ID: 990715351

View in Genome Browser
Species Human (GRCh38)
Location 5:58630217-58630239
Sequence CCAAATATATTTTGCCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990715351_990715357 30 Left 990715351 5:58630217-58630239 CCTTGCAGGCAAAATATATTTGG 0: 1
1: 0
2: 4
3: 19
4: 203
Right 990715357 5:58630270-58630292 CATGTGTATTGTGCCTCTTTTGG No data
990715351_990715355 -3 Left 990715351 5:58630217-58630239 CCTTGCAGGCAAAATATATTTGG 0: 1
1: 0
2: 4
3: 19
4: 203
Right 990715355 5:58630237-58630259 TGGCTTGTAGGGCTGTTTTAAGG 0: 1
1: 0
2: 0
3: 23
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990715351 Original CRISPR CCAAATATATTTTGCCTGCA AGG (reversed) Intronic
901283008 1:8053972-8053994 CCAAATTTATCTTTCCTGGAAGG - Intergenic
904629754 1:31832036-31832058 CCTAATATCCTTTGCCTGCCAGG + Intergenic
904940470 1:34162506-34162528 CCAAATCTCTGCTGCCTGCAAGG + Intronic
908428499 1:64032373-64032395 CAAAATATGTTGTTCCTGCATGG + Intronic
909603366 1:77483765-77483787 ACAAAAATATTTTTCCTGCCTGG + Intronic
910079941 1:83329588-83329610 CCCAATAAATTTTGGCTGAATGG + Intergenic
910922754 1:92367019-92367041 CCCAATATTTTCTTCCTGCATGG - Intronic
911373178 1:97018642-97018664 CCAACTATATGGTGCCTCCAAGG + Intergenic
915757923 1:158280776-158280798 CCAATTATATTTACCATGCATGG - Intergenic
920817441 1:209348103-209348125 CCAAATAGTTTTTACCTTCAGGG - Intergenic
921569381 1:216760178-216760200 CCCAATAAATACTGCCTGCATGG + Intronic
1062896026 10:1104007-1104029 CTAAATTTATTTTGTCTTCAGGG + Intronic
1063230148 10:4058255-4058277 GAAAATATGTTTTGCCTCCAAGG - Intergenic
1063849086 10:10163877-10163899 CCCAAAATATTTTGCCTACAAGG + Intergenic
1068089778 10:52419267-52419289 CCAAGTATATTTTGGCAGAAGGG - Intergenic
1068678296 10:59791001-59791023 GCAAACAAATTTTGCCTTCATGG - Exonic
1069115627 10:64502477-64502499 CTAAATATATTTTGTATGTATGG + Intergenic
1069828214 10:71267135-71267157 ACAAAAATATTTTGCCAGCTGGG - Intronic
1071954177 10:90739423-90739445 CCATATATATGTTCCCAGCATGG + Intergenic
1072133350 10:92518281-92518303 CCAGATATCTTCTGACTGCATGG + Intronic
1077585595 11:3449674-3449696 CCAATTATATTATGACTGTATGG - Intergenic
1078493235 11:11788753-11788775 CCAAATATATTTTCATTCCATGG + Intergenic
1078866842 11:15305821-15305843 CCATATATATTTTGTTTACATGG - Intergenic
1080201739 11:29679305-29679327 CTAAAGCTATTTTGCATGCATGG - Intergenic
1080344695 11:31311346-31311368 CCAATTATATTTTCCCTGTTTGG - Intronic
1083060613 11:59866744-59866766 CCTAATATATCTTCACTGCACGG - Intergenic
1084339774 11:68488871-68488893 CCAACTATATGTTGTCTACAAGG - Intronic
1085148944 11:74232318-74232340 ACAGATATATTCTGCCTGCTAGG - Intronic
1087483808 11:98735564-98735586 CTAAGTATGTTCTGCCTGCAGGG - Intergenic
1087976453 11:104554726-104554748 ACACATATATTTTCTCTGCAAGG - Intergenic
