ID: 990719706

View in Genome Browser
Species Human (GRCh38)
Location 5:58680583-58680605
Sequence GTCCCACTGGACCAAAGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 649
Summary {0: 1, 1: 1, 2: 10, 3: 108, 4: 529}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990719706 Original CRISPR GTCCCACTGGACCAAAGTCA GGG Intronic
900009454 1:92571-92593 GTGCCACTGGACCTAAGACAAGG - Intergenic
900025564 1:269147-269169 GTGCCACTGGACCTAAGACAAGG - Intergenic
900035328 1:402920-402942 CTGCCACTGGACCTAAGACAAGG - Intergenic
900056949 1:638673-638695 CTGCCACTGGACCTAAGACAAGG - Intergenic
900172270 1:1274751-1274773 GTCCCAGAGGGCCAGAGTCAGGG - Intergenic
900301276 1:1978680-1978702 GTCCCACTGGGCTAAAGTCAAGG - Intronic
900463546 1:2812816-2812838 GTCCCACTGGGCTAAAATCAAGG - Intergenic
900883766 1:5401366-5401388 GTCCGACTAGACCAAAGCCGAGG + Intergenic
901104030 1:6741475-6741497 GTCTTACTGGACCAAAATGAAGG + Intergenic
901390074 1:8939630-8939652 GTTTCACTGGGCTAAAGTCAAGG - Intergenic
901786017 1:11625449-11625471 GTCTCCCTGGGCCAAAATCAAGG - Intergenic
902226636 1:15000319-15000341 GTTTCACTGGGCCAAAATCAGGG - Intronic
902491845 1:16788329-16788351 GGCCCACTGGAAGAAATTCAAGG + Intronic
902647055 1:17806912-17806934 GTCCCACTGGGCTACAGTCAAGG + Intronic
902666160 1:17940076-17940098 GTTTCACTGAACTAAAGTCAAGG + Intergenic
903479688 1:23644264-23644286 GTGTCACTGGACCAGAGGCATGG - Intergenic
903683608 1:25114582-25114604 GTGTCACTGGACTAAAATCAAGG + Intergenic
905237525 1:36560413-36560435 GTCCCACGGGAGCAAAGGCACGG + Intergenic
905323712 1:37135302-37135324 GTCCAGCTGGACCAAAGGCCTGG - Intergenic
905635764 1:39550946-39550968 GTCTCACTGGGCTAAAATCAAGG - Intergenic
905853237 1:41289851-41289873 GTTGCTCAGGACCAAAGTCATGG - Intergenic
906248000 1:44290548-44290570 TTCCCACTGGATCCCAGTCAGGG + Intronic
906389346 1:45400355-45400377 GTCTCACTGGGCTAAAATCAAGG - Intronic
906646196 1:47477201-47477223 GTTTCACTGGACTAAGGTCAAGG + Intergenic
907748064 1:57234687-57234709 GTCTCACTAGGCCAAAATCAAGG + Intronic
907933111 1:59018468-59018490 GTCTCACTGGGCTAAAATCAAGG - Intergenic
908037987 1:60076175-60076197 GTCTCACTGGGCTAAAGCCAAGG - Intergenic
908808288 1:67953411-67953433 GTCTTACTGGGCTAAAGTCAAGG + Intergenic
908815544 1:68029306-68029328 GTTTCACTGGACTAAAGTCCAGG + Intergenic
909162591 1:72172704-72172726 GTCTCACTGGGCTAAAATCAAGG + Intronic
909179901 1:72410310-72410332 GTCACACTGGGCTAAGGTCAAGG + Intergenic
910791952 1:91060573-91060595 GTTTCACTGGACCTAAATCAAGG - Intergenic
911931877 1:103914897-103914919 GTCTCATTGGTCTAAAGTCAAGG + Intergenic
912394643 1:109332525-109332547 ATTCCACTGGACCCCAGTCAGGG + Intronic
914050138 1:144124577-144124599 ATCTCACTGGGCTAAAGTCAAGG - Intergenic
914129044 1:144840874-144840896 ATCTCACTGGGCTAAAGTCAAGG + Intergenic
914348488 1:146819970-146819992 GTCTCACTGGGCTAAAATCAAGG + Intergenic
914931560 1:151938791-151938813 GTTTCACTGGACTAAAATCAAGG + Intergenic
915071487 1:153272546-153272568 GTCCCACTAGACCACAGTGGTGG - Intergenic
915279445 1:154812586-154812608 CTCCCACTTCTCCAAAGTCATGG - Intronic
915564467 1:156706032-156706054 GTCCCACTGGATCCAGTTCAGGG - Intergenic
915674479 1:157517646-157517668 GTCTCACTGGGCTAAAATCATGG - Intronic
916176076 1:162039809-162039831 GTTTCACTGGACCAAAATCAAGG - Intergenic
916373895 1:164130447-164130469 GTCTCACTGGGCTAAAATCAAGG + Intergenic
916807935 1:168278437-168278459 GTTTCACTGGACTAAAGCCAAGG + Intergenic
916853502 1:168727101-168727123 GTGCCACAGGACCAGATTCAGGG - Intronic
917011212 1:170473749-170473771 GTCCTACTGGACTAAAATTAAGG - Intergenic
917635242 1:176929496-176929518 GTTTCTCTGGACTAAAGTCAAGG - Intronic
918083402 1:181224566-181224588 GTTTCACTGGACCAAAAGCAAGG - Intergenic
