ID: 990716206

View in Genome Browser
Species Human (GRCh38)
Location 5:58639957-58639979
Sequence CTGTGGATAAAGAAAGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 718
Summary {0: 1, 1: 1, 2: 5, 3: 58, 4: 653}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990716206_990716208 16 Left 990716206 5:58639957-58639979 CCATTCTCTTTCTTTATCCACAG 0: 1
1: 1
2: 5
3: 58
4: 653
Right 990716208 5:58639996-58640018 AATGATTTTTTAAATGTACTAGG 0: 1
1: 0
2: 12
3: 96
4: 826
990716206_990716209 17 Left 990716206 5:58639957-58639979 CCATTCTCTTTCTTTATCCACAG 0: 1
1: 1
2: 5
3: 58
4: 653
Right 990716209 5:58639997-58640019 ATGATTTTTTAAATGTACTAGGG 0: 1
1: 1
2: 7
3: 71
4: 701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990716206 Original CRISPR CTGTGGATAAAGAAAGAGAA TGG (reversed) Intronic
900680125 1:3911992-3912014 CTGGAGACAAAGGAAGAGAAAGG - Intergenic
900849967 1:5135034-5135056 CAGTAGATAAAGACGGAGAAAGG - Intergenic
900856468 1:5189207-5189229 GTGTGGCTAAACAGAGAGAAAGG - Intergenic
901522783 1:9798091-9798113 CTGTCAACAAAGAAAGAGAGAGG + Intronic
901965057 1:12859670-12859692 CTGTGGGTAAAGTAAGGGAGAGG - Intronic
901973959 1:12929870-12929892 CTGTGGAGAAACACAGAGAGAGG + Intronic
902001641 1:13198907-13198929 CTGTGGGTAAAGTAAGGGAGAGG + Intergenic
902011221 1:13271898-13271920 CTGTGGAGAAACACAGAGAGAGG - Intergenic
902850267 1:19149893-19149915 TCGGGGAAAAAGAAAGAGAAAGG + Intronic
904105548 1:28079064-28079086 CTGGGGAAAAAAAATGAGAATGG - Intronic
904271975 1:29356109-29356131 CTGTGGAAGTAGGAAGAGAAGGG - Intergenic
904590295 1:31610756-31610778 CTGTGACTAAAGATAGAGGAAGG - Intergenic
904639390 1:31912500-31912522 AGGTGAATACAGAAAGAGAAAGG - Intronic
904833967 1:33323145-33323167 CCTTGAATAAAGAAGGAGAAAGG - Intergenic
906713293 1:47948731-47948753 CTGAGGTTAAGGAGAGAGAAAGG - Intronic
907377888 1:54059038-54059060 CTCTGTAAAAAGAAACAGAAGGG - Intronic
907603872 1:55796038-55796060 CTATGTATAAACAAACAGAATGG + Intergenic
907648488 1:56268744-56268766 CTGAGGTTAAATAATGAGAAGGG + Intergenic
907739916 1:57155197-57155219 CTGTGTATATGGCAAGAGAAAGG + Intronic
908173666 1:61532590-61532612 CTCTGAAAAAAGAAAGAGCATGG - Intergenic
908563444 1:65330348-65330370 ATGTGCACAAAGAAAAAGAAAGG - Intronic
908613695 1:65892815-65892837 CTCTGTAGAAAAAAAGAGAAGGG - Intronic
908641029 1:66223711-66223733 CAGTGCATAGAGAAAGAGGAGGG + Intronic
908775847 1:67639136-67639158 TCTTGAATAAAGAAAGAGAAGGG + Intergenic
908897278 1:68914442-68914464 CTGTGGAATGAGAAAGATAAGGG - Intergenic
909362033 1:74772050-74772072 CGGTGGGTAAAGAAGGAAAAAGG + Intergenic
909883118 1:80905187-80905209 CAGTGGATAAAGAGAGTGGAAGG + Intergenic
910120066 1:83777752-83777774 TTGTGCAGAATGAAAGAGAATGG - Intergenic
910596761 1:88989564-88989586 CTTTGGAAAATGGAAGAGAAAGG + Intronic
911683523 1:100746464-100746486 CTGTCTAGAAAGAAAGAAAAAGG + Intergenic
912001420 1:104839855-104839877 ATCTGTATACAGAAAGAGAAAGG + Intergenic
913119642 1:115728047-115728069 CTGTGGTTCAAGAAAGCGCAGGG + Intronic
913467878 1:119161196-119161218 CTGTACATAATGAAAGAAAATGG - Intergenic
914344989 1:146791360-146791382 TTGAGGAAAAACAAAGAGAAAGG - Intergenic
914422747 1:147544082-147544104 CTGAGGATATAGGAAGAGAAAGG + Intronic
915128953 1:153683975-153683997 CAGAGGAGAAAGAAAGAGAAGGG + Intronic
915637293 1:157195700-157195722 CTGTGGGGAAAGGCAGAGAAGGG + Intergenic
916289157 1:163145045-163145067 CTGTGGAGATATAAAAAGAATGG - Intronic
916390615 1:164326746-164326768 ATGAGGAGAAAGAGAGAGAAGGG - Intergenic
916506385 1:165431661-165431683 CTGGGGATAAAGAAATAGAAAGG - Intronic
918407191 1:184222919-184222941 CTGGGGACATGGAAAGAGAAAGG - Intergenic
918483859 1:185008451-185008473 ATGTTGAGATAGAAAGAGAATGG - Intergenic
919277492 1:195439822-195439844 CTGTGGATAAAGGAGGCCAAAGG - Intergenic
920727966 1:208455044-208455066 CAGTGCATAAAGAAATTGAAAGG - Intergenic
920830150 1:209457222-209457244 CAGTGTGGAAAGAAAGAGAAAGG - Intergenic
921061310 1:211587228-211587250 GTCTGGCTACAGAAAGAGAAAGG - Intergenic
921218107 1:212953863-212953885 CTGTGGACAAAGAAGGCCAAAGG - Intronic
921261647 1:213389671-213389693 CTGGGTAAAAAGAAAGGGAAGGG - Intergenic
921374501 1:214459953-214459975 CTGTAGTAAAAGAAAGAAAACGG - Intronic
921916373 1:220615407-220615429 CTGTTCATATATAAAGAGAAAGG - Intronic
922035147 1:221840452-221840474 GTCTGGGGAAAGAAAGAGAAAGG + Intergenic
922040369 1:221890430-221890452 CTTTGGAAACAGTAAGAGAAAGG - Intergenic
922396458 1:225206417-225206439 CTGTGGGTAAACAAATAGACAGG + Intronic
922539648 1:226409026-226409048 GTGTGTGTAAAGAAAGAGATGGG + Intergenic
924224524 1:241909915-241909937 CTGTAGATAATCAAAGACAAAGG - Intergenic
924250150 1:242124421-242124443 CTTTGGAGGAAGAAGGAGAAGGG + Intronic
924264348 1:242266726-242266748 CTGTGGATAATGATATGGAATGG + Intronic
1063444502 10:6101879-6101901 TTGTGGATTAAAACAGAGAAAGG + Intronic
1063545054 10:6972804-6972826 CTGTGTAAAAGGATAGAGAAAGG - Intergenic
1063560721 10:7124195-7124217 CTTTGGATTCAGAATGAGAATGG + Intergenic
1063811842 10:9720183-9720205 CTGGGGATCAAGAAAGAGAGTGG + Intergenic
1064755778 10:18570849-18570871 CAGTGGAGAATGGAAGAGAATGG - Intronic
1065095593 10:22277825-22277847 CTGTAGAGAAAGGGAGAGAATGG + Intergenic
1065193754 10:23240634-23240656 CTGTAGAGAAGGCAAGAGAATGG + Intergenic
1066067751 10:31774617-31774639 CTGGGTATAAAGGAAGAAAAAGG + Intergenic
1066164717 10:32774289-32774311 CTGTGGTTAAAAAAAAAAAAAGG - Intronic
1067311251 10:45115445-45115467 CTTTGCATAAAGAAAGACAGAGG + Intergenic
1067522541 10:47019223-47019245 CTGGGGAAAAAGAAGGAGATTGG + Intergenic
1067548132 10:47211210-47211232 CTGAGGAGAAAGAAATAGACAGG - Intergenic
1068392501 10:56416149-56416171 CTGTGATAAAAGAAACAGAATGG - Intergenic
1068863454 10:61869774-61869796 CTGTGGATAAAGGCAGGGAGAGG + Intergenic
1068974005 10:62988770-62988792 CTGAAGAGAATGAAAGAGAATGG - Intergenic
1069939254 10:71943160-71943182 CTGTGGATCACTAAAGAGCAAGG + Intergenic
1070237663 10:74646494-74646516 CTGTAGTTAAAGAGAGAAAATGG + Intronic
1070239263 10:74661691-74661713 ATGTGGATAATGAAAAAGAGAGG - Intronic
1070580957 10:77718926-77718948 CTGAGGATGGAAAAAGAGAATGG + Intergenic
1070660252 10:78300585-78300607 CTGGGGAAACAGAAAGTGAAGGG - Intergenic
1070782378 10:79145205-79145227 CAGTGGAGAAAGACACAGAAAGG - Intronic
1071074163 10:81731322-81731344 CTTTTGGTAAAGTAAGAGAATGG + Intergenic
1071114410 10:82200724-82200746 CAGAGGATAAAGAAAGAGAAAGG - Intronic
