ID: 990717064

View in Genome Browser
Species Human (GRCh38)
Location 5:58649167-58649189
Sequence GCTCCCAGTGGACCAGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 208}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990717064_990717074 26 Left 990717064 5:58649167-58649189 CCACCTGCTGGTCCACTGGGAGC 0: 1
1: 0
2: 2
3: 17
4: 208
Right 990717074 5:58649216-58649238 CCAAATGCCCAAAACTAAGTAGG 0: 1
1: 0
2: 0
3: 19
4: 146
990717064_990717067 -5 Left 990717064 5:58649167-58649189 CCACCTGCTGGTCCACTGGGAGC 0: 1
1: 0
2: 2
3: 17
4: 208
Right 990717067 5:58649185-58649207 GGAGCTCCTGAACCTCCCTACGG 0: 1
1: 0
2: 0
3: 10
4: 122
990717064_990717068 0 Left 990717064 5:58649167-58649189 CCACCTGCTGGTCCACTGGGAGC 0: 1
1: 0
2: 2
3: 17
4: 208
Right 990717068 5:58649190-58649212 TCCTGAACCTCCCTACGGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990717064 Original CRISPR GCTCCCAGTGGACCAGCAGG TGG (reversed) Intronic
900154045 1:1197036-1197058 GAGCCCACTGGGCCAGCAGGAGG - Intronic
900259713 1:1719980-1720002 CCTCTCAGAGGACCTGCAGGGGG + Intronic
900386550 1:2413372-2413394 GCTCCCAGGGGACGAGCGGAGGG + Intronic
901027799 1:6288189-6288211 GCACCCAGGGGACCAGCACAGGG - Intronic
901201675 1:7470774-7470796 GTTCACAGTGGGCCGGCAGGAGG - Intronic
901790389 1:11650745-11650767 GCGGCCGGAGGACCAGCAGGAGG - Exonic
903999650 1:27331710-27331732 GATCTCTGAGGACCAGCAGGAGG - Intronic
904054398 1:27660475-27660497 GCTCCCTGAGGACAAGCAGAGGG - Intergenic
904587669 1:31588975-31588997 GCTCCCTGGGGACCGGCGGGCGG - Intergenic
904605494 1:31695733-31695755 CCTCCCAGTGGACTGGCAGCAGG - Intronic
905608366 1:39325607-39325629 GGTCCCAGTGGACATGCAAGAGG + Intronic
907569829 1:55472910-55472932 GCTCCAGGCGGCCCAGCAGGAGG + Intergenic
908165484 1:61453557-61453579 GCACCCAGTGAGTCAGCAGGGGG - Intronic
914240639 1:145850464-145850486 GCTCCCAGTGGGAAGGCAGGTGG + Exonic
914880110 1:151540405-151540427 GCACCCAGAGGACCAGGCGGCGG + Exonic
915167022 1:153953640-153953662 GCTGGCAGTGGACAAGAAGGTGG + Intronic
915586397 1:156846051-156846073 GCTTCCAGCGCACCAGGAGGTGG + Exonic
918571511 1:185998561-185998583 ACTCCCACTGGACCCGCTGGTGG + Intronic
919249111 1:195030241-195030263 GCTCTCAGTGGACCAGCAATGGG + Intergenic
919790711 1:201289080-201289102 GCTCCCAGCAGCCCAGCAGAGGG + Intronic
920311786 1:205052889-205052911 ACTCCCAGGGGACCAGTAGGAGG + Intronic
920529723 1:206693080-206693102 TCTCCCTGTAGACAAGCAGGAGG - Intronic
921246263 1:213244758-213244780 TCTCTTAGTTGACCAGCAGGTGG + Intronic
922686016 1:227639281-227639303 CCACCCAGTGGGCCAGCAGGGGG + Intronic
1064223117 10:13458726-13458748 GGTCCCAGGGGACAAGCAGAGGG + Intronic
1067730396 10:48806337-48806359 GTTCCCTGTAGACCAGCATGTGG + Intronic
1067749657 10:48962380-48962402 CCTCCCAGAGGACCAACAAGGGG + Intronic