918311317 1:183287606-183287628 ATCCCACTGGGCCAAGGTGATGG + Intronic
918410046 1:184249129-184249151 GTCCCACTGGGCTAAAATCAAGG + Intergenic
918418102 1:184333436-184333458 GTCACACTGGGCTAAAATCAAGG - Intergenic
918499511 1:185178398-185178420 GAGCCACTGAACCACAGTCAGGG + Intronic
918783713 1:188735687-188735709 GTTCCACTGGGCTAAAGTCAAGG + Intergenic
918910297 1:190559212-190559234 GCCTCACTGGACTAAAATCAAGG + Intergenic
919192740 1:194244847-194244869 GTATCACTGGGCCAAAATCAAGG - Intergenic
920626605 1:207608090-207608112 GTATCTCTGGACCAAAATCATGG - Intronic
920665701 1:207961347-207961369 GTCTCACTGGGCTAAAATCAAGG + Intergenic
920818547 1:209358313-209358335 GTCTCACTGGGCTAAAATCAAGG + Intergenic
920957084 1:210629592-210629614 GTCTCACTGGGCTAAAGTCAAGG + Intronic
922257859 1:223908480-223908502 GTGCCACTGGACCTAAGACAAGG - Intergenic
923195703 1:231664642-231664664 GTCTCACTGGGCTAAAATCAAGG - Intronic
923528600 1:234794210-234794232 GGCCCACTGGAAGAAATTCAAGG - Intergenic
923684572 1:236145002-236145024 GGCCCAGGGGCCCAAAGTCACGG + Intronic
924322071 1:242860334-242860356 GTCCCACTGGATTAAAATCAAGG - Intergenic
924339056 1:243011259-243011281 GTGCCACTGGACCTAAGACAAGG - Intergenic
924446151 1:244133395-244133417 GTCTCACTGGGCTAAAATCATGG - Intergenic
1063163434 10:3438127-3438149 ATCTCACTGGGCTAAAGTCAAGG + Intergenic
1063722311 10:8596666-8596688 ATCCCACTGGACTAAATACAAGG - Intergenic
1063825189 10:9889157-9889179 GTCCCATTGTACCACTGTCATGG - Intergenic
1064000054 10:11656122-11656144 GTCCCACTGGACTAAAATCAAGG - Intergenic
1064000212 10:11657571-11657593 GTCTCCCTGGACTAAAATCAAGG - Intergenic
1065498599 10:26355561-26355583 GTCCCACTGAGCTAGAGTCAAGG - Intergenic
1065859631 10:29861156-29861178 GTTGCACTGGACTAAAATCAGGG - Intergenic
1066651905 10:37664385-37664407 GTCTCACTGGGCAAAACTCAAGG + Intergenic
1068105944 10:52616499-52616521 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1068272086 10:54741596-54741618 GTCTCACTGGACTAAAATCAAGG + Intronic
1068525045 10:58118549-58118571 GTCTCACTGGGCTAAAATCAAGG - Intergenic
1069723773 10:70564967-70564989 GGCTCACTGGTCCAAGGTCACGG - Intronic
1069808223 10:71139208-71139230 GTCTCACTGGGCCAAAATAAAGG - Intergenic
1071446594 10:85754683-85754705 GGCCCACTGGATGTAAGTCAAGG - Intronic
1072568092 10:96634810-96634832 GTCTCACTGGGTCAAAGTCAAGG + Intronic
1072952272 10:99858127-99858149 GTCTCACCGGGCTAAAGTCAAGG - Intergenic
1073799150 10:107022353-107022375 CTGCCACTGGACCTCAGTCATGG - Intronic
1073814705 10:107193790-107193812 GTCTCACTGGACGAAAATCAGGG - Intergenic
1074203007 10:111256557-111256579 GTTTCACTGGGCTAAAGTCAAGG - Intergenic
1074261230 10:111855531-111855553 GTCTCACTGGACTAAAATTAAGG + Intergenic
1074494017 10:113963303-113963325 GTCCCACTGGGCTAAAATCAAGG + Intergenic
1074973999 10:118565912-118565934 GTCCCATTGGACAAAGGTGAAGG - Intergenic
1075857069 10:125638504-125638526 GTCTCACTGGACAAAAATCAAGG - Intronic
1075884422 10:125885628-125885650 GTCTCACTGGACTACAATCAAGG - Intronic
1076531582 10:131148782-131148804 GTCTCACTGGGCGAAAGTCAAGG - Intronic
1078474140 11:11616329-11616351 GTCTTATTGTACCAAAGTCATGG - Intronic
1078904825 11:15673949-15673971 GTCACACTGGGCAAGAGTCATGG + Intergenic
1078906303 11:15691280-15691302 GTATCACTGAATCAAAGTCAAGG + Intergenic
1079326872 11:19500953-19500975 GTCTCACTGGGCTAAAATCAAGG + Intronic
1079450942 11:20599286-20599308 GTCCCACTGCACCCAAGGCAAGG - Intergenic
1079661288 11:23039934-23039956 GTCTCACAGGGTCAAAGTCAAGG - Intergenic
1079807798 11:24956345-24956367 GACTTACTGGGCCAAAGTCAAGG - Intronic
1080109838 11:28554286-28554308 GTTTCACTGGAATAAAGTCAAGG + Intergenic