1071201333 10:83222799-83222821 CTGTGAATGTAGAAAGGGAAAGG + Intergenic
1071262621 10:83934436-83934458 CTCTTCATAAAGAAAGAGGAGGG + Intergenic
1072923096 10:99593243-99593265 CTGAAGATAAAGAGAAAGAAAGG + Intergenic
1074081806 10:110173887-110173909 CTGTCTTTAAAGAAAGAGATTGG + Intergenic
1074278742 10:112029956-112029978 CAGTGAGGAAAGAAAGAGAATGG - Intergenic
1074800379 10:116994498-116994520 CTGTAGAGACAGAGAGAGAAGGG + Intronic
1075058354 10:119236934-119236956 CTGTGGTAAAAGGAAGAGACTGG - Intronic
1076217552 10:128708507-128708529 CTGGGAATTTAGAAAGAGAAAGG - Intergenic
1076776731 10:132701855-132701877 CTTTGGAGAAAGAACCAGAACGG - Intronic
1077345235 11:2045337-2045359 CGGAGTATAAAGAAAGAGGATGG - Intergenic
1077716434 11:4585678-4585700 CTGTGGATAAAACAAGATTAGGG - Intergenic
1078058112 11:8023960-8023982 CTGTGAATAACTGAAGAGAAGGG - Intronic
1078215974 11:9312203-9312225 GTTTGGATAAGTAAAGAGAAGGG - Intronic
1078306888 11:10197841-10197863 TTATGGATAAACAAAGAAAATGG - Intronic
1078407578 11:11084049-11084071 AATTGGAAAAAGAAAGAGAAAGG - Intergenic
1078551908 11:12287064-12287086 CTGTGGAAAAAGAAAGGGACAGG - Exonic
1078910408 11:15725790-15725812 CTCTGGGTACAAAAAGAGAAGGG + Intergenic
1079247549 11:18763921-18763943 GTGTGGAGGAAGAAAGAGCATGG - Intronic
1080070692 11:28082089-28082111 CTATGGATAACCAAAGAAAATGG + Intronic
1080546604 11:33325574-33325596 CTAGGCAGAAAGAAAGAGAACGG - Intronic
1081041813 11:38223087-38223109 TTGGGGAAGAAGAAAGAGAAAGG + Intergenic
1081080866 11:38737608-38737630 ATGTGGAGAAAAAAAGAGCAGGG - Intergenic
1081194946 11:40150110-40150132 ATGGGGGTAAAGAAAGAGAATGG - Intronic
1081332752 11:41824742-41824764 CTTTGGATAAAAAAAGTGACAGG + Intergenic
1081430514 11:42971681-42971703 GTGTGGAGAAAGAGAGAGATGGG + Intergenic
1081932554 11:46882155-46882177 ATGGGAATAAAGAAAGAGGAGGG + Intronic
1082116878 11:48338320-48338342 CTGTCTGTAAAGAAAGAAAATGG - Intergenic
1082256916 11:50041990-50042012 CTGTGTGTAAAGAAGGAAAATGG + Intergenic
1083245505 11:61424367-61424389 CTGTGGTTCAAGGTAGAGAAAGG + Intronic
1084038555 11:66528505-66528527 GTGTGGATGCAGAAATAGAATGG + Intronic
1085839780 11:79998352-79998374 CTGAGGATCAGGAATGAGAATGG + Intergenic
1087022516 11:93617557-93617579 CTGAGGATGAAGTAAAAGAAAGG + Intergenic
1087279528 11:96194747-96194769 CTGAGAATAAAGAAAGGGAAAGG - Intronic
1088173250 11:107019573-107019595 CTGAGGATAGAGTAAGAGATGGG + Intergenic
1088347459 11:108843861-108843883 ATCTGCATAAAGAAAGTGAAAGG - Intronic
1089330239 11:117684273-117684295 GTGGGGAGAAAGAAGGAGAAGGG - Intronic
1089557280 11:119321341-119321363 CTCTGGTTAAAGAAAGAGTGGGG + Intronic
1090198075 11:124834102-124834124 CGGAGGAGAAAGAAAGAGCAGGG - Intergenic
1090436550 11:126691694-126691716 CTTTGGGTAGAGGAAGAGAAAGG + Intronic
1090671926 11:128954087-128954109 GTGAGGATCAAGAAACAGAATGG + Intergenic
1090766462 11:129880331-129880353 CTGTGGGGAATGAAGGAGAATGG - Intronic
1090923499 11:131229600-131229622 CAATGGATAAAGAAAGGGAAAGG + Intergenic
1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG + Intronic
1092025718 12:5238324-5238346 CTGTGAATAAAACAATAGAAAGG + Intergenic
1092246421 12:6866847-6866869 GTGTGAATAAAGAGAGGGAAGGG - Intergenic
1092516128 12:9215487-9215509 TTGTATAAAAAGAAAGAGAAAGG - Intergenic
1093063406 12:14631054-14631076 CTATTGAAAAAGAAAGGGAAGGG + Intronic
1093223078 12:16447014-16447036 CTGTGGAGAAAGGAATAGAGAGG - Intronic
1093239076 12:16646809-16646831 CTGTGTATGAAGAGAAAGAAAGG + Intergenic
1093397582 12:18702523-18702545 CTGAGGATGACAAAAGAGAAAGG - Intronic
1093540025 12:20271200-20271222 CTGTAAATAAAGAAATAAAAAGG - Intergenic
1093575325 12:20721045-20721067 TTGTGGATGAACAAAGTGAATGG + Intronic
1093783428 12:23164405-23164427 CTGTGGGAATAGAAAAAGAATGG - Intergenic
1094156086 12:27338221-27338243 AAGTGGATAAAGCAGGAGAAGGG + Intronic
1094303064 12:28987874-28987896 CGGTGGAGAAAGAGAGAGAATGG - Intergenic
1094505191 12:31055538-31055560 CTGAGGATAAAGATGGAGAGAGG - Intergenic
1095904176 12:47360529-47360551 CTGAGAGTAAGGAAAGAGAAGGG + Intergenic
1095972945 12:47916818-47916840 CTGTGGAAAGGGAAAGAGCATGG + Intronic
1096676271 12:53227688-53227710 CTAGGGAGAAAGAGAGAGAAAGG + Intronic
1097045377 12:56183931-56183953 CTGGGGATAGAGGAAGAGAAGGG + Intronic
1097527469 12:60755482-60755504 ATGTTGACAAAGTAAGAGAATGG + Intergenic
1099130277 12:78820389-78820411 TTGTGGATAATAAAAGAAAAAGG - Intergenic
1099244958 12:80183581-80183603 CTGGAGCTCAAGAAAGAGAATGG + Intergenic
1099443579 12:82726995-82727017 CTGTGGCTCAGGAAAGAAAAGGG - Intronic
1099820484 12:87702971-87702993 TTATGGATAAAGAAAGGAAATGG - Intergenic
1100027885 12:90151901-90151923 CTGGGGATTAAGGAAGAGAGAGG + Intergenic
1100214643 12:92434959-92434981 CTGTCTCTAAAGAAAGAGGAAGG - Intergenic
1100350698 12:93779215-93779237 CTGTGGTTTAAAAAATAGAAAGG - Intronic
1101850526 12:108398484-108398506 ATGTGAATAAAGATAGAGAAAGG - Intergenic
1101872165 12:108574961-108574983 TTATGGATAAACAAAGAAAATGG - Intergenic
1102653744 12:114462657-114462679 CTGAGGTTACAGAATGAGAACGG - Intergenic
1103620709 12:122185582-122185604 CTCTGGAAAAAGAAAGCCAAGGG - Intronic
1104445359 12:128828740-128828762 GTTTGGAAAAAGAAAGAGTATGG - Intergenic
1104587545 12:130059566-130059588 CTGTGGAAAAAAAAAAAAAAAGG - Intergenic
1105433604 13:20359061-20359083 CTGTGAAAAAAAAAAAAGAAAGG - Intergenic
1105870846 13:24505155-24505177 CAGAGGAGAAAGAAAGAGAGAGG + Intronic
1105975063 13:25466355-25466377 GTGTGGATTAGGAAAGGGAAGGG - Intronic
1106952671 13:34901910-34901932 TTGTGAATAAAGAAAGGGACAGG - Intergenic
1107196033 13:37652620-37652642 TTGTCTAGAAAGAAAGAGAAAGG - Intronic
1107265087 13:38544403-38544425 GTTAGGATAAAGAGAGAGAAAGG + Intergenic
1107664015 13:42670548-42670570 CCGTGGATAAAAGAAGAGATTGG - Intergenic
1107700937 13:43046969-43046991 CTGTGGGTCATGGAAGAGAACGG - Intronic
1108141337 13:47425309-47425331 CTGTGGAGAAAGAAAGAGGTGGG + Intergenic
1108301734 13:49084232-49084254 CTGTTGTTAAAGAAACAAAATGG - Intronic
1108423775 13:50277408-50277430 TTGTAGATGAAGAAAGAGCAGGG + Intronic
1108928915 13:55790020-55790042 AAATGGAGAAAGAAAGAGAAAGG - Intergenic
1109090780 13:58042033-58042055 CTTTAGATAAAGTATGAGAAAGG + Intergenic
1109487425 13:63045306-63045328 CTGTAAATGAAAAAAGAGAAAGG - Intergenic
1110410170 13:75196015-75196037 CTGTGGCTGTAGAAACAGAATGG - Intergenic