1090625400 11:128603873-128603895 CCAGCTATATTTTGGCAGCAGGG - Intergenic
1092316961 12:7426786-7426808 CCAAATATATGCTGCTTACAAGG + Intronic
1094801172 12:34037547-34037569 CCTAAAATATTTGGCCTGAAAGG + Intergenic
1096099586 12:48961567-48961589 CCAAATGGATTTTGTCAGCAAGG - Intergenic
1097372218 12:58798214-58798236 ACAAATATATAATGCATGCAGGG - Intronic
1097914386 12:65004921-65004943 CCATTTTTATTTTGCCTGGATGG + Intergenic
1098142100 12:67460357-67460379 TGAATTATATTTTGCCTGTAGGG + Intergenic
1098504944 12:71238540-71238562 CCAAATATGCTTTTCCTGGATGG + Intronic
1100239997 12:92701636-92701658 CAAAAAATATTTTGCCTGCATGG - Intergenic
1100244211 12:92740438-92740460 CCAAATATACTTTACTTTCAGGG - Intronic
1101972422 12:109324828-109324850 CCAAATATCTAATGCATGCAGGG - Intergenic
1109079937 13:57886019-57886041 CCTAAAATATTTTGCTTTCAGGG + Intergenic
1110950348 13:81480473-81480495 TCAAATATAATGTGCCTGAATGG - Intergenic
1111513080 13:89291785-89291807 CCAATAATTTGTTGCCTGCAAGG - Intergenic
1111875156 13:93883740-93883762 CCAAATACTTTTTGACTGCCAGG + Intronic
1112137680 13:96600578-96600600 CCAAATATATGCTGTCTTCAAGG - Intronic
1113412048 13:110098835-110098857 CCAAATATATTTTTCCCCTATGG - Intergenic
1118980643 14:70713545-70713567 CCAAATTTATTTTTCTTTCAAGG - Intergenic
1119753872 14:77099863-77099885 TCAAATATCTGTTTCCTGCAGGG + Intronic
1120268816 14:82284419-82284441 ATAAATATTTTTTGCCTGCAGGG - Intergenic
1120288488 14:82535900-82535922 ACTATTATATTTTGCCTTCAGGG + Intergenic
1120342093 14:83234466-83234488 CCAAAGATATTTTGCCTCCAGGG + Intergenic
1120678266 14:87448552-87448574 CAAAATATATTTTAGTTGCATGG - Intergenic
1122460798 14:101892881-101892903 CTACGTATATTTTGCCTGCTGGG + Intronic
1123912948 15:24987778-24987800 CCATATATTTTTTTCTTGCAAGG + Intergenic
1125566190 15:40680246-40680268 CCAAATGTTTTTTGCATGCATGG + Intergenic
1125918856 15:43512450-43512472 CCAAATATACTTTGCAGACATGG + Intronic
1126801508 15:52302028-52302050 CCAACTATATGTTGTCTACAAGG - Intergenic
1128407301 15:67355688-67355710 CCAAACAGATTTTTCCAGCAGGG + Intronic
1130247463 15:82264854-82264876 CAACATTTATTTTGCTTGCATGG - Intronic
1130452631 15:84072326-84072348 CAACATTTATTTTGCTTGCATGG + Intergenic
1130759638 15:86805214-86805236 CAAAATAAATTTTGTCTGTAAGG + Intronic
1137868581 16:51927537-51927559 CCAAATACATTTTGCATTGAGGG + Intergenic
1139595872 16:67957986-67958008 CCAAAGATATTCTGCAGGCAGGG + Exonic
1140144878 16:72296846-72296868 CCACATTTATTTGGCCTTCATGG + Intergenic
1140317716 16:73915064-73915086 CCAAATAAATTTTGTCCACATGG - Intergenic
1144262424 17:13535272-13535294 ACATATGTATTTTCCCTGCAAGG + Intronic
1144496122 17:15746528-15746550 GTAAATATATTTTGCCTTTAGGG - Intronic
1144555531 17:16279438-16279460 AAAGAGATATTTTGCCTGCAAGG + Intronic