1080131502 11:28801021-28801043 GTTTCACTGGGCTAAAGTCAGGG + Intergenic
1080267862 11:30420397-30420419 GTCTCACTGGACTAAAATCCAGG - Intronic
1080769896 11:35330856-35330878 GTCTCACTGGGCTAAAATCAAGG - Intronic
1081188316 11:40072510-40072532 GTCTCACTGGACTAAAATTAAGG - Intergenic
1082727406 11:56752604-56752626 GTACCACTGGGCCAAAATCAAGG - Intergenic
1082922289 11:58508644-58508666 GTTTCACTGGGCCAAAATCAAGG + Intergenic
1082984987 11:59160868-59160890 GTCTCGCTGGACTAAAATCAAGG - Intergenic
1083058902 11:59849087-59849109 GTCTCACTGGGCTAAAATCAAGG - Intergenic
1084294695 11:68204541-68204563 GTTTCACTGGGCCAAAGTCAAGG - Intronic
1084666655 11:70579999-70580021 GGCTCACTGGCCTAAAGTCAAGG - Intronic
1084702385 11:70795901-70795923 GTCTCACTTGGCTAAAGTCAGGG - Intronic
1084764470 11:71299167-71299189 GTCTCACTGGGCTAAAATCAAGG - Intergenic
1084765089 11:71303075-71303097 GTCTCACTGGGCTAAAGTCAAGG + Intergenic
1085275381 11:75295301-75295323 GCCTCACTGGACTAAAATCAAGG + Intronic
1085884346 11:80505210-80505232 GTCTCACTGGACTAAAGACAAGG - Intergenic
1086121113 11:83305253-83305275 GTCTTACTGGGCTAAAGTCAAGG - Intergenic
1086945153 11:92837421-92837443 CTCCCACTTGACAGAAGTCAGGG + Intronic
1088332335 11:108666558-108666580 GTTTCACTGGGCCAAAATCAAGG + Intronic
1088559753 11:111101378-111101400 GTCTCACTGGGCTAAAATCAAGG - Intergenic
1088572501 11:111236697-111236719 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1088734270 11:112714165-112714187 GTCTCACTGGACTAAAATCCAGG + Intergenic
1089047447 11:115515314-115515336 GCACCACTGGGCCAAAATCAAGG - Intergenic
1089569110 11:119390846-119390868 GTCCCACAAGACCAAATTCAAGG + Intergenic
1090717936 11:129446747-129446769 GTTCCACTGGACCTCAGGCAAGG - Intronic
1091364168 11:135003767-135003789 GTCCCACTGGAACATCTTCAGGG + Intergenic
1092001596 12:5037110-5037132 GTCTCTCTGGGCTAAAGTCAAGG - Intergenic
1093127571 12:15348842-15348864 GTCTCACTGGGCTAAAATCAAGG - Intronic
1093168054 12:15828434-15828456 GTTCCACTGGGCTAAAATCAAGG - Intronic
1094283698 12:28768954-28768976 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1094681887 12:32674472-32674494 GTCTCACTGGACTAAAATCAAGG - Intergenic
1095301588 12:40590566-40590588 GTCTCACTGGGCAAAAATCAAGG - Intergenic
1095403595 12:41842714-41842736 GTTTCACTGGGCTAAAGTCAAGG - Intergenic
1095721304 12:45404475-45404497 GTCTCACTGGACTAAAATCAAGG + Intronic
1095949080 12:47772004-47772026 GTCTCACTGGGCTAAAATCAAGG - Intronic
1096454591 12:51774545-51774567 GTCCCCCTGGAGCAAATGCAGGG - Intronic
1096872431 12:54601776-54601798 GTCTCACTGGGCTAAAATCAAGG - Intergenic
1096897966 12:54843784-54843806 GTCTCACTAGGCCAAAATCAAGG - Intronic
1097444749 12:59656539-59656561 GTCTCACTGAACTAAAATCAAGG - Intronic
1098358741 12:69634999-69635021 CTCCCACTGAACCAAAGGCAGGG - Intergenic
1099023778 12:77440148-77440170 GTGTCACTGGGCTAAAGTCAAGG + Intergenic
1099927509 12:89035622-89035644 GTCTCACTGGGCCAAAATCAAGG - Intergenic
1099957012 12:89360805-89360827 GTCTCCCTGGACTAAACTCAAGG + Intergenic
1100939329 12:99708473-99708495 GTTTCACTGGGCTAAAGTCAAGG + Intronic
1101407726 12:104443400-104443422 GTCTCAGTGGGCCAAAATCAAGG - Intergenic
1101481646 12:105103821-105103843 GTCTCACTGGGCTAAAGTAAAGG - Intergenic
1101749964 12:107575541-107575563 GCCTCACTGGGCTAAAGTCAAGG + Intronic
1102752001 12:115302964-115302986 GTATCACTGGGCCAAAATCAAGG - Intergenic
1103578329 12:121895507-121895529 GTCTCACTGGACTAAAATCAAGG + Intronic
1103887031 12:124210255-124210277 GTACCACTGGGCCAAAATCAAGG + Intronic
1104166821 12:126239767-126239789 GTTCCACTGGACTAAACTCAGGG + Intergenic
1104341927 12:127958421-127958443 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1104371277 12:128225830-128225852 GCTTCACTGGGCCAAAGTCAAGG - Intergenic