1068779651 10:60905686-60905708 ACTTCAAGTGGACCAGGAGGTGG - Intronic
1069838576 10:71325131-71325153 CCTTCCAGTGGCCCAGGAGGTGG + Intronic
1074864391 10:117536450-117536472 GTTCCCAGAGGACCAGCATGGGG - Intergenic
1075522048 10:123148805-123148827 GCTCCCAGGGGCCCACCGGGCGG - Intronic
1075980827 10:126737563-126737585 GATGCCAGGGAACCAGCAGGAGG - Intergenic
1076585495 10:131544752-131544774 GCTCCATGTGTACCAGCATGTGG - Intergenic
1076636657 10:131885515-131885537 GCTCACACTCGGCCAGCAGGAGG + Intergenic
1076750481 10:132539641-132539663 GCTCCAAGTGGCCCAGATGGAGG + Intronic
1077360924 11:2139771-2139793 GCTCCCAGCGCCCCACCAGGAGG + Intronic
1078105317 11:8354724-8354746 GCTCCCTGAGGAGCAGCAGCTGG + Intergenic
1079131533 11:17749640-17749662 ACTCCAGGTGGCCCAGCAGGTGG - Intronic
1079979301 11:27132223-27132245 GCTCCCATGAGCCCAGCAGGTGG + Intergenic
1081856530 11:46307746-46307768 GCTCCCAGGGGGCAGGCAGGGGG + Intronic
1082988326 11:59186457-59186479 GCTCCCAGCTCCCCAGCAGGGGG - Intronic
1083429395 11:62606092-62606114 GCCCCCACTGTACCAGCCGGCGG + Exonic
1083903322 11:65654475-65654497 GCCCCCAGTGGAGCAGGAGCTGG + Exonic
1084072321 11:66744589-66744611 GGTGCCAGTGGGCCCGCAGGTGG - Intronic
1084155283 11:67309780-67309802 TCTTGCAGTGGACCAGCACGTGG - Exonic
1084400360 11:68939691-68939713 GCAACCAGAGGACCAGCCGGAGG + Exonic
1084544924 11:69810463-69810485 GGTCCCTGTGGTCCAGCACGCGG + Exonic
1084556566 11:69879468-69879490 CCTCCCCCTGGGCCAGCAGGAGG - Intergenic
1084787090 11:71448634-71448656 GATCCCAGCTGACCAGCTGGGGG + Intronic
1088494378 11:110418791-110418813 GCTACCAGAGAATCAGCAGGAGG - Intergenic
1089178857 11:116567137-116567159 TCTCCCTGAGGACCAGAAGGGGG + Intergenic
1089454926 11:118620660-118620682 GCTCCCAGGGGCCCAGGAAGTGG + Intronic
1092137481 12:6159801-6159823 GGTGCCAGTGGAGCAGCGGGCGG - Intergenic
1098299865 12:69043179-69043201 CCTCCCAGGGACCCAGCAGGTGG + Intergenic
1099933414 12:89099101-89099123 TCTCACAGTGGAACTGCAGGGGG + Intergenic
1100732565 12:97488560-97488582 GCTCCTTGGGGACCAGCAAGCGG + Intergenic
1103526704 12:121574081-121574103 GCTCCCTGAGCACCTGCAGGTGG - Intronic
1103702911 12:122856882-122856904 GCTCCCTGAGGACCAGCGGTAGG - Intronic
1103815957 12:123656651-123656673 GCTACCAGTGGAGCAGGAAGAGG - Intronic
1104485820 12:129150591-129150613 CCACCCAGGTGACCAGCAGGAGG + Intronic
1104813866 12:131634590-131634612 GTTCCCAGGAGACAAGCAGGTGG - Intergenic
1107609883 13:42102503-42102525 GCTCCCAGGGTCCAAGCAGGTGG - Intronic
1110436018 13:75479375-75479397 GCTCCCACTGGACTAAAAGGGGG + Intronic
1112265496 13:97919887-97919909 GGTGCCAGAGAACCAGCAGGAGG + Intergenic
1112724885 13:102291880-102291902 GCACCATGTGGACAAGCAGGAGG - Intronic
1118756016 14:68844129-68844151 TCTCGCTGTGGGCCAGCAGGTGG - Intergenic
1118946968 14:70397915-70397937 GCTCAGAGGGGACCTGCAGGGGG + Intronic