1111636351 13:90908782-90908804 GAGTGGATAAAGAAAGATCAAGG + Intergenic
1112492017 13:99875324-99875346 CTCTTAATAAAGAAAGAAAAAGG + Intronic
1112741219 13:102474763-102474785 CTGTGGATATTGAAAAAGGAAGG - Intergenic
1114220453 14:20691876-20691898 CTGTGGATCTAGAAAGACACAGG - Intronic
1114221929 14:20704443-20704465 CTGTGTGTAAGGAAAAAGAATGG - Intergenic
1114503182 14:23187212-23187234 ATATGGATTTAGAAAGAGAAAGG + Intronic
1114736370 14:25048058-25048080 TTGAGGATAGAGAAAGAAAAAGG + Intronic
1114899793 14:27043415-27043437 CTGTGGGTGAAGAAGGAAAAGGG + Intergenic
1115088717 14:29548293-29548315 CTCTCAAAAAAGAAAGAGAAAGG + Intergenic
1115725441 14:36210550-36210572 ATGTAGAGTAAGAAAGAGAAGGG + Intergenic
1116300568 14:43176045-43176067 CTGTTCACAGAGAAAGAGAATGG - Intergenic
1116456693 14:45127783-45127805 GACTGGATAAAGAAAGAGAAGGG + Intronic
1116735395 14:48684283-48684305 CTTTGGAAAGAAAAAGAGAACGG - Intergenic
1116900454 14:50357650-50357672 CTGTTGCTAGAGAAAGAGGACGG - Intronic
1117286546 14:54291258-54291280 GAGTGGAGGAAGAAAGAGAAGGG + Intergenic
1117316940 14:54580343-54580365 TTGTGAGTAAAGAAACAGAAAGG - Intronic
1118208955 14:63749200-63749222 AAATAGATAAAGAAAGAGAAAGG - Intergenic
1118266200 14:64296866-64296888 CTGTCCATCAAGAAAGACAATGG + Intronic
1118659800 14:67996018-67996040 CTGTGAAAAAAGAAAAAGTAGGG + Intronic
1118841445 14:69516202-69516224 AGGAGGAAAAAGAAAGAGAACGG - Intronic
1118903102 14:70002806-70002828 CTGTGGCTAAATAAACAGCAAGG + Intronic
1118915660 14:70101344-70101366 CAGTGGATAAAGAAAGAGAATGG + Intronic
1119360492 14:74045036-74045058 CTGAGGAAACAGAAACAGAAAGG - Intronic
1119552904 14:75528680-75528702 ATGTTGATTAAAAAAGAGAAAGG + Intronic
1120438668 14:84509272-84509294 CTGTCTCGAAAGAAAGAGAAAGG + Intergenic
1121910161 14:97782795-97782817 CTGTGGATACAGAGAGTAAATGG + Intergenic
1124060325 15:26287538-26287560 TTGTGGATAATAAAAGACAATGG - Intergenic
1124101220 15:26695637-26695659 ATCTGTATAAAGAAAGGGAAAGG + Intronic
1125061715 15:35433923-35433945 CTGTGGAAGAGAAAAGAGAAGGG + Intronic
1125119936 15:36143973-36143995 ATGTGGATAGATAAAGAAAAAGG + Intergenic
1125202479 15:37112011-37112033 CTGTGAATGAAGAAAAGGAATGG - Intergenic
1126008735 15:44282901-44282923 TTTTGGATAACGAAAGGGAAAGG - Intergenic
1126399572 15:48255788-48255810 CTGTGGATAAAGGAGGAAATTGG - Intronic
1126833373 15:52633514-52633536 TAGTGGCAAAAGAAAGAGAAGGG + Intronic
1126967333 15:54069867-54069889 CTGTGGCCAAGGAAAGAGAAAGG - Intronic
1127358362 15:58223482-58223504 TTCTAGAAAAAGAAAGAGAAAGG - Intronic
1127701075 15:61501805-61501827 CTGAGTAAAAACAAAGAGAAAGG + Intergenic
1128466124 15:67913852-67913874 CAGGGGTTAAGGAAAGAGAATGG + Intergenic
1128705752 15:69836549-69836571 CAGTGGAAACAGAAACAGAAAGG - Intergenic
1128922724 15:71627121-71627143 CTGAGGTTACAGAAAGGGAAAGG + Intronic
1129514147 15:76146683-76146705 CTGGGGACAAAGAAAAAGGAGGG + Intronic
1129627951 15:77224877-77224899 CTGTGGAAATGGAAAGAGATGGG - Intronic
1129663437 15:77566136-77566158 GTGTAGAAAGAGAAAGAGAAAGG + Intergenic
1130121317 15:81050037-81050059 CTGTGGAAATGAAAAGAGAAAGG + Intronic
1130176207 15:81574084-81574106 TTGTTGATAAAGGAAGAAAAAGG + Intergenic
1130199859 15:81814992-81815014 CTGTGAAAAAAGAAAAAAAAGGG + Intergenic
1130320693 15:82838288-82838310 CTGTGCAATAAGCAAGAGAAAGG + Intronic
1130398129 15:83522480-83522502 CTGTTGATAAAGGAAGAGGCAGG + Intronic
1130430765 15:83844757-83844779 CTGTGCATGAAGAGAGATAATGG + Intronic
1130764480 15:86856179-86856201 CAGGAGATAATGAAAGAGAAAGG - Intronic
1131355427 15:91741780-91741802 CTGTGGAAAAAAAAAAAAAAAGG + Intergenic
1131593536 15:93773808-93773830 CTGAGGATAAGGAAAGTGTAGGG - Intergenic
1131625979 15:94121273-94121295 CTGTGTATAAAGAAAGATCCAGG + Intergenic
1131723298 15:95195319-95195341 CAGTTGTTAAAGAAGGAGAAGGG + Intergenic
1131803943 15:96101964-96101986 CTGTGGCTAAAAAAAAAAAACGG + Intergenic
1132010045 15:98267635-98267657 CTGTGGCTTAAGGGAGAGAAGGG + Intergenic
1132644151 16:991070-991092 CACCGGATAAAGAAAGACAAAGG - Intergenic
1132839811 16:1973536-1973558 CAGTGGAGAAGGAAGGAGAAGGG + Intronic
1133871308 16:9689078-9689100 CTGTGGCTGAGGGAAGAGAATGG - Intergenic
1134318370 16:13140179-13140201 CTGTCTAAAAAGAAAGGGAAGGG - Intronic
1134586196 16:15413532-15413554 TTGTGGACAAAGAAAGAGGAAGG - Intronic
1135503952 16:23020285-23020307 CTGTAGAGAAAGAAAGGAAATGG - Intergenic
1135933689 16:26761127-26761149 GTGTGAATAAAGCAAGAAAAAGG - Intergenic
1135939393 16:26808239-26808261 CTGGGGATAACGAATCAGAAAGG - Intergenic
1137394256 16:48105846-48105868 CTTGGGAAAAAGAAAGGGAAGGG - Intronic
1138398282 16:56724835-56724857 CTGTATATAAAAAAATAGAAAGG - Intronic
1138496131 16:57410471-57410493 CTGTGGCCAAAGGAAGGGAAAGG - Intronic
1138515070 16:57531403-57531425 CTGTGGACAAAGAAGGTGGATGG - Intronic
1138750740 16:59417136-59417158 GTGTGGATAGGGACAGAGAATGG - Intergenic
1139078828 16:63489355-63489377 CTGTTGAAAGAGAAAGAAAAAGG - Intergenic
1139079796 16:63502519-63502541 CTGAGCATGAAGAAAGAAAAAGG + Intergenic
1139439036 16:66955215-66955237 CTGTCTCTAAAGAAAAAGAAAGG - Intergenic
1139989003 16:70923944-70923966 TTGAGGAAAAACAAAGAGAAAGG + Intronic
1140084138 16:71778737-71778759 ATGTTGAAAAAGAAAGATAAAGG + Intronic
1140514732 16:75533712-75533734 CTGTGTAAAAGGAGAGAGAAAGG + Intronic
1141283330 16:82648588-82648610 CTCTAAATAAAGAAAAAGAAGGG + Intronic
1143132272 17:4686475-4686497 CTGTGGATAATGGATTAGAAAGG - Intronic
1143464837 17:7129656-7129678 CTGTGGAGAAAAACAGAGCAAGG - Intergenic
1143483132 17:7238509-7238531 CTGTGGAGAGAGAGAGAGAGTGG - Intronic
1143665771 17:8358726-8358748 GTGTGGAGAGAGAGAGAGAAGGG - Intergenic
1143955172 17:10662441-10662463 CTACAGAGAAAGAAAGAGAAGGG - Intergenic
1143957853 17:10687622-10687644 CTCTGAGTAAATAAAGAGAAAGG + Intronic
1144537504 17:16105214-16105236 CTGTGGAAGAAAAAACAGAATGG + Intronic
1144876844 17:18401589-18401611 CTGGGGAGATAGCAAGAGAAAGG - Intergenic
1145155386 17:20542829-20542851 CTGGGGAGATAGCAAGAGAAAGG + Intergenic
1146838417 17:36131672-36131694 CTGTTCATTGAGAAAGAGAAGGG - Intergenic
1146846535 17:36184617-36184639 ATGTGGAGAAAGAAGCAGAATGG - Intronic
1147236673 17:39062821-39062843 ATCGGGATAATGAAAGAGAAAGG + Intergenic
1147424080 17:40337423-40337445 CTGGAGAGAAAGAAAGATAAGGG + Intronic
1148344807 17:46895971-46895993 CTGGGGATTAAGAAAGACCAAGG + Intergenic
1149189762 17:54046581-54046603 CTGGGGATAAAGAAAATGTAAGG - Intergenic