1105290562 13:19050540-19050562 GTCCTACTGCAGCAAAGCCAAGG + Intergenic
1105856941 13:24382701-24382723 GTCCCACTGGAACAGAGAGAGGG - Intergenic
1106764469 13:32900138-32900160 ATCTCACTGGACTAAAATCAAGG + Intergenic
1106857733 13:33871289-33871311 TTCTCACTGGGCTAAAGTCAAGG + Intronic
1107215163 13:37908373-37908395 GTTTCACTGGGCAAAAGTCAAGG - Intergenic
1107884911 13:44867228-44867250 GCCTCACTGGACTAAAATCAAGG + Intergenic
1109010033 13:56928630-56928652 ATGCCACTGCACCACAGTCAGGG + Intergenic
1109185115 13:59259126-59259148 GTATCACTGGGCCAAAATCAAGG - Intergenic
1109220595 13:59637194-59637216 GTTTCACTGGACTGAAGTCAAGG - Intergenic
1109379863 13:61545107-61545129 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1109724032 13:66315962-66315984 GTCTCACTGGGCTAAAGTCAAGG + Intronic
1109837274 13:67876569-67876591 GTTTCACTGGGCTAAAGTCAAGG - Intergenic
1109843763 13:67956617-67956639 GTCTCACTGAACAAAAATCAAGG + Intergenic
1110819700 13:79900271-79900293 GTCTCACTGGGCCGCAGTCAAGG - Intergenic
1110968872 13:81735787-81735809 GTTTCACTGCGCCAAAGTCAAGG - Intergenic
1112049288 13:95629684-95629706 TTCTCACTGGGCTAAAGTCAAGG - Intronic
1112207210 13:97336682-97336704 GTTTCACTGGGCCAAAATCAAGG - Intronic
1112407327 13:99132730-99132752 CTCCCACTGGTCAAAGGTCAGGG + Intergenic
1112703334 13:102037281-102037303 GTCTCAGTGGACTAAAATCAGGG + Intronic
1112837545 13:103534169-103534191 GTTCCACAAGACCAAAGACATGG - Intergenic
1113067701 13:106388725-106388747 GTTTCAGTGGACTAAAGTCAAGG + Intergenic
1113165352 13:107434587-107434609 GCATCACTGGACCTAAGTCATGG + Intronic
1113387281 13:109860377-109860399 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1113496498 13:110734165-110734187 GAACCAATGGAGCAAAGTCATGG - Intergenic
1114371185 14:22090230-22090252 GTTTCACTGGACTAAAGTCAAGG - Intergenic
1114571523 14:23672550-23672572 GTCCCACTGGGTCAAAATCAAGG + Intergenic
1114596018 14:23912320-23912342 GTCTCACTGGACTCAAGTCAAGG - Intergenic
1116168751 14:41370445-41370467 GTCTCACTGGGCTAAACTCAAGG - Intergenic
1116371014 14:44132574-44132596 GTCACACTGGAGGAAAATCAAGG + Intergenic
1117059507 14:51947608-51947630 GTCTCACTGGGCTAAAGTCAAGG - Intronic
1119179733 14:72597765-72597787 GTCCCACGGCACCCAAGTCCAGG - Intergenic
1119323264 14:73743934-73743956 GTACCCCTGGGCCAAAGACAAGG + Intronic
1120366638 14:83579881-83579903 GTTTCACTGGGCCAAAATCAAGG - Intergenic
1120559046 14:85968746-85968768 GTATCACTGGACCTAAGTCAAGG + Intergenic
1120572096 14:86132252-86132274 GTCTCACTGGACTAAAATCAAGG + Intergenic
1121298210 14:92847448-92847470 GTCTCACTGGGCTAAAGTCAAGG - Intergenic
1121612411 14:95290645-95290667 GTCTCACTGGGCTAAATTCAAGG - Intronic
1121613354 14:95295997-95296019 GTCTCACTGGGCGAAAATCAAGG + Intronic
1121720277 14:96104357-96104379 GTCTCACTAGGCTAAAGTCAAGG - Intergenic
1121842675 14:97147521-97147543 GTCTCACTGGGCTAAAGTCAAGG + Intergenic
1123420000 15:20123840-20123862 ATCTCACTGGGCTAAAGTCAAGG - Intergenic
1123445861 15:20329692-20329714 ATCTCACTGGGCTAAAGTCAAGG + Intergenic
1123529221 15:21130376-21130398 ATCTCACTGGGCTAAAGTCAAGG - Intergenic
1124425517 15:29559526-29559548 GTCTCACTGGGCTAAATTCAAGG + Intronic
1126361833 15:47854433-47854455 GTCCCACGGGTCTAAAGCCATGG + Intergenic
1126869213 15:52969692-52969714 GTCTCACTGGGCTAAAATCAAGG - Intergenic
1127331160 15:57941470-57941492 GTCCCACTTGACCAAATGCAAGG + Intergenic
1129157202 15:73725821-73725843 GTTTCACTGGGCTAAAGTCAAGG - Intergenic
1130320479 15:82837001-82837023 GTCTCACTGGGCTAAAATCAAGG + Intronic
1130711991 15:86292433-86292455 GTCCCACTGGGCAAAATTCAAGG - Intronic
1130797450 15:87224924-87224946 GACACACTGGACTAAAATCAAGG + Intergenic