1121023902 14:90600332-90600354 GCTCCCAGGGAAGCAGCAGATGG - Intronic
1121622179 14:95357970-95357992 GCTCCCAGTTGACGACCAGCAGG - Intergenic
1121669211 14:95695163-95695185 ACTCCCTGGGGACCAGCTGGGGG - Intergenic
1123032529 14:105458657-105458679 GCTCCCAGTGGCCCAGGAGTGGG - Intronic
1123448417 15:20345605-20345627 GCTCCCAGCAAACCAGCAAGGGG - Intergenic
1127753633 15:62068672-62068694 GCTCACCCTGGCCCAGCAGGCGG - Exonic
1127763433 15:62163919-62163941 GCTCACCCTGGCCCAGCAGGCGG + Exonic
1127834845 15:62782647-62782669 GGTCGCAGTGGAGCAGCACGTGG + Intronic
1129167157 15:73785135-73785157 GCTCTCAGTGGGCAGGCAGGAGG + Intergenic
1129229544 15:74189154-74189176 GCTCTCCGAGGACAAGCAGGAGG - Exonic
1129350865 15:74955387-74955409 TCTCCCTCTGGGCCAGCAGGGGG + Exonic
1130877611 15:88028190-88028212 GCTCTCAGTGGTCCTGCAGCAGG + Intronic
1131440509 15:92456101-92456123 GTCCCCTGTGGCCCAGCAGGAGG - Intronic
1132147699 15:99438191-99438213 TCCCCATGTGGACCAGCAGGAGG - Intergenic
1132421556 15:101674161-101674183 GCTCCCAAGTGACTAGCAGGTGG - Intronic
1132850787 16:2024005-2024027 GCTCCCCGGGCCCCAGCAGGAGG - Intergenic
1133783096 16:8954246-8954268 GCTTCCAGTGGCACCGCAGGGGG - Intronic
1135757727 16:25111915-25111937 GCTCGAGGTGGAACAGCAGGAGG - Exonic
1136550798 16:30981333-30981355 GGTGTCAGTGGTCCAGCAGGAGG + Intronic
1136569177 16:31086652-31086674 CCAGCCAGTGGCCCAGCAGGAGG + Exonic
1138130410 16:54474722-54474744 GTTCCCAGTGACCCATCAGGAGG - Intergenic
1141420404 16:83911459-83911481 GATAACAGTGGAACAGCAGGGGG - Intronic
1144701633 17:17344432-17344454 GGTGGCAGTGGCCCAGCAGGTGG + Intronic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1146956377 17:36938513-36938535 GCTCCCAGCGCGCCAGCTGGCGG - Intronic
1147166804 17:38597880-38597902 GCTGCCAGTGGACCAGGAGGGGG + Intronic
1148339719 17:46866167-46866189 CCTCCCAGTGTAACAGCAGGAGG + Intronic
1148354925 17:46969303-46969325 GCTCTCAGTGGCCCCCCAGGGGG - Intronic
1150301502 17:64050859-64050881 GCTCACTGGGGACCAGCAGCTGG - Intronic
1150317406 17:64180935-64180957 GCACCCAGTGTACCGCCAGGGGG + Intronic
1150468693 17:65417306-65417328 GGTCAAAGTGGGCCAGCAGGAGG + Intergenic
1150861015 17:68800696-68800718 GCTCCCAGGGGACCAGAACAAGG + Intergenic
1151507940 17:74541690-74541712 GCTCCAAGAGGACCAGGAGCAGG + Exonic
1152648294 17:81480421-81480443 GCTCCTAGTGGATCTGCAAGAGG + Intergenic
1152923376 17:83076923-83076945 CCTCCCAGAGGACCAGGGGGAGG + Intergenic
1155480866 18:26286101-26286123 GCTCCCACTGGACCAGCAAGTGG - Exonic
1157285219 18:46372978-46373000 GCTTCCAGTTTCCCAGCAGGAGG - Intronic
1160297460 18:77650975-77650997 GCTCCCGGGAGGCCAGCAGGGGG - Intergenic
1160806998 19:996314-996336 GCTCCCAGCCGACCCGCCGGGGG - Intronic
1161285767 19:3467526-3467548 GCTGCCTGGGGACCTGCAGGGGG - Intronic