1149605245 17:57920053-57920075 CTGTGGATCAGGAATAAGAATGG - Intronic
1149930594 17:60750843-60750865 CAGTGGATAAGGAACAAGAAGGG - Intronic
1150055949 17:62016221-62016243 ATGAGGAAAAAAAAAGAGAAGGG - Intronic
1150182443 17:63138640-63138662 CTGATCATTAAGAAAGAGAAAGG - Intronic
1150576050 17:66431984-66432006 CTAAGGATAAAAAAAGGGAACGG - Intronic
1150588750 17:66542225-66542247 CTAAGCATAAAGAAAGAAAAAGG - Intronic
1151709417 17:75793656-75793678 CTGTGAATAAAGAATAAGGAAGG - Intronic
1153176573 18:2380533-2380555 CAGTGGATGAAGAAAAAAAATGG + Intergenic
1153436718 18:5075691-5075713 CTGGGGATTAAGAAAAAGTAGGG + Intergenic
1154972238 18:21421920-21421942 TTGTGGCTAAAGAAATAAAATGG - Intronic
1155649753 18:28127100-28127122 CTGTGTATAAAGAAACCAAATGG + Intronic
1155793168 18:29998717-29998739 ATGTGGTAAAAGCAAGAGAAAGG - Intergenic
1155851523 18:30780786-30780808 ATGTGGATGAAGAAAGAGCAGGG + Intergenic
1156717255 18:40026138-40026160 CTGTGTGTGAAGAAAGAGAGGGG + Intergenic
1157006234 18:43588422-43588444 CTGGGGCTGAAGAAAGAGACTGG + Intergenic
1157995696 18:52552505-52552527 CTGTTTATAAAGAAACAGAATGG + Intronic
1158648981 18:59269823-59269845 CTATGGATAAACAGAGAAAAGGG - Intronic
1159017845 18:63116286-63116308 CTGTGGAAAAACAAAGAATACGG + Intergenic
1159317326 18:66793173-66793195 AATTAGATAAAGAAAGAGAAGGG - Intergenic
1159507907 18:69359915-69359937 CTGCTGATAAAGACATAGAATGG - Intergenic
1159549556 18:69880221-69880243 GGGAGGAGAAAGAAAGAGAAAGG + Intronic
1159652789 18:70997402-70997424 ATGTGGATGAATAAAGAGCAGGG + Intergenic
1161743073 19:6036409-6036431 CTCTGGACAAAGGAAGAGAGAGG + Intronic
1162294444 19:9803461-9803483 CACTGCATAAAGAAAGACAATGG + Intergenic
1162577659 19:11508103-11508125 CTGGGGACAGAGAAACAGAAAGG + Intronic
1163500985 19:17676042-17676064 CTGTGGAGAGAGACAGAGATAGG + Intronic
1164082951 19:21876301-21876323 CTGTGCATAGAGAGTGAGAAGGG - Intergenic
1164190931 19:22916418-22916440 CTGTGCATAGAGAGTGAGAAGGG - Intergenic
1164393378 19:27844370-27844392 CTGTTGATTAAAAAAGAGATCGG + Intergenic
1164619521 19:29686304-29686326 CTATGGGTAATGACAGAGAAGGG + Intergenic
1167254692 19:48419986-48420008 TTGTGGATGAAGAAAGAACACGG + Intronic
1167768242 19:51498288-51498310 CTGTAGAGAAAGAGACAGAAGGG + Intronic
1167943519 19:52966810-52966832 TGGTGGAGAAAGGAAGAGAAGGG + Intergenic
1168356341 19:55702423-55702445 GTGTGCCTAAAGAAAGGGAAAGG + Intronic
924973142 2:149609-149631 TGGTGGATAGAGAGAGAGAACGG - Intergenic
925031974 2:657801-657823 CTGTTGAGAAATACAGAGAAAGG - Intergenic
925693360 2:6548396-6548418 CTGGAGAGAAAGAAAGAAAAAGG + Intergenic
925804466 2:7634471-7634493 CTGTGGAGAAAAAAAAAAAAAGG - Intergenic
926321215 2:11749445-11749467 CTGTGGAAAGAGGAAGAGGAAGG - Intronic
926897439 2:17709711-17709733 CAGAGAATAAAGAAAAAGAAGGG + Intronic
927087251 2:19684669-19684691 ACGTGGATAAAGACAGAGAGAGG - Intergenic
927344407 2:22020791-22020813 TTGTGGATTAAAATAGAGAAAGG - Intergenic
927374144 2:22393739-22393761 TTCTGTATAAATAAAGAGAAAGG + Intergenic
927502491 2:23591893-23591915 CTGGAGATAAAGGAAGAGGAAGG - Intronic
927758424 2:25727653-25727675 CTGGGGACAAAAAAAGAGAAGGG + Intergenic
928662551 2:33517918-33517940 CTGTGGATATAGCATGAGCAAGG - Intronic
929166879 2:38891408-38891430 CTGTCATTAAAGAAAAAGAAAGG - Intronic
929394628 2:41508587-41508609 CTCTGGATATAGAAAAAGAATGG - Intergenic
929549461 2:42880241-42880263 CTCTGGCTCAGGAAAGAGAACGG + Intergenic
930155876 2:48107135-48107157 CTGTGGATGATGCAAGGGAATGG - Intergenic
930616337 2:53598529-53598551 CTGTCTCTAAAGAAAAAGAAAGG + Intronic
931324400 2:61203693-61203715 GTGTGGGTAAAGAAAGATAAAGG + Intronic
931691846 2:64840340-64840362 CTATGTATTAAGAAAGAAAAAGG - Intergenic
932017466 2:68046411-68046433 CTGTTAAAAAAGAAAGAGAGAGG + Intronic
932209091 2:69913067-69913089 CTGAAGAAAAAGAAAGACAAAGG - Intronic
932457036 2:71856508-71856530 CTTAGGATAAAGGGAGAGAAAGG - Intergenic
932509728 2:72273671-72273693 ATGTGGATATACCAAGAGAATGG + Intronic
933857200 2:86427523-86427545 CTGAGGGTGAAGCAAGAGAATGG + Intergenic
933893003 2:86788559-86788581 CCCTGGATAAGGAAAAAGAAGGG + Exonic
934161945 2:89258012-89258034 GTGTGGAAAAAGCAAGAGATGGG + Intergenic
934205337 2:89924350-89924372 GTGTGGAAAAAGCAAGAGATGGG - Intergenic
934648736 2:96074545-96074567 CTGTTACCAAAGAAAGAGAATGG - Intergenic
935032118 2:99332817-99332839 CTGTGGATTAATATAGAGATTGG + Intronic
935426627 2:102925722-102925744 CTGGGGAAAAAAAAGGAGAAAGG + Intergenic
935442736 2:103121394-103121416 CAGTGTGTAAAGAAGGAGAAAGG + Intergenic
935811536 2:106802829-106802851 CTGTGGTAAGAGACAGAGAAAGG - Exonic
936343958 2:111661217-111661239 CTCTGGAAAAAGAATGAGACAGG - Intergenic
936396503 2:112135878-112135900 CTGAGGACAAAGACAGAGAAAGG + Intergenic
936616462 2:114052884-114052906 CTGCAGAGAAAGAGAGAGAATGG - Intergenic
937173155 2:119897637-119897659 CTATGAAAAAAGAAAGAAAATGG - Intronic
937749724 2:125460808-125460830 CAAGGGAAAAAGAAAGAGAAGGG - Intergenic
939134482 2:138277252-138277274 ATGTGGATAAAGGCAGATAAGGG + Intergenic
939548022 2:143577727-143577749 CTGTGGCTAAGGAAATAGAATGG + Intronic
939917677 2:148067672-148067694 CTGGGGATAATGTAAGACAAGGG - Intronic
939955974 2:148527957-148527979 CTGTGGATCAGGAAAGAGCAGGG - Intergenic
940961897 2:159795725-159795747 CTGTGGATACACAGAGTGAATGG + Intronic
941242239 2:163053805-163053827 CCGTGGAGATAGAAAGTGAAAGG - Intergenic
941621029 2:167779207-167779229 ATGTGTAGAAAGAAAGAAAAAGG - Intergenic
941856729 2:170238855-170238877 AGGTGGATAAAGGAAGAAAAGGG - Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942214747 2:173707681-173707703 GTGTGGATAATGAGGGAGAATGG + Intergenic
943049505 2:182897898-182897920 CTTTTGATATAGAATGAGAAAGG - Intergenic
943338407 2:186646663-186646685 CTGTGGGGAAAAAAAGAGGAGGG - Intronic
943542257 2:189231388-189231410 AAGAGAATAAAGAAAGAGAAAGG + Intergenic
944032383 2:195251144-195251166 CTGTGGAATTAGAGAGAGAAAGG + Intergenic
945975214 2:216265099-216265121 CAGTGGATAGAGAAATAGACTGG + Intronic
946316302 2:218915512-218915534 TTGTGGGTAAGGAAAGATAAAGG + Intergenic
946386007 2:219384937-219384959 CTGTGGGTCAAGAAAAGGAAGGG + Intronic
946907175 2:224428640-224428662 TTGTGTATAAAGAGAGAGAATGG - Intergenic
946984202 2:225253391-225253413 CTGAGGACAAAGGAAAAGAAAGG - Intergenic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
1169402589 20:5295624-5295646 CTGTGGAGAAACAAAGAGGATGG - Intergenic