1146243841 17:31260034-31260056 CCAAAGATATATAGCCTGCTAGG - Intronic
1149414969 17:56449516-56449538 CCAAAAACATTTTGCCTCCAAGG + Intronic
1150901766 17:69286601-69286623 CCAAATATATTTTTCCTAAAAGG + Intronic
1151409044 17:73908905-73908927 CCAAATATTCTCTGCCTGCCAGG + Intergenic
1151664151 17:75535863-75535885 CCAGAAATATTTTGCCGGCCAGG + Intronic
1152168450 17:78726522-78726544 CCAAATAAATGCTGTCTGCAAGG + Intronic
1155187617 18:23401288-23401310 CCATTCATATTTTGCCTTCACGG + Intronic
1156172489 18:34503253-34503275 CCAATTATATTTTATCTACAAGG - Intronic
1156536414 18:37868882-37868904 GGAAATATATTTTTCATGCAGGG - Intergenic
1157516665 18:48316152-48316174 CCAATTCTATTTTGTCTGTAAGG - Intronic
1158664840 18:59423106-59423128 CCAAATACATTTTTCCTTCAGGG - Intergenic
1161075478 19:2283130-2283152 CCAAAGATGTTTTTGCTGCAAGG + Intronic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
1167728430 19:51235136-51235158 CCAAATCTTTTTTGTCTGCAGGG + Exonic
1168609617 19:57788621-57788643 CCAGATATATTCTCCCTTCATGG - Intronic
1168611933 19:57807881-57807903 CCAAATTTATTTTACTTGTAAGG + Exonic
1168616609 19:57842720-57842742 CCAAATTTATTTTACTTGTAAGG - Intronic
926151228 2:10426716-10426738 CCAAGGACAGTTTGCCTGCAGGG - Exonic
928485958 2:31731764-31731786 CCAACTATATGCTGCCTACAAGG + Intergenic
928586891 2:32768911-32768933 GAAAATATCTTTTGCCAGCAAGG + Intronic
930368732 2:50477100-50477122 CCATATAAATTTTGTCTCCATGG - Intronic
930403578 2:50924590-50924612 CAAAAGATATTAGGCCTGCAGGG + Intronic
930961331 2:57265911-57265933 CCAACTATATGCTGCCTACAAGG + Intergenic
931891887 2:66682380-66682402 CCCAATATATTTTAGCTGCATGG - Intergenic
933917234 2:87007981-87008003 CCAAATATATGTTAACTACAAGG + Intronic
934005762 2:87761933-87761955 CCAAATATATGTTAACTACAAGG - Intronic
935768718 2:106396033-106396055 CCAAATATATGTTAACTACAAGG - Intronic
935911382 2:107899895-107899917 CCAAATATATGTTAACTACAAGG + Intergenic
935969499 2:108516735-108516757 CCAAATATATGTTAACTACAAGG + Intergenic
936133165 2:109864953-109864975 CCAAATATATGTTAACTACAAGG + Intergenic
936211532 2:110506532-110506554 CCAAATATATGTTAACTACAAGG - Intergenic
936420670 2:112361107-112361129 CCAAATATATGTTAACTACAAGG - Intergenic
936772652 2:115933373-115933395 GCAAAAATACTTTGCATGCAAGG + Intergenic
936772668 2:115933745-115933767 CTAAAAATACTTTGCATGCAAGG - Intergenic
939083534 2:137689050-137689072 CCAAATGTATTTTTACAGCATGG - Intergenic
940357326 2:152758309-152758331 CAAAATATATTCTACCTGCTTGG + Intronic
940540169 2:155004641-155004663 CCAGATATATTTTGTCTTCCTGG - Intergenic
940778471 2:157908324-157908346 CAAAATTTATTTTTCCTGCCAGG - Intronic
942616943 2:177801094-177801116 TCAAACATATTTTGCCTATATGG - Intronic
943138892 2:183952585-183952607 ATAAGTATATTTTGTCTGCAAGG + Intergenic
