ID: 990718966

View in Genome Browser
Species Human (GRCh38)
Location 5:58671616-58671638
Sequence GCTGATATGGAGACATGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990718966_990718970 5 Left 990718966 5:58671616-58671638 CCTTCCCATGTCTCCATATCAGC 0: 1
1: 0
2: 1
3: 23
4: 248
Right 990718970 5:58671644-58671666 GTTACAGATACATTGATTGCTGG No data
990718966_990718971 14 Left 990718966 5:58671616-58671638 CCTTCCCATGTCTCCATATCAGC 0: 1
1: 0
2: 1
3: 23
4: 248
Right 990718971 5:58671653-58671675 ACATTGATTGCTGGCTGCATAGG No data
990718966_990718972 15 Left 990718966 5:58671616-58671638 CCTTCCCATGTCTCCATATCAGC 0: 1
1: 0
2: 1
3: 23
4: 248
Right 990718972 5:58671654-58671676 CATTGATTGCTGGCTGCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990718966 Original CRISPR GCTGATATGGAGACATGGGA AGG (reversed) Intronic
900811149 1:4802181-4802203 GGAGAGATGGAGACAGGGGAGGG - Intergenic
900815152 1:4837928-4837950 GCAGATATGGAGACAGTGGGTGG - Intergenic
901199734 1:7459870-7459892 GGAGAAATGGAGACATGGGATGG + Intronic
901326920 1:8372269-8372291 GCTGACATGGAGGCAGGAGAAGG + Intronic
902140605 1:14350529-14350551 TGTCATATGGTGACATGGGAGGG + Intergenic
902468497 1:16632085-16632107 GCTGGGAGGGAGAAATGGGATGG + Intergenic
903168198 1:21535842-21535864 GCAGATCTGGAGACATGGCTTGG + Intronic
903741738 1:25562453-25562475 GCTGCTTTGGAGACCTGGGAAGG + Intronic
904936109 1:34130853-34130875 GCGGAGATGGGGACCTGGGACGG - Intronic
905104861 1:35558250-35558272 GCTGAGATGGGGAGATGAGAAGG - Intronic
905249447 1:36638616-36638638 CCTGAAATGGAAACAGGGGAGGG + Intergenic
905505198 1:38473768-38473790 GAGGATAGGGAGAAATGGGAAGG + Intergenic
907207293 1:52784386-52784408 GCTGATAGTGAGGAATGGGAAGG + Intronic
907926978 1:58964492-58964514 GCTGATATCCACACATGGAAAGG - Intergenic
911255914 1:95633430-95633452 TGAGATATTGAGACATGGGAGGG + Intergenic
912627412 1:111217051-111217073 GCTGATTGAAAGACATGGGAGGG - Intronic
915301348 1:154953319-154953341 GGTGATGTGGAGACGTGGGTTGG - Intronic
915518873 1:156429899-156429921 GCTGATAAGGAGTCATGAGAAGG + Intronic
917449854 1:175138448-175138470 GGTGACATGGTGACATGGGAGGG + Intronic
918892371 1:190292141-190292163 GGGGATATGGAGCCATGGGAGGG + Intronic
919137105 1:193523708-193523730 TCTGATATGTAGACCTGGGATGG + Intergenic
919548245 1:198950142-198950164 AATGATATGGGGACATGGGAGGG + Intergenic
922671628 1:227512478-227512500 GCTGACCTGGAGAGATGGGGTGG - Intergenic
1063102615 10:2963571-2963593 TCTGAGGTGGGGACATGGGAGGG - Intergenic
1064123337 10:12638248-12638270 GCTGCTAAAGAGACCTGGGAGGG - Intronic
1064377523 10:14810390-14810412 GCTGATGTGGATTCACGGGAGGG + Intergenic
1064705568 10:18069517-18069539 GCTGATATGGAGGCAGGATAGGG - Intergenic
1066965299 10:42258403-42258425 GAGGATATGGAGAAATAGGAAGG - Intergenic
1068871113 10:61946278-61946300 CCTGAGATGTGGACATGGGAAGG + Intronic