1169524857 20:6413296-6413318 CTGAGGATGCAGAAAAAGAAAGG + Intergenic
1169573981 20:6938124-6938146 GGTTGGATAAAGAAAGAGGAAGG + Intergenic
1169799088 20:9496790-9496812 ATGTGGAAAGAGAAAGAGAGAGG + Intergenic
1170142806 20:13142083-13142105 CTTTGGATAAAGTAAATGAAGGG - Intronic
1170412349 20:16105146-16105168 TTGTGGATAGAAAAAGAGAAGGG - Intergenic
1170530119 20:17282746-17282768 CTGTGAAAAAAAAAAAAGAAAGG + Intronic
1170782041 20:19434619-19434641 ATGTAGAGAAAAAAAGAGAATGG - Intronic
1173341962 20:42161059-42161081 CTTTGGATAATGAAAGGGGAAGG + Intronic
1173343334 20:42175026-42175048 CTATGGATAGGGAAAGAGAGGGG - Intronic
1173785417 20:45789594-45789616 CTGCAGATAACGAGAGAGAAAGG + Intronic
1173878760 20:46394533-46394555 CTGGGGAGAAAGAATCAGAAAGG + Intronic
1173940822 20:46909701-46909723 CTGTGGATGGAGTGAGAGAAAGG + Intronic
1174062350 20:47841737-47841759 CAGGTGAAAAAGAAAGAGAAGGG - Intergenic
1174473363 20:50777939-50777961 CTGTCAAGAAAGAAAGAGAAAGG - Intergenic
1174716792 20:52767374-52767396 CTTTTGATAGAGAAGGAGAAAGG + Intergenic
1174758124 20:53180137-53180159 CTGTGACAAAAGAAAGAGATTGG + Intronic
1174931858 20:54824832-54824854 CAGTGGGTAAAGAGAGAGAGAGG + Intergenic
1177528947 21:22336317-22336339 CTGTGCATTAGGAAAGAGACTGG + Intergenic
1177548940 21:22596334-22596356 CTTTGGAGACACAAAGAGAATGG + Intergenic
1177993650 21:28069337-28069359 TTTTGGATAAAGATAGTGAATGG - Intergenic
1178155325 21:29846686-29846708 CTCTGCTTAAAGAATGAGAAGGG + Intronic
1178319407 21:31593891-31593913 ATGTGGAAAAGGAAAAAGAAAGG - Intergenic
1179275401 21:39887804-39887826 CTGTTTATAAAGAAACAAAAAGG - Intronic
1179836001 21:44034028-44034050 ACGTGCATAAAGACAGAGAAAGG + Intronic
1180134232 21:45851211-45851233 CTTTGGTTAAAGAAAGTGGAAGG + Intronic
1180688184 22:17686807-17686829 ATGTTGATAAAGAAATATAATGG - Intronic
1181931941 22:26408858-26408880 CTGTGTCTCAAGAAAGAAAAAGG - Intergenic
1182106810 22:27695534-27695556 CTGTCAAGAAAGAAAGGGAAGGG + Intergenic
1182466817 22:30522043-30522065 CTCTGTAAAAAGAAAGAAAAAGG - Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1184256722 22:43291181-43291203 CTGTGAGAAAAGGAAGAGAAGGG + Intronic
1184329458 22:43817619-43817641 ATGTGGAGAAAGAAACAGTAGGG + Intergenic
1184617982 22:45651021-45651043 GTGTGAATGAACAAAGAGAATGG - Intergenic
1184714346 22:46272465-46272487 CTGTGGTAAAGGAAAGAGAGGGG - Intronic
949146707 3:709703-709725 CTGTGGCAAGAGAAACAGAAGGG - Intergenic
949171849 3:1009282-1009304 TTGGGAATAAAGAGAGAGAAAGG - Intergenic
949467882 3:4362255-4362277 CTGTGTAGAGAGAAAGAGCAAGG + Intronic
950885394 3:16358048-16358070 CTGTGGAAAAAGAAAAAGGCGGG + Intronic
951088561 3:18544204-18544226 CTGTGGATAAGGTAAGGCAATGG - Intergenic
952084212 3:29798018-29798040 CTGAGGACAAAGAAAGAGATGGG + Intronic
952531829 3:34270905-34270927 CTTTGGAAAGACAAAGAGAAAGG - Intergenic
953735036 3:45486408-45486430 CTGAGAATGAACAAAGAGAAGGG + Intronic
953869656 3:46615391-46615413 GTGTGGAAAATGAAGGAGAAGGG - Intronic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
954142910 3:48619569-48619591 AAGGGGAAAAAGAAAGAGAAAGG + Intergenic
955010480 3:55009798-55009820 CTGTGAAAACAGAAATAGAATGG - Intronic
955044300 3:55345273-55345295 CTGAGTATACTGAAAGAGAAAGG + Intergenic
955187818 3:56731931-56731953 CAATGGAAAAAGACAGAGAAAGG + Intronic
955259338 3:57369415-57369437 CTGTTGGAATAGAAAGAGAATGG - Intronic
955731361 3:61990954-61990976 GTTTGGAGAAAGAAAGAAAATGG - Intronic
955740520 3:62086332-62086354 CTCTGGAGAGAGAGAGAGAAGGG + Intronic
955939592 3:64134796-64134818 TTGAGTATAAAGAAAGAAAAAGG + Intronic
956030079 3:65028085-65028107 CTGAGTAAAAAGAAAGAGAAAGG + Intergenic
956490383 3:69765095-69765117 CCGTGGAAACAGAAATAGAAAGG + Intronic
956499478 3:69866417-69866439 GGGAGGATAAAGGAAGAGAAGGG + Intronic
956619637 3:71208499-71208521 ATTTTGATAAAGAAAGAAAAAGG - Intronic
957165514 3:76668277-76668299 TTGTAGAGAGAGAAAGAGAAAGG + Intronic
957485040 3:80849978-80850000 CTGTGTGAAAAGACAGAGAAGGG + Intergenic
957575423 3:82001358-82001380 CTATGGAAATAGAAAGAGAATGG - Intergenic
958028879 3:88082969-88082991 ATGTGCATAGAGAAAGAGAGAGG + Intronic
958658073 3:97028531-97028553 CCTTGGAAAGAGAAAGAGAAAGG - Intronic
958849589 3:99307988-99308010 ATGTGGATAAAGACAAACAATGG + Intergenic
959027873 3:101262033-101262055 CTGAGGAGAAAGAATAAGAAAGG - Intronic
959071960 3:101710411-101710433 CTGATGATATAAAAAGAGAAAGG - Intergenic
959093941 3:101933463-101933485 CTTTGCAGAAAAAAAGAGAAGGG + Intergenic
959477492 3:106828867-106828889 CTGTGTTTATACAAAGAGAAAGG - Intergenic
959803793 3:110527083-110527105 CTGTGGAGGAAGAAAGGCAATGG + Intergenic
960373801 3:116873626-116873648 CCCTGGATAAAGGAAAAGAAAGG - Intronic
961344082 3:126250306-126250328 AGGTAAATAAAGAAAGAGAAAGG - Intergenic
962391715 3:134977943-134977965 CTGTGGAAAGAAAAACAGAATGG - Intronic
962412564 3:135154129-135154151 CTGTGGAGAGAGAAAGAAACAGG - Intronic
962609777 3:137065330-137065352 CATGGGATAAAGAAAGAGAGAGG + Intergenic
963034697 3:141015779-141015801 CAGTGGAAAAAGAAAACGAACGG + Intergenic
963155341 3:142090508-142090530 CAGAAGACAAAGAAAGAGAATGG - Intronic
963510752 3:146245174-146245196 CTATGGATAAGGAAAGAAAATGG + Intronic
964080086 3:152743855-152743877 CTATGGAGAAAGATAAAGAAGGG - Intergenic
964230487 3:154461310-154461332 GTGTGGATAAGGATAAAGAAGGG - Intergenic
964810653 3:160660256-160660278 CTGGGGATTTGGAAAGAGAATGG + Intergenic
965686767 3:171312032-171312054 CTGTGGAGAAAAAAAGGGAGGGG + Intronic
966888263 3:184388564-184388586 CTGTTGAGAGGGAAAGAGAAAGG - Intronic
966895915 3:184444948-184444970 GTCTGGAGAAGGAAAGAGAAGGG - Intronic
966971212 3:185047137-185047159 ATGTGGCTACAGAAACAGAAAGG - Intronic
967471363 3:189865622-189865644 CAATGGAAGAAGAAAGAGAATGG + Intronic
967577330 3:191108817-191108839 ATGGGGAGAAAGAGAGAGAAGGG - Intergenic
967726843 3:192870155-192870177 CTGTGGATTAGGAAAGACAGAGG - Intronic
968144847 3:196289375-196289397 CTGTGGACAAAGAAAATGGATGG + Intronic
968641081 4:1715371-1715393 CTGTGGGTCAAGAAGCAGAATGG + Intergenic
970095639 4:12460320-12460342 CAATGGATAAAGAGTGAGAAAGG - Intergenic
970519271 4:16865739-16865761 CTTTGGAGAAACAAAGAGAAGGG + Intronic
970932695 4:21531380-21531402 CTGTCAAGAAAGAAAGAAAAAGG - Intronic
971269613 4:25129229-25129251 CTTTAAATAACGAAAGAGAAAGG - Intronic
971370366 4:26014370-26014392 CTGTGGGCAAAGAAAGGGCAAGG - Intergenic