943838540 2:192548007-192548029 CAGATTATATTTTGACTGCAAGG + Intergenic
944437864 2:199710448-199710470 ACAAAAATATTTTGACTGGAGGG + Intergenic
945527508 2:210906498-210906520 CCAACTATATGTTGCCTATAAGG + Intergenic
946782745 2:223207973-223207995 TCAACTATATGTTGCCTACAAGG + Intergenic
947428258 2:230003454-230003476 CCAGAGATATTTTGCAGGCATGG - Intronic
947500168 2:230665763-230665785 CAAAAAAAAATTTGCCTGCATGG + Intergenic
947712389 2:232323571-232323593 CCAAACATCATATGCCTGCAGGG - Intronic
948001665 2:234572763-234572785 CCAAAATTATTTCCCCTGCATGG + Intergenic
1169339859 20:4788087-4788109 CCAAATGTTGTTTGCCTTCAAGG - Intronic
1169662105 20:7990780-7990802 CCCAAAATATCTTCCCTGCAAGG + Intronic
1173128666 20:40365637-40365659 CCAAATATATTTTTCTTGAAAGG - Intergenic
1175727190 20:61326776-61326798 TCAAATACATTTTTCCTCCAAGG - Intronic
1177946159 21:27472094-27472116 CCAAATATATTGTAGCTGCATGG + Intergenic
1178264340 21:31128758-31128780 CCAAATATATTTGCCCTACATGG + Intronic
1179385797 21:40940840-40940862 CCTAATACAGTTTGCCTGGATGG + Intergenic
1179559378 21:42203393-42203415 CCTAATATTTTTTCCCTGAAAGG + Intronic
1182249523 22:28989099-28989121 CCAAATATTTATTGGATGCAGGG + Intronic
1182385917 22:29940778-29940800 CTAAATATAATTAGCCTCCAAGG - Intronic
949822091 3:8126463-8126485 AAAAAAATATTTTGCCTTCAAGG - Intergenic
955004832 3:54958806-54958828 CCAAAAATATTTTATCTGCCTGG + Intronic
956659962 3:71587694-71587716 CCAAATTTATTTTGCCTTGGAGG - Intergenic
957530925 3:81440146-81440168 GCCAATATATTTTGCCTTCTTGG + Intergenic
959600751 3:108182147-108182169 CTAAATATTTTTGACCTGCAGGG - Intronic
961850672 3:129814631-129814653 CCAACTATATGCTGCCTACAAGG + Intronic
963150939 3:142044763-142044785 CCAAATACACTTTGACTTCAGGG - Intronic
963217362 3:142763584-142763606 CCAACTATATGCTGCCTTCAAGG - Intronic
963573012 3:147020971-147020993 CCAACTATATGCTGCCTACAAGG + Intergenic
963970450 3:151423582-151423604 CCAAATATATTTTCCCAGCAAGG - Intronic
965573384 3:170193327-170193349 CCAAATATCTGTTGTCTTCAAGG + Intergenic
966111495 3:176408062-176408084 TCAAATATATTTTGGAAGCATGG - Intergenic
966982976 3:185154361-185154383 CCAAATAGATTTTCCATGCCAGG + Intergenic
967793083 3:193570002-193570024 ACAAATATGCTTTGCCAGCAGGG + Intronic
967812256 3:193770230-193770252 CCATTTATTTTTTGCCTTCAAGG - Intergenic
969000786 4:3979604-3979626 CCAATTATATTATGACTGTATGG - Intergenic
969813137 4:9665266-9665288 CCAATTATATTATGACTGTATGG + Intergenic
970541292 4:17082437-17082459 CCAATTATCTTTTGGCTGCAAGG - Intergenic
970900828 4:21157463-21157485 TCTAATATATTTTGCCTGTTTGG - Intronic
972908555 4:43784165-43784187 CAAAATTTATTTTCCCTGTAAGG - Intergenic
974824698 4:67112975-67112997 CCAAATATATTCTGCCTTTCAGG - Intergenic