1163667722 19:18610964-18610986 GCTCCCCCGGGAACAGCAGGAGG + Intronic
1164593001 19:29516451-29516473 GCTGCCAGTCTATCAGCAGGAGG + Intergenic
1165015903 19:32879825-32879847 GGTCACAGTGGACAAGCAGACGG - Intronic
1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG + Intronic
1168238195 19:55076400-55076422 GCTCCCAGGGCACCTCCAGGTGG + Exonic
925018944 2:553615-553637 GCTCCCTGTGCACCGGAAGGAGG + Intergenic
925280933 2:2683872-2683894 TCTCCCAGGGAACCAGCAGGTGG - Intergenic
927174509 2:20396171-20396193 GCCTCCAGTAGCCCAGCAGGTGG + Intergenic
927997146 2:27494565-27494587 GGTCACAGCTGACCAGCAGGAGG + Exonic
928186523 2:29115640-29115662 GCTCCGAGAGGACCCGGAGGAGG + Exonic
932368793 2:71170697-71170719 GCCCTCTGTGAACCAGCAGGTGG - Intergenic
938186110 2:129233383-129233405 GCTCCCAGTGTGGCAGCAGCTGG - Intergenic
938319848 2:130355678-130355700 GCTCCCAGGGGACGGGCGGGAGG + Intergenic
938598886 2:132817137-132817159 TCACTCAGTGGACCAGCAGCAGG - Intronic
943553601 2:189372625-189372647 TCTGCAAGTGGACTAGCAGGAGG + Intergenic
943667745 2:190628035-190628057 GCTGCCAGGGGAGCAGCTGGAGG - Intergenic
946225693 2:218263030-218263052 GCTCCCCGTGCACCAGCAAGAGG - Exonic
948025663 2:234774147-234774169 GGTCCCAGCAGAGCAGCAGGTGG - Intergenic
948461297 2:238131129-238131151 CCTTCCAGTTGCCCAGCAGGTGG - Exonic
948699703 2:239751920-239751942 GCACCCAGAGGCCCAGCAGAGGG + Intergenic
1168765791 20:381101-381123 GCCTCCAGGGCACCAGCAGGTGG - Exonic
1168819412 20:763018-763040 GCTCTAAGGGAACCAGCAGGAGG + Intronic
1169194389 20:3675386-3675408 GTTCCCAGGGGACCTGCAGCAGG + Intronic
1172228836 20:33323419-33323441 GCTTCGAGTGGACCGGAAGGAGG + Intergenic
1174378832 20:50143529-50143551 CCTCCCAGCGGGCCAGCAGCAGG + Exonic
1175277538 20:57782515-57782537 GCGCCCAGTGGGCCAGCGGAGGG - Intergenic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1177287018 21:19064858-19064880 GCTCACAGTGGAGAAGCAGGTGG - Intergenic
1178350026 21:31866206-31866228 GAGCCGAGTTGACCAGCAGGGGG + Intergenic
1179545016 21:42107900-42107922 GCTCCCACTGGCCCCGCAGCTGG - Intronic
1179610091 21:42544703-42544725 CCTCCCAGTGGGCCAGCATGTGG + Intronic
1179905096 21:44418601-44418623 GGTGCCTGTGGACCTGCAGGAGG - Intronic
1179946538 21:44681899-44681921 GCACCCAGAGGACTGGCAGGAGG + Exonic
1180178869 21:46108955-46108977 GCTCACAGGAGACCCGCAGGGGG + Intronic
1180885551 22:19240866-19240888 GCTCTCAGGGCAGCAGCAGGAGG + Intronic
1181085317 22:20437018-20437040 GCTCGAAGTGGACCAGAAGCGGG - Intronic
1184042455 22:41952199-41952221 GCTCTGAGTGGGCCAGGAGGGGG - Intergenic
1184172674 22:42769061-42769083 GCACACAGTGGGCCTGCAGGTGG - Intergenic
1184210713 22:43034043-43034065 GTTCTCAGTGGCCCAGTAGGGGG - Intergenic
1184466508 22:44671536-44671558 GCTTCTGGTGGCCCAGCAGGAGG + Intronic
1184599262 22:45532905-45532927 TCTCCCAGTAGGGCAGCAGGTGG + Intronic