971739018 4:30497056-30497078 CTCTGGATAAGGAAATAGAATGG + Intergenic
971839243 4:31812103-31812125 ATGTTCATAAAGAAACAGAAAGG - Intergenic
972775160 4:42233432-42233454 CTGTGCAGAAAGAAACACAATGG + Intergenic
973154022 4:46925873-46925895 ATGTGGCCAAAGAATGAGAAAGG - Exonic
973171825 4:47154839-47154861 CTGTAGAGAAAGAAAGAAAATGG - Intronic
974355603 4:60808850-60808872 CTGTGAACAAAGACAGAGAGGGG - Intergenic
974377916 4:61101682-61101704 ATAAGGAGAAAGAAAGAGAAAGG + Intergenic
974506123 4:62774471-62774493 CTAAGGAGAAAGAAAAAGAAGGG + Intergenic
975086727 4:70350321-70350343 GGGTGGAGAAAAAAAGAGAATGG - Intergenic
975260039 4:72287407-72287429 GGGAGGATAAAGAAAGAGAAAGG + Intronic
975341660 4:73249294-73249316 ATGGGGATAAAAAAAGTGAAAGG + Intronic
975450417 4:74519071-74519093 CACTGGATAAAGTAAGATAAAGG - Intergenic
976295246 4:83464800-83464822 CAGTGGATGAAGAAACAAAAAGG + Intronic
976826976 4:89271756-89271778 CAGTAGAGAAAGAAAGACAAGGG + Intronic
977069699 4:92369331-92369353 CTGTGGAAAAAGACATAGAAAGG + Intronic
977243964 4:94607241-94607263 CTGTGGATAAAAAAATAGAATGG - Intronic
977612256 4:99048151-99048173 CTGTTGTTAAAGAAAGCAAAAGG + Intronic
977769221 4:100837299-100837321 ATGTGGAGAAAGAAAGAGAGAGG - Intronic
977912003 4:102548132-102548154 ATGTGGAGAAAGAGAGAGAAAGG + Intronic
978060320 4:104328810-104328832 AAGTGGTTAAAAAAAGAGAATGG + Intergenic
978124525 4:105120061-105120083 ATGTGGGTAATAAAAGAGAAGGG - Intergenic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
978758167 4:112326521-112326543 CTGTGGAGAGAGAGAAAGAAAGG + Intronic
979972305 4:127150614-127150636 ATGTGTATAAAGGAAGAAAATGG - Intergenic
980057371 4:128091320-128091342 ATGTGAATAAAGAAAAAGAAAGG - Intronic
980255000 4:130368223-130368245 CTCTGTATAAAGAGAGAGAATGG + Intergenic
980267250 4:130533302-130533324 ATGTGGAGAAAATAAGAGAAAGG - Intergenic
980856596 4:138447871-138447893 TTATAGATAAAGAAAGAAAACGG - Intergenic
980864018 4:138532461-138532483 CTGTAGATAAACAAACTGAAAGG + Intergenic
981835654 4:149050426-149050448 GTGAGGCTATAGAAAGAGAAAGG + Intergenic
981866677 4:149429242-149429264 CAGTGCATAAGGAAAGACAACGG + Intergenic
982647224 4:158038543-158038565 TTCTAGATAAAGAAAGAAAAGGG + Intergenic
983992439 4:174137598-174137620 CTCTGGATGATGAAAGACAATGG - Intergenic
984184014 4:176520478-176520500 CTTTGGAAAAAGAAAAGGAAAGG + Intergenic
984245813 4:177274490-177274512 CTGTGGAGAAAGGAAGAGCTGGG + Intergenic
984794977 4:183651659-183651681 CGTGGGATACAGAAAGAGAATGG + Intronic
984964717 4:185129734-185129756 CTGTGAAAAAAGAAAGAAAAGGG - Intergenic
985361612 4:189181749-189181771 CTTTGGAAAAAGAAAGAAAGAGG - Intergenic
985699164 5:1360299-1360321 CTGTGGAAAAAGAAAAAGCTAGG + Intergenic
985969852 5:3366214-3366236 CTTTGGATACAGCAAAAGAATGG - Intergenic
987060665 5:14240337-14240359 GTGGGGATAAAGGAAGAAAAGGG + Intronic
987080901 5:14424400-14424422 CTTTGGATAGAGAAAAAGTATGG + Intronic
987085876 5:14467299-14467321 CTGTGGATGAAGGAAGAAATGGG - Intronic
987705690 5:21459943-21459965 CTGGAGAGAAAGGAAGAGAAAGG + Intergenic
987726659 5:21709403-21709425 CTGAGGAGAAGGAAAGAGATGGG - Intergenic
987929048 5:24379772-24379794 CTGGAGATAAAGAAAGAATAGGG - Intergenic
988754296 5:34229946-34229968 TTATGGAGAGAGAAAGAGAAGGG - Intergenic
989512979 5:42309881-42309903 ATGTGGGTAGAGAAGGAGAAAGG + Intergenic
990206991 5:53440403-53440425 CTATGGAAACAGAAAGACAAGGG + Intergenic
990716206 5:58639957-58639979 CTGTGGATAAAGAAAGAGAATGG - Intronic
990788767 5:59453243-59453265 CTGAGGAGAAAGAGAGAGATAGG - Intronic
991252556 5:64579808-64579830 GTGAGAATAAAGAAATAGAAAGG - Intronic
991711901 5:69416269-69416291 TTTTAGAGAAAGAAAGAGAAAGG + Intronic
992028037 5:72690660-72690682 AAGTTGCTAAAGAAAGAGAAAGG - Intergenic
992416810 5:76559705-76559727 ATGTTGATGAAGAAAAAGAAGGG + Intronic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
992877719 5:81074300-81074322 CTGTGGAGAAAAATAAAGAAGGG + Intronic
993038488 5:82784759-82784781 CTGTGGCTAAATTATGAGAATGG - Intergenic
993739100 5:91515341-91515363 TTGTGGCTCATGAAAGAGAATGG - Intergenic
993857348 5:93092951-93092973 CTGTGGAGACAGATAGAAAAGGG - Intergenic
994363480 5:98883425-98883447 CTGGTGAAAAAGAAAGAAAACGG + Intronic
994530335 5:100961211-100961233 CTGATGACAAAGAAAAAGAAAGG + Intergenic
994671054 5:102762206-102762228 CTGTGGCAAATAAAAGAGAAAGG - Intronic
995547685 5:113249188-113249210 CTGTGGATCCAGAAACAGAAGGG + Intronic
995891523 5:116958129-116958151 TTGGGGAAAAAAAAAGAGAAAGG + Intergenic
996185870 5:120474517-120474539 CTAAGCATAAAGAAAGAAAAAGG - Intronic
996215898 5:120865124-120865146 CTGTGAATACAGAAAGAGAATGG - Intergenic
996404335 5:123090784-123090806 CGTTGGAGAAGGAAAGAGAACGG + Intronic
997298979 5:132788558-132788580 CTGTTAGAAAAGAAAGAGAATGG + Intronic
998171919 5:139877527-139877549 CTGTGGATAAACAAGGAGCCTGG + Intronic
998264132 5:140654310-140654332 CTGTGGTAAATGAAACAGAAGGG - Intronic
999084304 5:148873596-148873618 CTGTTGATGAGGAAAGAAAATGG + Intergenic
999299554 5:150482723-150482745 CTGTGGCTTAAGGAAGAGAGGGG - Intergenic
1000236832 5:159369822-159369844 CTGTGGACAACTAAAGAGCAAGG + Intergenic
1000242489 5:159421531-159421553 CTGAGGATAAATAATGAGCAAGG + Intergenic
1000892845 5:166819555-166819577 CCTTTGAAAAAGAAAGAGAAAGG - Intergenic
1000932187 5:167265022-167265044 ATGTGGATAAAGGAAAGGAAAGG + Intergenic
1001568074 5:172713323-172713345 CTGTGGACAAATAAAGACTAAGG + Intergenic
1001597793 5:172909136-172909158 CTGGGGCTCAGGAAAGAGAAGGG - Intronic
1002546192 5:179946885-179946907 CCGAGGCTAAAGAAAGATAAAGG - Intronic
1002999112 6:2314435-2314457 CTGTGGACCACTAAAGAGAAAGG - Intergenic
1003271440 6:4611185-4611207 CTGTTCATAAGGAGAGAGAAAGG + Intergenic
1003422993 6:5974621-5974643 CTGAAGATAAAGAAAGAAAGTGG + Intergenic
1003440463 6:6136654-6136676 CTGAGGAAAAAGAAATGGAATGG + Intergenic
1003921993 6:10841087-10841109 GAGTGGAGAAAGAAAGAGTAGGG + Intronic
1004104180 6:12649574-12649596 CAGAGGAGAAAGAAAGAGACAGG - Intergenic
1004139496 6:13003107-13003129 ATTTGGGAAAAGAAAGAGAAAGG + Intronic
1004402288 6:15299876-15299898 CAGTGGGTAAAGTACGAGAAAGG - Intronic
1005457656 6:26036536-26036558 CTGTGGAGAAAAATAAAGAAAGG + Intergenic
1005476908 6:26216919-26216941 CACTGAATAAAGAAAAAGAATGG - Intergenic
1005552479 6:26936801-26936823 TTATGGAGAGAGAAAGAGAAGGG - Intergenic
1005696042 6:28353751-28353773 CTGTGGATAGAGAAAAGAAAAGG + Intronic