1131070669 15:89463786-89463808 GTCCCCCAGGACCCCAGTCAGGG + Intergenic
1131424883 15:92337760-92337782 GTCTCACTGGACTAAAATCAAGG + Intergenic
1132295249 15:100729704-100729726 GTAGCACTTGGCCAAAGTCAAGG - Intergenic
1132334122 15:101033023-101033045 GTTTCCCTGGTCCAAAGTCAAGG + Intronic
1132568735 16:634975-634997 AGCCCACTGGACCAAGGTCGGGG + Intronic
1133526250 16:6608834-6608856 GTCTCACTGGACTAAAATCATGG + Intronic
1133657839 16:7883580-7883602 GTCTCACTGGACTAACATCAAGG + Intergenic
1133899933 16:9964522-9964544 GTCTCGCTGGACTAAAATCAAGG + Intronic
1134042696 16:11080615-11080637 GTCTCACTGGGCTAAAGTCTAGG + Intronic
1134180176 16:12041521-12041543 GTTTCACTGGGCTAAAGTCAAGG + Intronic
1135073605 16:19373897-19373919 GTCTCACTGGACTAGAATCAAGG - Intergenic
1136020425 16:27436631-27436653 CTCCCACTGGACAAAAATGATGG - Intronic
1136533476 16:30885339-30885361 GTCTCACTGGGTTAAAGTCAAGG - Intronic
1137705390 16:50532136-50532158 GTCCATCTGGAGCAAACTCATGG + Intergenic
1137845679 16:51685598-51685620 GTCTCACTGAGCTAAAGTCAAGG + Intergenic
1138487532 16:57356325-57356347 GTCTCAGTGGACTAAAATCAAGG + Intergenic
1138639616 16:58374046-58374068 GTCTCACTGGGCTAAAATCACGG + Intronic
1139276403 16:65731762-65731784 GTTTCACTGGGCCAAAATCAAGG - Intergenic
1139287270 16:65826841-65826863 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1139985547 16:70895578-70895600 GTCTCACTGGGCTAAAATCAAGG - Intronic
1140889578 16:79273496-79273518 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1141107416 16:81244931-81244953 GTACCACTGCACTAAAGTCTGGG - Intronic
1141967155 16:87453231-87453253 GGCCCGCTGGGCCACAGTCATGG + Intronic
1142028122 16:87825164-87825186 GTCCCACTGGACAGAACTCCGGG - Intergenic
1142454876 16:90214329-90214351 GTGCCACTGGACCTAAGACAAGG + Intergenic
1142961190 17:3553434-3553456 GTCCCACTGGAGCTGAGTCCTGG - Intronic
1143267890 17:5654047-5654069 GTCTCACTGGGCTAAAATCAAGG - Intergenic
1143620988 17:8080147-8080169 GTCCCACTGCCCCGAAGTCGGGG + Exonic
1144237786 17:13278762-13278784 GTTTCACTGAGCCAAAGTCAAGG - Intergenic
1144739720 17:17575079-17575101 TTACCACTGGGCCAAAATCAAGG + Intronic
1144871576 17:18375409-18375431 GTCTCACTGGACTAAAATCGAGG + Intergenic
1146728313 17:35173473-35173495 GTCTCACTCGGCTAAAGTCAAGG + Intronic
1148371897 17:47106195-47106217 GTCTCATTGGGCTAAAGTCAAGG + Intergenic
1149104796 17:52949616-52949638 GTCCCACTAGGCCAAAAGCAAGG + Intergenic
1150248506 17:63693168-63693190 GTCTCACAGGGCTAAAGTCAAGG - Intronic
1151142773 17:72010801-72010823 GTCTCACTGGGCTAAAATCAAGG - Intergenic
1151223262 17:72629691-72629713 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1151968754 17:77446195-77446217 GTCTCACCGGACTAAAGTCAAGG + Intronic
1151986284 17:77546049-77546071 GTCTCACTGCACTCAAGTCAAGG - Intergenic
1152174648 17:78779802-78779824 GTCTCACTGGGCTAAAGCCAAGG - Intronic
1153592331 18:6686814-6686836 GTCTCACTGGACTAAAACCAAGG + Intergenic
1153881755 18:9427371-9427393 GTTTCACTGGACTAAGGTCAAGG + Intergenic
1153952863 18:10071569-10071591 GTCCCACCAGGCCAAAATCAAGG - Intergenic
1155462216 18:26095603-26095625 GCCTCACTGGGCGAAAGTCACGG - Intergenic
1155601163 18:27549625-27549647 GTCTCACTGGACTACAATCAAGG - Intergenic
1156742114 18:40343697-40343719 TTCCCAGTGGCCCAATGTCATGG + Intergenic
1156959247 18:43003111-43003133 GTCTCACTGGACTAACATCAAGG - Intronic
1157179801 18:45487104-45487126 GTCACACTGGACTAAAATCAAGG + Intronic
1157521747 18:48350203-48350225 GTCTCACTGGGCTAAAATCAAGG + Intronic
1158410424 18:57200345-57200367 GTCCCAGTAGACCAAAGGAAGGG - Intergenic
1158590593 18:58775574-58775596 GTTTCACTGGGCTAAAGTCAAGG - Intergenic
1158954501 18:62524883-62524905 GTCCCTCTGTGCCAAAGACAAGG - Intronic