1071250166 10:83809803-83809825 GCTGAGATGGAGATATGGAAAGG - Intergenic
1075608944 10:123836199-123836221 GCTGAGATGGAGCCAAGGGGAGG - Intronic
1075953200 10:126499636-126499658 GCTCATTTGGAGACCTGGCAAGG + Intronic
1076408427 10:130229366-130229388 GTTGGCATGGAGAGATGGGAAGG + Intergenic
1077956085 11:7020914-7020936 GCTGAAATGAAGCCATGAGAAGG + Intronic
1079399197 11:20092281-20092303 GCAGAGATGGACACTTGGGAAGG - Exonic
1079613476 11:22462090-22462112 GATGATGAGGAGAAATGGGAAGG - Intergenic
1079669340 11:23147485-23147507 AATGAGAGGGAGACATGGGAGGG - Intergenic
1079946667 11:26751501-26751523 GGAGAGATGGTGACATGGGAAGG + Intergenic
1080869148 11:36221901-36221923 ACTGATATGGAACCATGAGAAGG - Intronic
1081022790 11:37968276-37968298 GCTGATAAGGGGACAGGGGGCGG + Intergenic
1081746407 11:45475462-45475484 GCTGCTATTCAGACCTGGGAAGG - Intergenic
1083095085 11:60242137-60242159 GCAGAAATGGTGGCATGGGAAGG + Intronic
1084670923 11:70606168-70606190 GCTGATTTCCAGACATGGGTTGG - Intronic
1085119741 11:73959399-73959421 GCGGATATGGAGAAAGGGAAGGG - Intronic
1086073116 11:82820807-82820829 GTGAATATGGAGACATGGGCAGG - Intergenic
1086501598 11:87459317-87459339 GCTGCTATGGAGACTGGAGACGG - Intergenic
1086932706 11:92709770-92709792 GCTGATATGCAGAACAGGGAAGG + Intronic
1089282830 11:117386455-117386477 GCTGACCTGGATACATAGGAGGG - Intronic
1090011166 11:123047160-123047182 GCTGATTTGGGGAGATTGGAGGG - Intergenic
1091505301 12:1061712-1061734 GGAGATATGGAGATATGGGGGGG - Intronic
1091611998 12:2018592-2018614 GCTGAGATGGAGCCATGCGTGGG + Intronic
1091910274 12:4225099-4225121 GCTGAAATGGAGACAAAGAAAGG + Intergenic
1093670770 12:21872643-21872665 GGTGAGATGCAGACATTGGAAGG - Exonic
1095502816 12:42859369-42859391 GCTGATTTAAAGACAGGGGAGGG + Intergenic
1097143820 12:56925843-56925865 GCTGACATGGTGAGATGGGCTGG + Intronic
1097687545 12:62704877-62704899 GCTGATAGGGAGAAGTGGGGAGG - Intronic
1097777377 12:63664411-63664433 TCTGATTTGGAGGCCTGGGATGG - Intronic
1099036335 12:77592117-77592139 TCTGATCTGGAAACCTGGGAGGG - Intergenic
1099957492 12:89364803-89364825 GCTGAAATGGAGACCTAGTATGG - Intergenic
1100450532 12:94701639-94701661 GAAGATATGGGGACATGGAAAGG - Intergenic
1100961683 12:99969068-99969090 GCCCATCTGGAAACATGGGATGG + Intronic
1101357050 12:103989706-103989728 GTTGATTTGGAGACCTGGGGTGG - Intronic
1102345984 12:112161742-112161764 GCAGATAGGGAGGTATGGGAGGG + Exonic
1103021975 12:117541311-117541333 GCTGATGTGGAGGCATGGGAGGG + Intronic
1103451734 12:121033910-121033932 GAGGATCTCGAGACATGGGATGG + Intronic
1105603091 13:21904405-21904427 GCAGATATGGATACAAAGGATGG + Intergenic
1106022219 13:25926317-25926339 GTTGATGTGGTGACAGGGGAGGG - Intronic
1106462238 13:29981265-29981287 GTTGCTATGGAGACCTGTGACGG - Intergenic
1106513205 13:30429349-30429371 GCTGAAATGGAGACAACAGAAGG + Intergenic
