703203 7:32780546-32780568 TTTGCTCAGAATAAGGAGGCTGG + Intergenic
1022837228 7:34129899-34129921 CTAGATCAGCAGTTGGAGGAAGG - Intronic
1023011888 7:35931185-35931207 ATTTATCAGAAGAAAGAGAAAGG + Intergenic
1024079247 7:45842683-45842705 ATTTATCAGAAGAAAGAGAAAGG - Intergenic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1025125533 7:56341266-56341288 ATTTATCAGAAGAAAGAGAAAGG + Intergenic
1025908680 7:65810088-65810110 CTTGGTGAGAAGACGGAGCAAGG + Intergenic
1025980216 7:66399145-66399167 CTTGTTGAGAAGAGGGAGCAAGG - Intronic
1026457414 7:70584738-70584760 CTTGCTCTGAAGAAGGAAGGGGG + Intronic
1026689696 7:72540953-72540975 CCTGAACAGAATCAGGAGGAAGG - Intergenic
1027205097 7:76091518-76091540 CTTGTTGAGAAGAGGGAGCAAGG - Intergenic
1027215961 7:76184129-76184151 CTAGCTCTGAAGATGGAGGAGGG + Intergenic
1029726256 7:102407477-102407499 CTTGAACAGAAGAAACAAGAAGG + Exonic
1030739793 7:113095139-113095161 CTAGATCAGATAAAGGAGAAAGG - Intergenic
1031949066 7:127873168-127873190 CCTGCTCAGAAAAAGGAGAAAGG - Intronic
1032016510 7:128383580-128383602 CTGGTTCTGAAGATGGAGGAAGG + Intergenic
1033042207 7:137928796-137928818 CTTGACCAAAAGAATGTGGAGGG - Intronic
1033714015 7:143981038-143981060 TCTGATCAGAAGAAGAATGAGGG - Intergenic
1033725611 7:144113590-144113612 CTTGATCAGAAGAAGAAAGCAGG + Intergenic
1035725434 8:1822465-1822487 CTTGATCAACAGAAGTAAGAAGG - Intergenic
1036289456 8:7474600-7474622 GCTGTTCAGAAGGAGGAGGATGG + Intronic
1036332020 8:7836931-7836953 GCTGTTCAGAAGGAGGAGGATGG - Intronic
1036482670 8:9151785-9151807 TTTCATCAGAAGCCGGAGGACGG + Exonic
1037897923 8:22670434-22670456 CTTGAGCAGGAGAGGTAGGAGGG + Intergenic
1039018401 8:33178846-33178868 CTTGAGCAGAGGTAGGAGGGAGG + Intergenic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1040635735 8:49270784-49270806 CTTGACCAGAAGTCGGGGGAGGG - Intergenic
1041342010 8:56856103-56856125 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
1041625209 8:60017669-60017691 TTTGTTGAGAAGAAGGTGGATGG + Intergenic
1042108842 8:65357357-65357379 CTTGATAGAAAGAAGGAGAAGGG - Intergenic
1042810771 8:72823040-72823062 CTGGCTCCTAAGAAGGAGGAAGG + Intronic
1044550538 8:93507293-93507315 CTTCATCAGATGAAGGAAAAGGG + Intergenic
1044928941 8:97233535-97233557 CTTCATCAGTAAAACGAGGACGG + Intergenic
1045101698 8:98850979-98851001 CTTAATCACAAGAAGGAGCTGGG - Intronic
1045297499 8:100884853-100884875 CTTTAACAGAGGTAGGAGGAGGG - Intergenic
1049663858 8:143834270-143834292 CTAGCTCTGAAGATGGAGGAGGG + Exonic
1049889428 9:54837-54859 CTGGAACAGAAGGAGGAGGGCGG - Intergenic
1050112535 9:2231696-2231718 CATGAACAGAAGGAGGAGGAAGG + Intergenic
1050452509 9:5798153-5798175 CTGGATGAGAAGAAATAGGATGG - Intronic
1051262210 9:15275637-15275659 CTTCATCAGGAGATAGAGGAAGG + Intronic
1051297402 9:15611120-15611142 CCAGATCAGGAGCAGGAGGAAGG - Intronic
1051421968 9:16897712-16897734 CTTTATTAGAAGCAGGAGAATGG - Intergenic
1051666978 9:19474823-19474845 ATTGATAAGGAGGAGGAGGAGGG - Intergenic
1052565443 9:30144071-30144093 TCTGAACAGAAGAAGAAGGAGGG - Intergenic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1053802693 9:41774290-41774312 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054190999 9:61985636-61985658 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054462292 9:65471930-65471952 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1054647370 9:67602081-67602103 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1056855536 9:90125858-90125880 TTTGCTCAGAAGAAGGATCAAGG - Intergenic
1058173472 9:101711072-101711094 CATTATCACAAGAAGGACGAGGG - Intronic
1058946292 9:109859805-109859827 CTTGGTCAGAAGAACAAGTAAGG - Intronic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060620367 9:125060017-125060039 CTTGATCAGAAGTAGGTGCCAGG - Intronic
1061373910 9:130213016-130213038 CATCATCAGAAGGTGGAGGAGGG - Intronic
1062108576 9:134769311-134769333 CTTGGTCAGAAGAAGCAGAGTGG + Intronic
1185652362 X:1657715-1657737 GGTGAACAGAGGAAGGAGGAAGG - Intergenic
1186129203 X:6448203-6448225 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1186652560 X:11576941-11576963 CTGGCTTTGAAGAAGGAGGAAGG - Intronic
1187297046 X:18012127-18012149 CCTGATCAGCAGGAGGAGGTAGG + Intergenic
1187532894 X:20112635-20112657 TTTCACCAGAAGAAGGAAGAGGG - Intronic
1188287574 X:28346696-28346718 CTTGATTTGAAGAATGAGCAGGG - Intergenic
1188473905 X:30569630-30569652 CTGGAACAGTACAAGGAGGAAGG + Intronic
1189294283 X:39908028-39908050 CTTGGTCAGAGGAGGGAGGGTGG - Intergenic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1189859927 X:45261773-45261795 GTTGATCAGGGGAAGGAGGTAGG + Intergenic
1194148597 X:90294873-90294895 CGTGAGCAGAAGCAGGAAGATGG + Intergenic
1194698560 X:97085896-97085918 GTTGATCAGAAGTAGGAGAATGG + Intronic
1194825390 X:98556293-98556315 CTTTATTAGAAGCATGAGGATGG - Intergenic
1197207659 X:123803840-123803862 CTTGATCAAAGGGATGAGGAAGG + Intergenic
1197779109 X:130141977-130141999 CTTAACCATAAGAAGGAGTAGGG - Intronic
1198223383 X:134623310-134623332 CTTGGACACAAGAGGGAGGATGG + Intronic
1199497022 X:148464019-148464041 CATGAACAGAAGCAGAAGGAGGG - Intergenic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1199779306 X:151043839-151043861 TGTTGTCAGAAGAAGGAGGAAGG + Intergenic