977423135 4:96828908-96828930 GCAAATATACTGTGGCTGCATGG + Intergenic
979168206 4:117563915-117563937 CCAACTATATTTTACCTACAAGG - Intergenic
980246911 4:130257826-130257848 TCAAAAATATTTTGCCTGTCTGG - Intergenic
980773995 4:137415640-137415662 CCATATATATATTCCTTGCAAGG + Intergenic
981964825 4:150587755-150587777 ATAAATATATTTTGCCTCAAAGG - Intronic
982849889 4:160299710-160299732 CCAAATATATATTGCTAGCTTGG + Intergenic
983083667 4:163417279-163417301 CCCAGTATATTTTGCCAGCAAGG - Intergenic
984293749 4:177828143-177828165 CCAAATATATTTTTTTTACATGG + Intronic
986424756 5:7620146-7620168 CCAGATATATTTGGACTGAAGGG - Intronic
987189572 5:15461655-15461677 CTAACTATATGCTGCCTGCAAGG - Intergenic
990715351 5:58630217-58630239 CCAAATATATTTTGCCTGCAAGG - Intronic
990715354 5:58630226-58630248 CAAAATATATTTGGCTTGTAGGG + Intronic
994410788 5:99404738-99404760 CCAAATACATTATGCGTGAAAGG - Intergenic
995984366 5:118151394-118151416 CAAAATATATTTTACCTTTAGGG + Intergenic
996989077 5:129606119-129606141 CCAAATATTTATTGCCTTCAAGG - Intronic
997941343 5:138160280-138160302 TCAAATATATTTTGACTGATTGG + Intronic
998984218 5:147737731-147737753 TCAAATTTCTTTTGTCTGCAAGG - Intronic
999581766 5:153046313-153046335 CCAAAGATACTTGCCCTGCAAGG - Intergenic
999973354 5:156886949-156886971 CCAAATATTTGTTGCCAACAAGG + Intergenic
1000071844 5:157747469-157747491 CCAAATTCAGTTTTCCTGCAGGG + Intronic
1000553885 5:162699694-162699716 CCACATATGTTTTGCCTTCCAGG - Intergenic
1001275452 5:170347555-170347577 GCTAATATATTTGGCCTGCCGGG + Intergenic
1008373609 6:50765949-50765971 CCAAAAATATTTTTCCTTCTAGG + Intronic
1008599991 6:53083621-53083643 CAAAAAATATTTTTGCTGCAAGG - Intronic
1009511679 6:64558750-64558772 CTAAAAATAATTTCCCTGCAAGG + Intronic
1010054361 6:71547055-71547077 CCAAGTAAATGTTGGCTGCAAGG + Intergenic
1013982524 6:116149131-116149153 CAGAATATATTTTGCCTGGCAGG + Intronic
1014743137 6:125169334-125169356 CAAAATTTATTTTTCCTGCCTGG + Intronic
1015307512 6:131726223-131726245 ATAAATATTTCTTGCCTGCATGG - Intronic
1018541124 6:164880507-164880529 CCAGATATATTTGGTTTGCAAGG - Intergenic
1023074827 7:36472410-36472432 CCAATTATAGTTTGCCAGTAAGG + Intergenic
1023180921 7:37482613-37482635 CCAAATAAAATTTGACAGCAAGG - Intergenic
1024457250 7:49623264-49623286 CCTGACATATTTTGCCTTCAAGG - Intergenic
1026781736 7:73272649-73272671 CCAAGTATAGTTTTCTTGCATGG + Intergenic
1027022585 7:74826083-74826105 CCAAGTATAGTTTTCTTGCATGG + Intronic
1027065427 7:75119826-75119848 CCAAGTATAGTTTTCTTGCATGG - Intronic
1027297705 7:76794867-76794889 CCCAATAAATTTTGGCTGAATGG + Intergenic
1027582312 7:80013681-80013703 CCAACTATATGCTGCCTACAAGG - Intergenic
1027807491 7:82847601-82847623 CCCAATATAATTTTCCTGCGGGG + Intronic
1027827988 7:83140780-83140802 CCATAAATATTTTTCCTGCCTGG + Intronic