1106696366 13:32178267-32178289 GCAAATATCCAGACATGGGAAGG - Exonic
1107274835 13:38666596-38666618 TCCAATATGGGGACATGGGAGGG - Intergenic
1107333973 13:39333728-39333750 GAGGATATGGAGAAATAGGAAGG + Intergenic
1107389071 13:39944555-39944577 GCTGATATGGAGAAGAGGGGTGG - Intergenic
1107670131 13:42736968-42736990 GCTGATATGGACAGATGGATGGG - Intergenic
1108035608 13:46287355-46287377 GCTGTTAGGGAGTCATGGAAAGG + Intergenic
1109592841 13:64509368-64509390 GAGGATGTGGAGAAATGGGAAGG - Intergenic
1110463470 13:75773671-75773693 GCTGATTTGGAGGCAAGAGATGG + Intronic
1110625910 13:77655439-77655461 GCGGATGTGGAGAAAGGGGAAGG - Intergenic
1110862826 13:80362418-80362440 TCTGCTTTGGAGAGATGGGATGG + Intergenic
1113268618 13:108647313-108647335 GCTCATAGAGAGACATGGTAGGG - Intronic
1113976644 13:114232324-114232346 AGTGATATGGAGAGATGGGCAGG + Intergenic
1119526971 14:75330580-75330602 TTTCATATGGAGACTTGGGATGG + Intergenic
1120318931 14:82934056-82934078 GCTAAGATGGAGGCATGGAATGG - Intergenic
1120763453 14:88306650-88306672 GCTTTTCTGGAGACATGAGATGG - Intronic
1123444642 15:20317393-20317415 GATGATATGATGAGATGGGATGG + Intergenic
1123779096 15:23607701-23607723 GATGAAATGGAGATATGTGATGG - Intronic
1124696168 15:31866416-31866438 GCTGAAATGGAGAGAAGGGCCGG - Intronic
1125715667 15:41818639-41818661 ACTGAAATGGAGAGAGGGGAGGG - Intronic
1126118323 15:45228908-45228930 GGTGAAATGGGGGCATGGGAAGG - Intergenic
1126584089 15:50266092-50266114 GCTGATAAGGAAACAGGGGCAGG - Intergenic
1127875982 15:63111663-63111685 GCTGACATGGGGAAGTGGGAGGG + Intergenic
1128579579 15:68799649-68799671 GCTGATAGGAACACGTGGGATGG + Intronic
1130368082 15:83258505-83258527 GCTGCTGTGGGCACATGGGAGGG - Intronic
1132025716 15:98402977-98402999 GGTCATATGGAGACACGGGGTGG - Intergenic
1133924962 16:10184583-10184605 GCTGAAATGGAGACAGGAGAGGG + Intergenic
1135089311 16:19500287-19500309 ACTGAAGTGGAGACAAGGGATGG - Intergenic
1135163608 16:20118960-20118982 GCTGGCATGGAGGGATGGGATGG - Intergenic
1137633135 16:49962164-49962186 GCTGCTAAGGAGACATGAGCTGG + Intergenic
1137730440 16:50685810-50685832 GGTTATATTGAGACATGGCAGGG + Intergenic
1138713604 16:58996961-58996983 GCTGAAATTGAGATATGGGGAGG - Intergenic
1140192740 16:72832115-72832137 GCTGCTCAGCAGACATGGGAAGG + Intronic
1140625810 16:76793170-76793192 GCTGTTATGGGGGCGTGGGATGG + Intergenic
1143611881 17:8022633-8022655 ACTGTGAGGGAGACATGGGATGG + Intergenic
1144508073 17:15850402-15850424 GCTGAATTGGAGAAATGAGAGGG - Intergenic
1145172195 17:20668040-20668062 GCTGAATTGGAGAAATGAGAGGG - Intergenic
1145202401 17:20958122-20958144 GCTGAATTGGAGAAATGAGAGGG - Intergenic
1145262731 17:21364516-21364538 GCTGAGCTGGGGTCATGGGAGGG + Intergenic
1148343766 17:46890030-46890052 GCTGAAATGGTGGCATGGGAGGG - Intergenic
1148734253 17:49855865-49855887 GCTGACATGGAGACCTAGGTAGG + Intergenic