1185222506 22:49636103-49636125 GGTCCCAGTGCAGAAGCAGGTGG - Intronic
1185275122 22:49947436-49947458 GCTCCCAGTGGACTTGGCGGTGG - Intergenic
950453758 3:13080373-13080395 CCACCCAGTCGACGAGCAGGTGG - Intergenic
953906352 3:46870241-46870263 GCTCCAAGTGGACAAGAAGTGGG + Intronic
954322303 3:49840431-49840453 ACTCCCTGGGGAGCAGCAGGAGG - Intronic
954465631 3:50652944-50652966 TCACCCAGGTGACCAGCAGGTGG - Intergenic
954647474 3:52140421-52140443 GCTGCCAGAGGAACAGCCGGTGG + Intronic
955298636 3:57756677-57756699 GCTCCCGGCGGACGAGAAGGTGG - Exonic
955529429 3:59857935-59857957 GGTGTCAGGGGACCAGCAGGTGG - Intronic
959081765 3:101809365-101809387 TCACTCTGTGGACCAGCAGGGGG + Intronic
959863617 3:111242561-111242583 GCTCACAGGAGACCTGCAGGAGG + Intronic
961539681 3:127591038-127591060 GTTGTCAGTGGACCAGCTGGCGG + Intronic
961636561 3:128336552-128336574 GCCCCCAGTGGAACTGCGGGTGG - Intronic
961932532 3:130548665-130548687 GTTCCCAGTAGAGCACCAGGAGG + Intergenic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
964393000 3:156216812-156216834 GCTGCCAGTTGCCCAGCATGAGG + Intronic
966124235 3:176556788-176556810 GCTCCCAAGGGAACAGGAGGTGG - Intergenic
966775155 3:183537148-183537170 TCTCCCAGAGGAGCAGCAGGAGG - Intronic
968845134 4:3036769-3036791 CCACTCAGTGGACCTGCAGGAGG + Intronic
969036209 4:4255943-4255965 ACTCCCAGGGGAGCAGCAGCAGG + Intergenic
969256883 4:6008286-6008308 TGTCCCACTGGGCCAGCAGGAGG + Intergenic
970576793 4:17436494-17436516 TCACCCAGTGGATCCGCAGGGGG + Intergenic
973619532 4:52712750-52712772 GCGCCCAGCGGAACAGCCGGAGG + Intergenic
975408603 4:74021892-74021914 GCTCCCAGTCTTCCAGCAGCTGG - Intergenic
978624919 4:110674473-110674495 GCTCCCAGTCTCCAAGCAGGTGG - Intergenic
979681110 4:123460864-123460886 CCTTCCAGTGGAACAGCATGTGG + Intergenic
982139457 4:152304187-152304209 CCTCCCTGTGGACCACGAGGAGG - Intergenic
985116779 4:186599642-186599664 CCTCCCAGTGCCCGAGCAGGAGG - Intronic
985551128 5:534166-534188 CCTCCCTGTGGACCTGCCGGTGG - Intergenic
986309618 5:6542636-6542658 GATCCCAGTGGAAATGCAGGTGG + Intergenic
986727495 5:10610236-10610258 GCTCTAAGTGGACAAGCTGGGGG - Intronic
990717064 5:58649167-58649189 GCTCCCAGTGGACCAGCAGGTGG - Intronic
991306760 5:65185093-65185115 GGTCCCAGCGGAAGAGCAGGCGG - Intronic
991582419 5:68170087-68170109 GCTCCCAGGGAGCCAGCAGCTGG + Intergenic
992564776 5:77986360-77986382 GCTGGCAGTGGAACAGGAGGAGG + Intergenic
995647569 5:114329908-114329930 GTGCCCAGTGGAGCAGCAGGAGG - Intergenic
997042754 5:130277607-130277629 GCTCCCAGGCGACCAGAAGTAGG + Intergenic
997355563 5:133260623-133260645 GCTTCCCCTGGACCAGGAGGTGG - Intronic
999328747 5:150659023-150659045 TTTCCCAGAGGACTAGCAGGAGG + Intronic
1000344899 5:160306454-160306476 ACACCCAGTGGACGAGAAGGAGG + Intronic