1005740404 6:28785839-28785861 AGGTGGATAAAAAAACAGAATGG + Intergenic
1006093971 6:31644472-31644494 CTCTGGGTAGAGAAAGGGAAGGG - Intronic
1006216444 6:32447624-32447646 CTTTGGATAAATACATAGAAGGG + Intergenic
1006318272 6:33303990-33304012 CTGTGGGGAAAGATTGAGAAGGG + Intronic
1006468379 6:34210344-34210366 CTATGTTTAAAGAAAGAAAATGG - Intergenic
1006874316 6:37282155-37282177 CATTTGAAAAAGAAAGAGAACGG - Intronic
1007291315 6:40789137-40789159 GTGTGTGTAAAGAAAGAGAAAGG - Intergenic
1007663012 6:43497884-43497906 CTGTGGCTAAAGGAAGTGGAGGG + Exonic
1008428761 6:51390149-51390171 CTTTGTATAAAGAAAGAGCTAGG + Intergenic
1009418016 6:63437030-63437052 CTGTCAAAAAAGAAAGAAAAGGG + Intergenic
1009726497 6:67542509-67542531 CTGTGCTTTAGGAAAGAGAATGG + Intergenic
1010160964 6:72854705-72854727 GTGTGTACAAAGAAAGAGAGAGG - Intronic
1011597981 6:89034488-89034510 CTGTTGTTTAAGAAAGATAATGG + Intergenic
1011698315 6:89932896-89932918 CAGTAGAGAAAAAAAGAGAAGGG + Intronic
1011704985 6:89992160-89992182 CTTTGTAAAAAGAAACAGAAAGG - Intronic
1011791797 6:90906966-90906988 CTGTGGAAAGAGAAAGAGAAAGG - Intergenic
1012564889 6:100636428-100636450 CTGAGGAGAAGGAAAGAGATGGG - Intronic
1012710718 6:102600597-102600619 GTGTGGCTAAAGAAATGGAAAGG - Intergenic
1012797196 6:103777150-103777172 CTCTGGAAAAAGGAAGAGAGAGG + Intergenic
1013765992 6:113574924-113574946 ATGTGGTTGCAGAAAGAGAAAGG - Intergenic
1013806533 6:114002165-114002187 CAGTGGGAAAAGAAAGTGAAAGG + Intronic
1014142554 6:117961125-117961147 CTGAGGATAGAAAAAAAGAAAGG - Intronic
1014384929 6:120788371-120788393 ATGTGGTCAAAGAAAGAGAAAGG - Intergenic
1014403704 6:121022795-121022817 ATGTGGAGAGAGAAAGAGTAGGG + Intergenic
1015486208 6:133772851-133772873 CTGTGGTTAAAGAAAAAAGATGG + Intergenic
1016123984 6:140376487-140376509 GGGGGGAGAAAGAAAGAGAAAGG - Intergenic
1016477174 6:144440552-144440574 TTCTGGATAAAGAATGAGAAAGG - Intronic
1016746103 6:147581930-147581952 CAGTGGATAAAGACACAGAAGGG + Intronic
1016754396 6:147667772-147667794 CTGTTTGTGAAGAAAGAGAATGG - Intronic
1017193425 6:151676947-151676969 GTATGGAGAAAGAAAGACAAAGG + Intronic
1017272747 6:152528113-152528135 GAGAGGAGAAAGAAAGAGAAAGG - Intronic
1017422580 6:154288118-154288140 CTACAGAAAAAGAAAGAGAAGGG + Intronic
1018102943 6:160457365-160457387 CTGTTGAGAAAGAATAAGAAAGG - Intergenic
1019018418 6:168897339-168897361 CTGTGGAGAAAGAGACAGAGAGG - Intergenic
1019026832 6:168972812-168972834 ATATGGAGAAAGAGAGAGAAAGG - Intergenic
1020741032 7:12018568-12018590 CTGTCGATAAAGCAAGAGCAGGG + Intergenic
1020985090 7:15123266-15123288 CTGTAGATAAACAAAAATAAAGG - Intergenic
1021300227 7:18963682-18963704 CTATGGATAAAGAATGAAAAAGG + Intronic
1021562511 7:21982525-21982547 CAGTGGAAACAGAAAGAGATTGG - Intergenic
1021629518 7:22630596-22630618 TTGTGGAGAGAGAAAGAGTAAGG + Intronic
1022294917 7:29041568-29041590 ATGTGGAGAAAGAAAGAAATTGG - Intronic
1022647557 7:32245276-32245298 CTAAAGATAAACAAAGAGAAGGG - Intronic
1022666431 7:32415769-32415791 CTGTGGAAAAAGTGACAGAATGG + Intergenic
1022863585 7:34393557-34393579 AAGTTGGTAAAGAAAGAGAATGG + Intergenic
1023478184 7:40603968-40603990 CTGGGGATAATGAAAGATGAAGG - Intronic
1024228118 7:47343903-47343925 CTATGGAGAAAGAGAGAGAATGG + Intronic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024536904 7:50443300-50443322 CTGTTTATATAGAAATAGAAAGG + Intergenic
1024596386 7:50941119-50941141 CTGTGGATGAAGAGAGGAAACGG - Intergenic
1024777396 7:52803509-52803531 CTGAGGATAAGGAAAGGGGATGG - Intergenic
1024800423 7:53071496-53071518 CTGTAGGAAAAGAAAGAGTAGGG - Intergenic
1026475156 7:70728878-70728900 CTGTGGAGGAAGAAAGTTAATGG - Intronic
1026743527 7:72993814-72993836 CTCTGGAAAAAGGAAAAGAATGG + Intergenic
1026783016 7:73282879-73282901 CTCTGGAAAAAGGAAAAGAATGG + Intergenic
1026803403 7:73414274-73414296 CTCTGGAAAAAGGAAAAGAATGG + Intergenic
1026840035 7:73665390-73665412 CTGTCTAAAAAGAAAGTGAAGGG + Intergenic
1027029637 7:74878514-74878536 CTCTGGAAAAAGGAAAAGAATGG + Intergenic
1027100208 7:75371263-75371285 CTCTGGAAAAAGGAAAAGAATGG - Intergenic
1027385347 7:77654347-77654369 CTGTGGAAAGGAAAAGAGAAGGG - Intergenic
1027849177 7:83427231-83427253 TTGAAGAAAAAGAAAGAGAAAGG - Intronic
1027945782 7:84744120-84744142 CTATGGTTAAAAAAAGATAAAGG - Intergenic
1028103150 7:86846117-86846139 GTGTTGACAAAGAATGAGAAAGG - Intronic
1028178309 7:87683541-87683563 CTGAGGAGAAAGAGAGAGATGGG + Intronic
1028496337 7:91464847-91464869 CTGTGTCTAGAGAAAGAAAATGG - Intergenic
1028575085 7:92340073-92340095 CAGTGGCCAAATAAAGAGAATGG - Intronic
1028579236 7:92387924-92387946 TTGTGAATAAATAAAGAGAATGG + Intronic
1029913815 7:104184977-104184999 CTGAGGTTACAGAAAGAAAATGG - Intronic
1030204138 7:106936412-106936434 ATGTTCATATAGAAAGAGAAAGG + Intergenic
1031541022 7:122994574-122994596 CAGTGGAAAAGGATAGAGAAAGG + Intergenic
1031774685 7:125892775-125892797 CTGTGGAAAAAAAAGGAGTAGGG - Intergenic
1031854732 7:126908120-126908142 CTGGAGCTAAAGAGAGAGAAGGG + Intronic
1032191608 7:129769135-129769157 CTCTTGAGACAGAAAGAGAAGGG - Intergenic
1032575005 7:133044149-133044171 CTGTGGATAAAGCAACTGAAGGG + Intronic
1032868322 7:135952575-135952597 ATGTTGGTACAGAAAGAGAATGG - Intronic
1033321333 7:140342440-140342462 CAGTGGTCAAAGAAAGAGGAAGG - Intronic
1033904875 7:146190821-146190843 CTGTTTAGAAAGAGAGAGAAGGG - Intronic
1034316060 7:150134381-150134403 CAGTGGTGAAAGAGAGAGAAGGG - Intergenic
1034790828 7:153966400-153966422 CAGTGGTGAAAGAGAGAGAAGGG + Intronic
1034845576 7:154441254-154441276 CTCTTTATAAAGAAAGGGAAGGG - Intronic
1035149021 7:156850986-156851008 GAATGGATAAAGAGAGAGAAAGG - Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036966224 8:13301097-13301119 CTGTGGATACAGGAGGATAATGG + Intronic
1036977960 8:13435626-13435648 TTGTGGATAAACAAATAAAATGG + Intronic
1037070889 8:14647524-14647546 TTGCGGAGAGAGAAAGAGAAAGG - Intronic
1037315885 8:17599084-17599106 ATGTGGATAAAGAGGGAGAAGGG - Intronic
1037681569 8:21102015-21102037 ATTGGGATAAAGAGAGAGAAAGG + Intergenic
1037687298 8:21152678-21152700 TTGTGTATAAAGAAAAATAAAGG + Intergenic
1038911365 8:31968335-31968357 CTGTGGGTAAAGGAAAAGCAGGG + Intronic
1038971971 8:32646680-32646702 TTGTAGAGAAAGAAAGAAAAAGG + Intronic
1040024986 8:42773435-42773457 TTGTCCATAAAGAAATAGAAAGG + Intronic
1040396686 8:47007410-47007432 CTCAGGACAAAGAGAGAGAAGGG + Intergenic