1151141661 17:71998874-71998896 CCTGGAATGAAGACATGGGATGG + Intergenic
1151226578 17:72652460-72652482 GCTGATATGATTACCTGGGATGG + Intronic
1157301482 18:46482913-46482935 GCTGAGAAGGAGCCAGGGGAGGG - Intronic
1157818422 18:50748187-50748209 GCTGAAAGGGGGACATGGGGTGG - Intergenic
1158072684 18:53491940-53491962 GAGGATGTGGAGACATAGGAAGG - Intronic
1161209050 19:3056846-3056868 GGTGACAGGGAGCCATGGGAGGG - Intronic
1161735616 19:5990584-5990606 GCTGTGATGGAGACTTGGGGAGG + Intergenic
1163448450 19:17361422-17361444 GCTGTGATGGAGACAGGGGTAGG - Intronic
1165736989 19:38183203-38183225 ACTGAGATGGAGCCACGGGAGGG + Intronic
1165931646 19:39362980-39363002 GCTCACATGGACACAGGGGAGGG - Intronic
1166342967 19:42149858-42149880 GCTGAGACTGACACATGGGAAGG + Intronic
1166856356 19:45784299-45784321 GATGAGAGGGAGAGATGGGAGGG + Intronic
1166886134 19:45962045-45962067 AGTGAGATGGAGCCATGGGAGGG + Intronic
1167016293 19:46843078-46843100 TCTGATATGGGCAGATGGGAAGG - Intronic
1167211474 19:48136529-48136551 GGGGAAATGGAGACATGGGGAGG - Intronic
1167590378 19:50401642-50401664 GCTGAAATGGACACAGGGAACGG + Intronic
925160239 2:1678307-1678329 GGTGATGGGGAGCCATGGGAGGG - Intronic
925222044 2:2149780-2149802 CCTGAAATGCAGACCTGGGATGG - Intronic
925751818 2:7096135-7096157 GCAAATATTGAGACATTGGATGG + Intergenic
925832378 2:7909211-7909233 GCTTAGATGGAGACAGGAGAAGG + Intergenic
926792036 2:16583743-16583765 GAGGACATGGAGACATGGGAAGG + Intronic
930723993 2:54665043-54665065 GCTGATATGGAGATCAGGGCAGG - Intronic
931169106 2:59783835-59783857 ACTGACATGAAGGCATGGGAGGG + Intergenic
931209814 2:60181967-60181989 GCTTGTATGTAGACTTGGGATGG - Intergenic
931379879 2:61742858-61742880 GCTCATTTGGATACATGGCAAGG + Intergenic
934314736 2:91906842-91906864 GAGGATATGGAGAAATAGGAAGG + Intergenic
935211726 2:100944508-100944530 GCAATTATGGAGACAAGGGAGGG - Intronic
936896593 2:117434653-117434675 CCTGATAGGGGGAAATGGGAGGG + Intergenic
938076223 2:128340022-128340044 CTTCATATGGAGACACGGGAGGG + Intergenic
938989685 2:136615184-136615206 GATGACAAGGTGACATGGGAAGG + Intergenic
941889768 2:170567817-170567839 GATGAAATTTAGACATGGGATGG + Intronic
944993522 2:205267181-205267203 GCTGAAATGGAGAAATAGCATGG - Intronic
946456531 2:219831060-219831082 GCACATTTGGAGACATGTGAGGG - Intergenic
947394723 2:229675313-229675335 GCTGAGAAGGAGGCATGAGATGG - Intronic
947830277 2:233134695-233134717 CCTGAAATGGAGACACGGAAAGG + Intronic
948003643 2:234589793-234589815 GCTAAAGAGGAGACATGGGACGG + Intergenic
948171768 2:235909556-235909578 TCTGATGAGCAGACATGGGAAGG - Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1171490942 20:25516763-25516785 GCTGGTAAGGAGCCCTGGGATGG - Intronic
1173001055 20:39106052-39106074 GCTGACATAGAGACAAGGGGTGG + Intergenic
1173723977 20:45284048-45284070 GCTGGTATTGAGTCAAGGGAAGG + Intergenic
1173941344 20:46913782-46913804 GCTGAAATGGGGACAGTGGAGGG + Intronic