1159703949 18:71663653-71663675 GTCTCAGTGGGCCAAAATCAAGG - Intergenic
1159958527 18:74537577-74537599 GTCCCCCTGGGCCACAGCCAGGG - Intronic
1160087981 18:75797122-75797144 GTCTGACTGGACTAAAATCAAGG - Intergenic
1160884528 19:1339436-1339458 GTACCACTGCACCCAAGTCTGGG - Intergenic
1161093599 19:2376075-2376097 GCCTCCCTGGGCCAAAGTCAAGG + Intergenic
1162550173 19:11354447-11354469 GTCACACTGGATCACATTCAAGG + Intronic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1164050534 19:21582696-21582718 GTCCCACAAGGCCAAAGTCAAGG - Intergenic
1165162085 19:33822525-33822547 GTCACACTGGGCTAAAATCAAGG + Intergenic
1166123575 19:40700335-40700357 GTCCCCCTGGACCAGTGCCAGGG - Exonic
1166599636 19:44082597-44082619 ATCTCACTGGACAAAAATCAGGG + Intronic
1166666955 19:44685948-44685970 GTCTCACTGCACTAAAGCCAAGG - Intergenic
1167717307 19:51152072-51152094 GTGTCACTGGGCCAAAATCAAGG + Intronic
1168432920 19:56295550-56295572 GTCCCACTGCACCCCAGTCTGGG + Intronic
1168708231 19:58481756-58481778 GTCCCACTGGGCTAAAATCAAGG + Intronic
1202689527 1_KI270712v1_random:77140-77162 ATCTCACTGGGCTAAAGTCAAGG - Intergenic
926574445 2:14564537-14564559 GTCTCAATGGACTAAAATCAAGG - Intergenic
927062020 2:19432162-19432184 GTCTCACTGGGCTAAAGTCATGG - Intergenic
927420631 2:22926854-22926876 GTCTCACTGGGCTAAAATCAAGG + Intergenic
928041961 2:27887345-27887367 GTCTCACTGGGCTAAAATCAAGG - Intronic
928600029 2:32895470-32895492 GTCTCACTGGACTGCAGTCAAGG - Intergenic
930901058 2:56508199-56508221 GTCCCAGTGGAGCAAAGGAAAGG - Intergenic
930903094 2:56532066-56532088 GTCTCACTAGACTAAAGTCAAGG + Intergenic
931073760 2:58685571-58685593 AACTCACTGGACTAAAGTCAAGG - Intergenic
931245375 2:60488295-60488317 TTCCCACTGCACCAAAGAGACGG - Intronic
932131564 2:69192261-69192283 GTCTCACTAGACTAAAATCAAGG + Intronic
932629531 2:73327371-73327393 GTGCCACTGCACCCCAGTCAGGG - Intergenic
932936625 2:76110575-76110597 GTCCCACAAGACTACAGTCAAGG + Intergenic
933244365 2:79958623-79958645 GTCTCACTGGACTAAAATCAAGG - Intronic
933254985 2:80070743-80070765 GTTCCATTGGGCCAAAATCAAGG + Intronic
933956907 2:87378952-87378974 ATCTCACTGGGCTAAAGTCAAGG + Intergenic
934241028 2:90270842-90270864 ATCTCACTGGGCTAAAGTCAAGG + Intergenic
934272150 2:91545843-91545865 ATCTCACTGGGCTAAAGTCAAGG - Intergenic
936090219 2:109497063-109497085 GTCTCACTGGGCCAAAATCAAGG - Intronic
937519724 2:122697619-122697641 TTCTCACTGGGCCAAAGTCCAGG + Intergenic
937966974 2:127520002-127520024 GTCACACTGTACTAAAATCAAGG - Intronic
940068432 2:149655636-149655658 GTCTCACTGAGCTAAAGTCATGG - Intergenic
940329352 2:152457745-152457767 GTCCCACTGGGCTAAAACCAAGG + Intronic
940595822 2:155791434-155791456 GTCACACTGAACCAAAATCAAGG + Intergenic
941914674 2:170803262-170803284 GTCTCACTGGGCCAAAAGCAAGG + Intergenic
941985908 2:171511550-171511572 GTCTCACTGGGCCAAAATCAAGG - Intergenic
943071061 2:183141049-183141071 GTTTCACTGGGCTAAAGTCAAGG + Intronic
944156010 2:196608631-196608653 GCTTCACTGGACTAAAGTCAAGG + Intergenic
944278126 2:197862847-197862869 GTTCTTCTGGAACAAAGTCAGGG + Intronic
944546096 2:200800236-200800258 GTCTCACTGGGCTAAAATCAAGG - Intergenic
944946343 2:204690648-204690670 GTCTCACTGGGCTAAAATCAAGG - Intronic
945180208 2:207083972-207083994 GTCTCACTGGGCTAAACTCAAGG - Intronic
946174782 2:217915874-217915896 GTCCCAATGGCCCCACGTCATGG + Intronic
946326455 2:218986915-218986937 TTCCCTGTGGACCAAACTCAGGG + Intergenic
946911310 2:224464010-224464032 GTCTCACTAGTCTAAAGTCAAGG - Intergenic
947084724 2:226438084-226438106 GTCTCACTGGACTAAAACCAAGG - Intergenic
947094311 2:226548856-226548878 GTCTCACTGGACTAAAATGAAGG + Intergenic