1031495561 7:122443360-122443382 CCCAAAATATTTAGCCTGAAAGG - Intronic
1032063895 7:128749622-128749644 CTAAAAATATTTTGCCTTGATGG + Intronic
1036376435 8:8204425-8204447 CCAATTATATTATGACTGTATGG + Intergenic
1036853097 8:12218713-12218735 CCAATTATATTATGACTGTATGG - Intergenic
1036874472 8:12461235-12461257 CCAATTATATTATGACTGTATGG - Intergenic
1037488237 8:19370645-19370667 CAAATTATACATTGCCTGCAAGG - Intronic
1038610345 8:29054966-29054988 CCAGATATATTTTACCTCAAAGG + Intronic
1040540704 8:48351969-48351991 GTAAATATATTTTGCCTCCCCGG - Intergenic
1043117065 8:76270498-76270520 CCAACTATATATTGTCTGCAAGG + Intergenic
1044106660 8:88215966-88215988 CCAAATATTTTGAGCATGCATGG - Intronic
1045645938 8:104298801-104298823 CCAACTTTATTTTGGCTTCAGGG - Intergenic
1046304738 8:112350381-112350403 GCAAACATATTCAGCCTGCAAGG - Intronic
1046318069 8:112533352-112533374 CCAAATATATGCTGCTTACAAGG + Intronic
1046536223 8:115514622-115514644 CAAAATATCTTTTGCATGGAAGG - Intronic
1051210146 9:14732854-14732876 CCAGCTATATGCTGCCTGCAAGG - Intergenic
1052246659 9:26344454-26344476 CCAAATATATGCTGCCTACAAGG + Intergenic
1052296645 9:26903543-26903565 CCAAATAAAAATTGCCTGTAAGG - Intergenic
1052595087 9:30547512-30547534 CCAACTATATATTGCCTGTAAGG - Intergenic
1053074987 9:35125073-35125095 CCAAATTTATTTTGTATCCAAGG - Intergenic
1059778287 9:117498997-117499019 CCAGATATATTTTGTCTGATAGG + Intergenic
1061455303 9:130693111-130693133 CCAAATATACCTGGCTTGCAAGG + Intergenic
1062443962 9:136585638-136585660 CCAAAGATGCTTTGGCTGCAGGG + Intergenic
1188271259 X:28144068-28144090 CCAAAGATATTGTGACTGTAAGG - Intergenic
1188569356 X:31563595-31563617 CTCAATATATCTTGCCTTCAAGG + Intronic
1188836750 X:34967044-34967066 CCAAATATAGTTGGCCTCTATGG + Intergenic
1191791547 X:64976845-64976867 CCAAAGCTACTTTCCCTGCAGGG - Intronic
1193849947 X:86524738-86524760 CCAATAATATTTGTCCTGCATGG + Intronic
1193861960 X:86679664-86679686 CCAAATATATTTACCATGCCAGG + Intronic
1194610433 X:96036305-96036327 CCAAATTCATGTTACCTGCATGG + Intergenic
1196776405 X:119341874-119341896 CCAAATAGATTTTGCTTATATGG - Intergenic
1197187710 X:123606739-123606761 GCAAATATATTTGGCCTTCTTGG + Intronic
1197577148 X:128228974-128228996 GCAAATATATTTTTCCAGCCTGG - Intergenic
1197999876 X:132422551-132422573 CCTATTATATTTTCCCTCCAAGG - Intronic
1198166823 X:134065941-134065963 CCAAATATGTTTTGCCTTCATGG + Intergenic
1200703789 Y:6424392-6424414 CCACAGATATTTTGGCTGCCAGG - Intergenic
1200802439 Y:7398921-7398943 GCAAATATATTTTTTCTGAAGGG - Intergenic
1200916471 Y:8575612-8575634 CCACAAATATTTTGGCTGCCAGG + Intergenic
1201030322 Y:9740315-9740337 CCACAGATATTTTGGCTGCCAGG + Intergenic
1201474850 Y:14369354-14369376 ACAAATATTTTTTGCCTACATGG - Intergenic