1174158246 20:48531226-48531248 GCTGAAATGCAGACAGGGGTGGG + Intergenic
1174792282 20:53490426-53490448 GCTGATATCAAGACATTTGAGGG + Exonic
1175219191 20:57407312-57407334 GCTGAGAAGGAGACATGGAGTGG + Intronic
1175303164 20:57957273-57957295 GCTGATGTGAAGCCATGGGGAGG - Intergenic
1181322762 22:22021292-22021314 GCTGGTATGGAGACCATGGAAGG + Intergenic
1183079974 22:35450070-35450092 GCTGAGAAGGAGACAGGGAAGGG + Intergenic
1184512308 22:44940826-44940848 GGTGAGATGGATACAGGGGAAGG + Intronic
1185306418 22:50119820-50119842 ACTGAAATGGAGAGCTGGGAGGG + Intronic
950670120 3:14520952-14520974 GCTGAGATTTAGACATGGGTGGG - Intronic
952248060 3:31619039-31619061 GCTGGCATGGAGACAGGTGAAGG - Intronic
952495695 3:33913950-33913972 GCAGATATGGAGGAAAGGGAGGG + Intergenic
953138621 3:40206114-40206136 GCTGATATGGAGTCCATGGATGG - Intronic
953151826 3:40332102-40332124 GATGTTATGGAGATAAGGGATGG - Intergenic
953554726 3:43935065-43935087 GAGGATATGGAGAAATAGGAAGG - Intergenic
954740534 3:52746254-52746276 GCTGATAGGGGAACATTGGAAGG - Intronic
954911039 3:54109809-54109831 GTTGTTATGGAGACATCTGAAGG + Intergenic
956414023 3:69008427-69008449 GCAGCTATGTCGACATGGGATGG - Exonic
958851027 3:99325713-99325735 GCTGAGATTGAGACATGGCTTGG + Intergenic
960208866 3:114935669-114935691 GCTGATCTGGGAACAGGGGATGG - Intronic
960489836 3:118302599-118302621 GTTAATATGGAGACATTGGAAGG - Intergenic
961326015 3:126109848-126109870 GCTGAACTGGAGACATCTGAAGG - Intronic
961362325 3:126375887-126375909 GGTGAAATGGAGACGTGGGGAGG - Intergenic
961480127 3:127174200-127174222 GCTGAGGTAGAGAGATGGGAAGG - Intergenic
962031775 3:131608566-131608588 GCTGAAATGGAGCCAAGGGGAGG + Intronic
963076769 3:141354498-141354520 ACTGAAATGGAGAAATTGGATGG + Intronic
963503407 3:146156890-146156912 GGTGAAATGGAGATTTGGGATGG - Intronic
963806915 3:149732145-149732167 ACTGAAATGGAGACAAGAGAGGG + Intronic
963815090 3:149821028-149821050 ACTGATATATAGACATGGAAAGG - Intronic
964512409 3:157467273-157467295 GCTTATCTGGGGAGATGGGATGG + Intronic
964692303 3:159463686-159463708 GGGGATATGGGGACAAGGGAAGG - Intronic
964745992 3:160012880-160012902 GCAGAAGTGGAGTCATGGGAGGG - Intergenic
966207579 3:177420695-177420717 GCTGACTTGGAAATATGGGAGGG + Intergenic
966478488 3:180377652-180377674 GCTGATAGGGTGACTGGGGAGGG + Intergenic
969618407 4:8266851-8266873 GCGGAGATGGAGGGATGGGATGG + Intergenic
970322570 4:14889459-14889481 TCTGATTTGGAGACCAGGGAAGG - Intergenic
970599558 4:17630474-17630496 GCAGATATGGAGTCTGGGGAGGG - Exonic
970881273 4:20935039-20935061 GGAGACATGGAGACATGGAAAGG - Intronic
972451325 4:39201684-39201706 TCTGATATGGACACAAGAGAGGG - Intronic
973707098 4:53591802-53591824 GCAGATATGGGGAAAGGGGAGGG - Intronic
974018186 4:56668791-56668813 ACTGGTATGGAGTCATAGGATGG + Intronic
975289147 4:72656643-72656665 GAGGATATGGAGAAATAGGAAGG + Intergenic