947218357 2:227769627-227769649 GGCTCACTGGGCTAAAGTCAAGG + Intergenic
947538088 2:230953547-230953569 GTCTCACTGGGCTAAAATCAGGG - Intronic
947815271 2:233032551-233032573 GGCTGAGTGGACCAAAGTCAGGG - Intergenic
947816475 2:233040807-233040829 GTTTCACTGGGCTAAAGTCAAGG - Intergenic
948326292 2:237124447-237124469 GTCTCACTGGGCTAAAGTCAAGG - Intergenic
949086341 2:242158996-242159018 CTGCCACTGGACCTAAGACAAGG + Intergenic
1168881795 20:1212422-1212444 GTTTCACTGGATCAAAATCAAGG + Intergenic
1169524924 20:6413899-6413921 GTCTCACTGGGTTAAAGTCAAGG - Intergenic
1169688231 20:8301011-8301033 CTCACCCTGGACCAGAGTCAGGG + Intronic
1170218522 20:13917040-13917062 GTCCCATTGGGCCAAATCCAGGG + Intronic
1170413887 20:16120108-16120130 GTCTCACTGGGCTAAAGTCAGGG + Intergenic
1171148623 20:22807452-22807474 GTTTCACTGGGCCAAAATCAAGG + Intergenic
1171422333 20:25025562-25025584 GTCTCACAAGGCCAAAGTCAAGG + Intronic
1172669175 20:36622582-36622604 GTTTCACTGGACAAAAATCAAGG + Intronic
1173162908 20:40665527-40665549 GTCTCACTGGGCTAAATTCATGG + Intergenic
1173565222 20:44033751-44033773 GTCTCACTGAACTAAAGTGAAGG - Intronic
1174177099 20:48652013-48652035 GTCCCACTGGGCTGAAATCATGG - Intronic
1174506189 20:51019164-51019186 GACTCACTGGGCCAAAATCAAGG - Intronic
1174673714 20:52332941-52332963 GTATCACTGGGCCAAAATCAAGG + Intergenic
1175287387 20:57845973-57845995 GTCTTACTGGACCAAAATCAAGG - Intergenic
1175306743 20:57981467-57981489 GTCCCACAAGGCCAAGGTCAGGG + Intergenic
1175312039 20:58018841-58018863 GTCCCACAGGTCCTTAGTCATGG - Intergenic
1175597998 20:60250766-60250788 GTCTCACGGGGCCAAAATCAAGG - Intergenic
1175643200 20:60649049-60649071 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1175655659 20:60767767-60767789 GTCTCGCTGGGCTAAAGTCAAGG - Intergenic
1175702849 20:61153219-61153241 GTTTCACTGGACTAAAGTCAAGG + Intergenic
1177395829 21:20534626-20534648 GTCTCACTGGTGTAAAGTCAAGG - Intergenic
1177628624 21:23699101-23699123 GTCTCACTGGTCTAAAATCAAGG + Intergenic
1177710042 21:24762413-24762435 GTCTCACTGAGCCAAAATCAAGG + Intergenic
1177783489 21:25644330-25644352 GTCTCACTGGCCTAAAATCAAGG + Intronic
1178683717 21:34695099-34695121 GTCTCACTGAACTAAAATCAAGG + Intronic
1179034166 21:37745553-37745575 GTCTCACTGGGCTAAAGCCAAGG - Intronic
1179154861 21:38840927-38840949 GTCCCACTGGGCTAACGTCAAGG + Intergenic
1179316997 21:40252915-40252937 GTCCCCCTAGACCCAAGTAAGGG + Intronic
1179355448 21:40654541-40654563 ATCTCACTGGACTAAAATCAAGG + Intronic
1179936167 21:44604931-44604953 ATCCCACTGGATCATAGTGAAGG + Intronic
1180551893 22:16547441-16547463 ATCTCACTGGGCTAAAGTCAAGG + Intergenic
1181029452 22:20142836-20142858 GGCCCCCTGGCCCATAGTCAGGG - Exonic
1181352134 22:22266602-22266624 ATCTCACTGGGCTAAAGTCAAGG - Intergenic
1182877362 22:33703765-33703787 GTCTCACTGGACTAAAGTCAGGG - Intronic
1182877725 22:33706873-33706895 GTCTCACTGGACTAAAGTCAGGG - Intronic
1182883430 22:33753470-33753492 TTCTCACTGGGCTAAAGTCAAGG - Intronic
949849241 3:8405335-8405357 GTCTCACTGGACCAAAGTCTAGG - Intergenic
949898197 3:8786128-8786150 GTCTCACTGGGCTAAAATCAAGG - Intronic
951306995 3:21076438-21076460 GTTTCACTGGGCCAAAATCAAGG + Intergenic
951960036 3:28307836-28307858 GTCTCACTGGGCTAAAATCAAGG + Intronic
952290151 3:32007435-32007457 GTATCACTGGTCCAAAATCAAGG + Intronic
952553702 3:34507868-34507890 GTCCCACTCAATTAAAGTCAAGG - Intergenic
952815973 3:37448458-37448480 GTCTCACTGGATTAAACTCAAGG + Intergenic
954092736 3:48298041-48298063 GTCTCACAAGGCCAAAGTCAAGG - Intronic
954623749 3:52010871-52010893 GTCTCACTGGACTAAAATCAAGG - Intergenic
954731987 3:52672055-52672077 GTCTCACTGGTCTAAAATCAAGG + Intronic
954977701 3:54712280-54712302 GTCTCACTGGGTTAAAGTCAAGG + Intronic