1001406528 5:171481003-171481025 GGTCCCAGTGGAGCCCCAGGTGG - Intergenic
1001686848 5:173599742-173599764 GCCAGCAGTGGACCAGCATGGGG + Intergenic
1002254602 5:177949872-177949894 GGCCCCCGTGGACCAGCAGAGGG + Intergenic
1002483390 5:179517940-179517962 GGCCCCCGTGGACCAGCAGAGGG - Intergenic
1002664581 5:180813608-180813630 CCACCTAGAGGACCAGCAGGTGG + Intronic
1003336696 6:5180213-5180235 GCTGTCTGTGGAGCAGCAGGAGG - Intronic
1004782982 6:18932915-18932937 GCTCCCAGTGAAACAGCAAGAGG + Intergenic
1005055220 6:21722710-21722732 CCTCCCAGTGCACAGGCAGGTGG + Intergenic
1006803537 6:36774550-36774572 GTTCCCAGTGGAGGAGCAGATGG - Intronic
1007360685 6:41353218-41353240 GCAGCCAGAGGACCAGCAGGAGG + Intergenic
1015954853 6:138588972-138588994 GCTTGTAGTTGACCAGCAGGTGG + Intronic
1024474842 7:49799171-49799193 TGGCCCAGTGGCCCAGCAGGTGG + Intronic
1026940126 7:74282970-74282992 GCTCCCAGTGTCCTGGCAGGGGG - Intergenic
1030932730 7:115545095-115545117 GCTCCCAGTAAGCCAGAAGGTGG + Intergenic
1031528539 7:122850244-122850266 GCCCCCAGTGGAGCAGGAGCTGG - Intronic
1033439651 7:141367140-141367162 CAGCCCAGTGGACCAGCAGAGGG + Intronic
1035041040 7:155927359-155927381 GCTCCCAGGGTCCCTGCAGGAGG - Intergenic
1035171012 7:157017554-157017576 CCTCCCAGTGGAACAACAGGGGG + Intergenic
1035386287 7:158475179-158475201 GCTCCCAGAGGAGCAGCCTGTGG + Intronic
1035685003 8:1517450-1517472 GCTCTCAGTGGAGCAGGGGGTGG - Intronic
1037759495 8:21732571-21732593 GCCCCCATGAGACCAGCAGGAGG + Intronic
1039527743 8:38231681-38231703 GCTCCCAGTGGGCGAGTAGCGGG - Exonic
1040384606 8:46905822-46905844 GCTCACAGTGGGCCTGCAAGGGG + Intergenic
1042841202 8:73125496-73125518 GCTCCCAGTGGTCCTTTAGGGGG + Intergenic
1049104843 8:140605657-140605679 GCTACCCCTGGACCAGCGGGTGG - Intronic
1054829029 9:69603008-69603030 CCTCCCAGAGGACCAGGAGAAGG - Intronic
1060554317 9:124500472-124500494 TCGCCCAGTGGCCCAGCAGGTGG + Exonic
1060828711 9:126700743-126700765 GCTCCCATGGGACCCCCAGGTGG - Exonic
1060965819 9:127711888-127711910 GCTCCAACTGGCTCAGCAGGAGG - Exonic
1062041606 9:134406962-134406984 GCTCCCACTGGAGAAGCGGGTGG - Intronic
1062316703 9:135970769-135970791 GATCCCAGAGGACCTGCATGTGG - Intergenic
1062331747 9:136047948-136047970 GGTCACATTGGAGCAGCAGGGGG + Intronic
1062383166 9:136297489-136297511 GCCACCACTGGAGCAGCAGGTGG - Intronic
1062432059 9:136530631-136530653 TCCCGCAGTGGAGCAGCAGGTGG - Intronic
1062446330 9:136596908-136596930 GGTCCCAGTGGGCCCCCAGGAGG + Intergenic
1188451032 X:30308511-30308533 GCTGCCCCTGGACCAGCAGCTGG - Exonic
1191087848 X:56588182-56588204 GCCATCAGGGGACCAGCAGGTGG - Intergenic
1194727800 X:97418540-97418562 GCTTCCAGAGCACCATCAGGAGG - Intronic
1194947912 X:100091120-100091142 GCTCCCAGGGGAGGGGCAGGAGG + Intergenic
1200366470 X:155671052-155671074 GATTACAGTGGTCCAGCAGGAGG - Intergenic