975638490 4:76475275-76475297 TCTGATTTGGAGAACTGGGAAGG + Intronic
976282373 4:83337710-83337732 TATGATATGGATACATAGGAAGG + Intergenic
978526568 4:109673275-109673297 GGTCATATGGAGTAATGGGATGG - Intronic
979551331 4:121994440-121994462 GCTGATGGGAAGCCATGGGATGG + Intergenic
979663755 4:123288262-123288284 GCAGATATGGAGACAAGGAAGGG + Intronic
980421416 4:132565858-132565880 TATGATAGGGAGACATGGGCTGG + Intergenic
981774177 4:148346083-148346105 GCTGAAATGGAGAGAGGGGAGGG + Intronic
987345653 5:16976499-16976521 GGAGATATGGAGACAAGGGTAGG + Intergenic
990718966 5:58671616-58671638 GCTGATATGGAGACATGGGAAGG - Intronic
990904129 5:60785153-60785175 GCTCATTTGAAGACTTGGGAGGG - Intronic
990911260 5:60854747-60854769 GCTGATAGGAAGCCATTGGAAGG - Intergenic
991535816 5:67668438-67668460 GCAGATAGGAAGATATGGGAAGG + Intergenic
992651261 5:78863119-78863141 GAGGATGTGGAGAAATGGGAAGG + Intronic
993316369 5:86411356-86411378 TCTGATGTGGAGAAATAGGAAGG - Intergenic
993970804 5:94417967-94417989 GCTGTTATGGAGCCAAAGGAGGG - Intronic
994035280 5:95192844-95192866 GCTGATATGGAAAAATAGGAAGG - Intronic
995230724 5:109759181-109759203 TCTGATATAGCAACATGGGATGG + Intronic
996136098 5:119844188-119844210 GCTGGTATGGTGAGGTGGGACGG + Intergenic
996536817 5:124585894-124585916 ACTGATATGGAGATATGGACAGG - Intergenic
997498910 5:134355821-134355843 GCTGCTGTGGAGACATGGCATGG + Intronic
997726402 5:136123965-136123987 GCTGAAATGGAGAGAGGTGAGGG - Intergenic
998008762 5:138676168-138676190 CCTGAGACTGAGACATGGGAAGG - Intronic
998483936 5:142485575-142485597 GAGGATATGGGGCCATGGGATGG - Intergenic
998929995 5:147171028-147171050 GAGGATGTGGAGACATAGGAAGG + Intergenic
1001337309 5:170809803-170809825 GCTGATCTGTAGACATGGGCTGG + Intronic
1002475785 5:179464952-179464974 GCTGATATGGGAACAGGGCAGGG - Intergenic
1002827456 6:786095-786117 GGTGTCATGTAGACATGGGAAGG + Intergenic
1005423462 6:25676783-25676805 GCTGATTTGGAAAGAGGGGATGG - Intronic
1006273671 6:32983769-32983791 GCTGTAATGGAGAGCTGGGAAGG + Intergenic
1008804742 6:55413581-55413603 CCTGATATGCATACATGGTATGG + Intergenic
1009212892 6:60884219-60884241 GAGGATATGGAGAAATAGGAAGG - Intergenic
1009886162 6:69626374-69626396 GCAGATATCCAGACATGGGCAGG - Intergenic
1012481146 6:99668552-99668574 GCTAATATGCAGACAAGAGAGGG - Intergenic
1013640164 6:112067444-112067466 GCTGCTAAGGAGAAATAGGAGGG - Intronic
1014286257 6:119502533-119502555 GCTGATATGGGGACATGGCCTGG - Intergenic
1015283485 6:131458849-131458871 GCTGACATGAAGACGTGAGAAGG - Intergenic
1022203165 7:28137512-28137534 GCTGTTAAGGAGACCTGGGTGGG - Intronic
1022846445 7:34214837-34214859 GCTGATATGGAGACATCATCAGG - Intergenic
1023243912 7:38179762-38179784 GGTTGTATGGAGAAATGGGATGG + Intronic
1024663903 7:51526857-51526879 GAGGATATGGAGAAAGGGGAAGG + Intergenic
1026711382 7:72743478-72743500 GCTGCTATGAAGACATGAGTTGG + Intronic