1040593590 8:48817999-48818021 CTATAGAGAAAGAAAAAGAAGGG - Intergenic
1041596809 8:59664709-59664731 CTGTGAAGAAAGAAAAAAAATGG + Intergenic
1041754314 8:61296909-61296931 TTCTGGATAAAGAGAGAGAAAGG + Intronic
1041800879 8:61797204-61797226 CTGTGTCTAAAGAAATAAAAGGG - Intergenic
1041850733 8:62389035-62389057 CTGTGGGTAGAGAAACTGAAGGG + Intronic
1042356678 8:67836137-67836159 GTATGTATAAAAAAAGAGAAGGG + Intergenic
1042575103 8:70209287-70209309 TTGCGGATAAACAAAGAAAATGG + Intronic
1043079549 8:75748805-75748827 CTGGGAATAATGAAAGATAAGGG + Intergenic
1043466198 8:80509730-80509752 CAGTGGAAAAAGAATGAGATGGG - Intronic
1043601185 8:81940391-81940413 CTGTGGTTAGAGAAAGAATAAGG + Intergenic
1043944763 8:86237524-86237546 CTGAGGAAAAGGAAAGAGACAGG + Intronic
1044399365 8:91752757-91752779 AGGTGGATAAAGAAAAAGCAAGG - Intergenic
1045600730 8:103712709-103712731 CTGTAGATACAGAAACACAAAGG + Intronic
1045679631 8:104644835-104644857 GTGTGTAAAAAGAAAGAAAAAGG - Intronic
1045737264 8:105310790-105310812 CAGTGGATAAGGAAACAGAATGG + Intronic
1045742702 8:105380363-105380385 ATGTTAAGAAAGAAAGAGAAAGG + Intronic
1045748602 8:105454753-105454775 CTGTTCATAAAGAAAGGGGAGGG + Intronic
1046599050 8:116296532-116296554 CTTTGGATAAGGAAAAACAAAGG + Intergenic
1047153975 8:122296346-122296368 AAGGGGATAAAGAAAGGGAAGGG + Intergenic
1047155825 8:122317013-122317035 TGGAGTATAAAGAAAGAGAAAGG + Intergenic
1048115059 8:131511700-131511722 ATGAAGACAAAGAAAGAGAAAGG + Intergenic
1048288916 8:133164714-133164736 CTGTGGAGAAGGACAGTGAATGG - Intergenic
1049954251 9:677403-677425 ATGTTGCTAAACAAAGAGAAAGG + Intronic
1050123921 9:2336858-2336880 CTGGGGAGAAAGAGAGATAATGG + Intergenic
1050288159 9:4125650-4125672 GTGTGTATTCAGAAAGAGAACGG + Intronic
1050856903 9:10369677-10369699 CAGTGTATAGAAAAAGAGAATGG - Intronic
1051009870 9:12398312-12398334 CTGAGGACAAGGAAAGAGATGGG - Intergenic
1051391604 9:16570888-16570910 ATGTGAATAAAGAAACAGAGGGG + Intronic
1051680990 9:19607793-19607815 CATTGGAGAAAGAAAGAGAGAGG + Intronic
1051684816 9:19647031-19647053 GTGTGGAAAGAGAGAGAGAAAGG - Intronic
1051974955 9:22938111-22938133 TGGTGGGTAAAGGAAGAGAATGG - Intergenic
1052285098 9:26775981-26776003 CTGGGGAAAAAAAAAGGGAAAGG + Intergenic
1052690773 9:31814155-31814177 ATGAGGAGAAAGAAAGAGATGGG + Intergenic
1053036182 9:34828207-34828229 TTGTGGATAAGGGAAGAAAAAGG - Intergenic
1053037513 9:34837948-34837970 CTGAGGATGAAGCAAGAGAAAGG + Intergenic
1053412143 9:37922812-37922834 CTGTGGATGCAGCAGGAGAAGGG - Intronic
1053432562 9:38052734-38052756 CTGTGGGTAAAGAAAGGTAGTGG - Intronic
1055048781 9:71958720-71958742 ATCTGGGGAAAGAAAGAGAAAGG - Intronic
1055542164 9:77321947-77321969 CAGAGGATAAAGAAAGAGTTTGG - Intronic
1055833906 9:80416807-80416829 CTGTGGTTCAAGAAAGTGATTGG + Intergenic
1056069745 9:82973789-82973811 ATGAAGAGAAAGAAAGAGAAAGG - Intergenic
1056425348 9:86470010-86470032 CTGTGGCCATAAAAAGAGAAGGG - Intergenic
1056959622 9:91111583-91111605 CTGAGGAGAAGGAAAGAGATGGG + Intergenic
1058020996 9:100088520-100088542 CTGTGGAAAAAGAAAAGGTAGGG - Intronic
1058067988 9:100570613-100570635 ATGTGGATCATGGAAGAGAATGG - Intronic
1058536951 9:105971273-105971295 CTGATGATGAAGATAGAGAAGGG + Intergenic
1058570118 9:106332651-106332673 ATATGGATAGAGAAAGAGATGGG + Intergenic
1058748544 9:108016023-108016045 CTGTGGATAAAAATAAAGCAAGG - Intergenic
1058824037 9:108759066-108759088 CATTGGATAAAGAAAGACCATGG - Intergenic
1058858641 9:109092111-109092133 CTGAAGAGAAAGAATGAGAAAGG - Intronic
1059588333 9:115630174-115630196 AGGTGGAGAAAGAAAGAGGAAGG + Intergenic
1062324788 9:136007233-136007255 CTTTGGAAAAAGAAAAGGAAAGG - Exonic
1185623496 X:1467272-1467294 CTCTGGAGGAAGAAAGAGCAGGG - Intronic
1186001801 X:5020849-5020871 CTGTGGATGAAGAAACTCAACGG + Intergenic
1186040359 X:5470427-5470449 CAGAGGATAAAGACAGAGAGGGG + Intergenic
1186092091 X:6060858-6060880 CTGAGGATATAGCAAGAGCAAGG - Intronic
1186160201 X:6769421-6769443 CTGTGGATTAATGAAGAGCAAGG - Intergenic
1186976437 X:14911531-14911553 GTGTGTAAAAAGAAAGAGGAAGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187728620 X:22230298-22230320 CTGTGAAGAAAGAAAGTCAATGG + Intronic
1188208547 X:27390894-27390916 CTTTGGATAAAGGAAGAAAATGG + Intergenic
1189900363 X:45700173-45700195 CAGTGGATAAGGAAAGAGGGTGG + Intergenic
1190798322 X:53764612-53764634 GTGAAGATAAAGAAAGAGAATGG - Intergenic
1191151223 X:57222368-57222390 CTGTCGATATAGAGGGAGAAAGG - Intergenic
1191650315 X:63529821-63529843 CTTTGGAAAGAGAAAGAGAGTGG + Intergenic
1192005852 X:67211418-67211440 CTTTATATAAAGAAGGAGAAAGG + Intergenic
1193099625 X:77594047-77594069 CTCTAGATAGAAAAAGAGAAAGG + Intronic
1193214697 X:78850061-78850083 CAGTGGATAATGAATGTGAAAGG - Intergenic
1193640606 X:84006300-84006322 TTGTGTACAAAAAAAGAGAAAGG - Intergenic
1194193859 X:90868826-90868848 GTGTGCCTAAAGAAAGGGAAAGG - Intergenic
1194490853 X:94547348-94547370 CTTTGTATAAAGAAGCAGAAAGG + Intergenic
1194644139 X:96437737-96437759 GTGTGGACAAGGTAAGAGAAGGG + Intergenic
1194785513 X:98079120-98079142 CTGGGGATAGTAAAAGAGAAAGG + Intergenic
1195365016 X:104116828-104116850 ATGTGGATGAAGCAAGGGAAAGG - Intronic
1195777377 X:108422359-108422381 CTGTCTAAAAAGAAAGAAAAAGG + Intronic
1196157740 X:112449445-112449467 ATGTAGATAATGAAACAGAAAGG + Intergenic
1196308210 X:114128844-114128866 GTGTAAATAAAGACAGAGAAAGG - Intergenic
1196514412 X:116552682-116552704 GTATGGATAAAGGAGGAGAAGGG - Intergenic
1196610794 X:117712516-117712538 ATGTGGAAAAAGGATGAGAAAGG + Intergenic
1196614864 X:117756499-117756521 ATTAGGAAAAAGAAAGAGAAAGG + Intergenic
1197814185 X:130479692-130479714 CTGTGGTTAAAAAAAAAAAAAGG - Intergenic
1198075812 X:133191679-133191701 CTGTGGCTCAAGTATGAGAATGG - Intergenic
1198384367 X:136114550-136114572 CTGTGGAACAAGAGAGAGAGTGG - Intergenic
1198539780 X:137625362-137625384 ATGTGCATGAACAAAGAGAATGG - Intergenic
1199086766 X:143636318-143636340 CTGTGAAGAGAGAAAGGGAAGGG + Intergenic
1199449616 X:147964715-147964737 CTGTTGATATAGGAATAGAAAGG + Intergenic
1199899687 X:152160780-152160802 ATGTGGAGAAATAAAGAGAAAGG + Intergenic
1200286966 X:154832243-154832265 CTCTGGATAATGAAACATAAGGG + Intronic
1200540469 Y:4451210-4451232 GTGTGCCTAAAGAAAGGGAAAGG - Intergenic
1200833991 Y:7714881-7714903 CTGTGGAAAAAAAAAAAAAAAGG - Intergenic
1201683497 Y:16675788-16675810 CTGAGAATGGAGAAAGAGAATGG + Intergenic