1030646130 7:112063974-112063996 GCTGTAAGGGAGACTTGGGAAGG - Intronic
1030679724 7:112422263-112422285 GCTTAGATGGAAACATGGGGCGG + Intergenic
1032287075 7:130547034-130547056 ACTTATTTGGAGACTTGGGAAGG - Intronic
1033794102 7:144826988-144827010 GCTAATATGGAAAGATGGGGGGG + Intronic
1035334907 7:158121579-158121601 GATGGTATGAGGACATGGGAGGG + Intronic
1036192444 8:6682573-6682595 TCTGCTGTGGAGAGATGGGACGG - Intergenic
1036961416 8:13248719-13248741 GTGGAGAGGGAGACATGGGATGG - Intronic
1037011084 8:13843341-13843363 GCAGAAATAGAGAAATGGGATGG + Intergenic
1037338586 8:17816467-17816489 GAGGATATGGAGAAATAGGAAGG + Intergenic
1039211732 8:35224391-35224413 GATGATATGGTGATATGGTAGGG - Intergenic
1043179082 8:77061086-77061108 GCTGATTTGAAGACATATGACGG + Intergenic
1043444732 8:80308092-80308114 GCTGGTCTGGAGTTATGGGAAGG + Intergenic
1044790536 8:95842425-95842447 CCATATATGGATACATGGGATGG + Intergenic
1047428018 8:124764421-124764443 GCTGATGTGAAGCCTTGGGAAGG + Intergenic
1048304678 8:133275601-133275623 GGTGATATGGAGCCAGGTGATGG - Intronic
1049118588 8:140713076-140713098 TCTGATGTGAAGACATGGGAAGG - Intronic
1051366814 9:16327219-16327241 GCTGTTATGGGGACATGTGGAGG - Intergenic
1055760946 9:79607003-79607025 GATGATGTGGAGAAATAGGAAGG - Intronic
1057473744 9:95381186-95381208 GCTGAGAGGCAGCCATGGGAAGG - Intergenic
1058352141 9:104038599-104038621 GCAGATAGGGAGACAGGGAAAGG + Intergenic
1058965281 9:110031767-110031789 GCTGGTATGTAGACATGCTAAGG + Intronic
1059397516 9:114047506-114047528 GCTGATATGGAGGGAAGGGAGGG - Intronic
1060003730 9:119981372-119981394 GCTGATGGGGAGACAGGGCAGGG - Intergenic
1060566339 9:124595748-124595770 CATGAAATGGAGACATGGGAAGG - Intronic
1060826298 9:126689998-126690020 GCTGAGACGGAGGGATGGGAAGG + Intronic
1186333132 X:8557687-8557709 GAGGATATGGAGAAATAGGAAGG + Intronic
1187352717 X:18535822-18535844 GTTGATATGGAGCCATTGGAGGG - Intronic
1188472486 X:30555971-30555993 GCTGAAAAGGAGACATGGTAGGG - Intergenic
1189230828 X:39451183-39451205 GCTGTTGTGGAGAAGTGGGAGGG - Intergenic
1190700079 X:52981299-52981321 CCTGAAATGGAGACTTGGGCTGG - Intronic
1191701810 X:64050196-64050218 GAACATATGGACACATGGGAAGG + Intergenic
1191722089 X:64239924-64239946 TCAGATATGGAAACTTGGGATGG - Intergenic
1193238285 X:79135670-79135692 GATGAGATGGATACATGGGGAGG + Intergenic
1194833131 X:98650042-98650064 TCTGATGTGGAGATCTGGGATGG + Intergenic
1194964950 X:100277608-100277630 GTTGACATTGACACATGGGAAGG + Intergenic
1196098838 X:111827820-111827842 CATGATAGGGAGCCATGGGAGGG - Intronic
1198163722 X:134032869-134032891 GCTGGTATGAGGACATAGGAAGG - Intergenic
1202240628 Y:22764175-22764197 GCTACTATGGAGAAATGGGGTGG + Intergenic
1202393614 Y:24397928-24397950 GCTACTATGGAGAAATGGGGTGG + Intergenic
1202477171 Y:25272172-25272194 GCTACTATGGAGAAATGGGGTGG - Intergenic