955463223 3:59208489-59208511 GTCTCACTGGACTAAAATCGGGG - Intergenic
955514090 3:59709454-59709476 GTTTCACTGGGCTAAAGTCAAGG - Intergenic
956353072 3:68359644-68359666 GTCCCACTGGGTTAAACTCAAGG - Intronic
956536220 3:70280036-70280058 GTTTCACTGGAGCAAAATCAAGG + Intergenic
956586417 3:70869873-70869895 GTCTCACTGGGCTAGAGTCAAGG - Intergenic
956736699 3:72244010-72244032 GTCTCACTGGGCAAAAATCAAGG + Intergenic
956790786 3:72678560-72678582 GAACCACAGGACCAAAGTCCAGG + Intergenic
957682884 3:83460323-83460345 GTGTCACTGGACCAAAATCTAGG - Intergenic
957969228 3:87361706-87361728 GTCTCACTGGGCTAAAATCAAGG - Intergenic
958737042 3:98021192-98021214 GTCCCACTGCACCTTATTCATGG + Intronic
958882940 3:99693420-99693442 GTCCCACTGGAAGAACTTCAGGG - Intronic
959021180 3:101188977-101188999 GTCTCACTGGGCTAAAATCAAGG + Intergenic
959190529 3:103104701-103104723 GTCTCACTTGACTAAAATCAAGG - Intergenic
959204660 3:103290557-103290579 GTCCCACTGGAAGATCGTCAGGG - Intergenic
959908187 3:111733367-111733389 GTCCCTCTGTAGCAAAGGCATGG + Intronic
960743998 3:120866081-120866103 GTCTCACTGGACCAAAATCAAGG - Intergenic
960765617 3:121126766-121126788 GTCTCACTGGGCAAAAATCAAGG + Intronic
961185069 3:124907573-124907595 GTACCACTGGACTCAAGTCTGGG + Intronic
961732178 3:128973751-128973773 GTCCCACTGGGCCAATGCCGTGG + Intronic
962148035 3:132861808-132861830 GTCTCACTGGACTAAAATCAAGG - Intergenic
962290945 3:134135863-134135885 GTCCCACTTGTTCAAAGTAAGGG - Intronic
963033916 3:141008204-141008226 GTCTCACTGGGCTAAAATCAAGG - Intergenic
963541343 3:146593565-146593587 CTCCAACTGGAGCAAAGTCCAGG - Intronic
964513283 3:157477129-157477151 GTCTCACTGGACTAAAGTCAAGG + Intronic
964727827 3:159833216-159833238 GTCTCACTGGACTAAAATCAAGG + Intronic
965266010 3:166544077-166544099 GTGCCACTGCACAACAGTCAGGG + Intergenic
965856354 3:173092679-173092701 GTCTCACTGGGCTAAAATCAAGG - Intronic
966644286 3:182226039-182226061 GTCTCACTGGGCTAAAATCAAGG + Intergenic
966666114 3:182472806-182472828 GTCTCACTGGGCCAAAATCAAGG + Intergenic
966740900 3:183232330-183232352 GTCCCACAAGGCTAAAGTCAAGG - Intronic
967368540 3:188716174-188716196 GTTCCACTGGAACAAACTCCTGG - Intronic
967550626 3:190790537-190790559 GTGTCACAAGACCAAAGTCAAGG - Intergenic
968577499 4:1374707-1374729 GGGCCACTGGACCAAGGTCTTGG - Intronic
968821401 4:2854880-2854902 ATATCACTGGACCAAAATCAAGG + Intronic
969342696 4:6552315-6552337 GCCTCACTGGGCTAAAGTCAAGG + Intronic
969433674 4:7171415-7171437 TTCCCAGTGGATCAGAGTCATGG + Intergenic
969508038 4:7600298-7600320 GTGTCACTGGGCCAAAATCAAGG + Intronic
969633852 4:8353819-8353841 GGCCCACATGAACAAAGTCAAGG + Intergenic
970272951 4:14367044-14367066 GTCTCACTGGACGGAAGTGAAGG + Intergenic
970360709 4:15306039-15306061 GTCCCACTTGGCTAAAATCAAGG - Intergenic
971454944 4:26835349-26835371 GTCTCACTGGGCTAAAATCAAGG - Intergenic
971506014 4:27367386-27367408 GTTTCACTGGACTAAAATCAAGG + Intergenic
971797069 4:31241948-31241970 GTTTCACTGGGCCAAAATCAAGG - Intergenic
972269762 4:37499963-37499985 GTGCCACTGGACTCAAGTCTGGG - Intronic
972921697 4:43950416-43950438 GTCTCACTGGTCTAAAGTGAAGG - Intergenic
973167627 4:47096897-47096919 GTCTCACTGGAGTAAAATCAAGG - Intronic
973229623 4:47826418-47826440 GTTTCACTGGACTAAAGTCAAGG + Intronic
973329173 4:48895172-48895194 GTCTCACTGGGCTAAAATCAAGG - Intronic
973903020 4:55497107-55497129 GTCTCACTGGGCTAAAATCAAGG + Intronic
974009547 4:56594404-56594426 GTGCCTCTGGACCAAGCTCAAGG + Intronic
975098741 4:70487985-70488007 GTCTCACTGGGCTAAAATCAAGG + Intergenic
975709945 4:77151043-77151065 GTCTCACTGGGCTAAAATCAAGG - Intergenic
976048206 4:80978195-80978217 GTCTCACTGGACTAAAATCAAGG - Intergenic
976140687 4:81988533-81988555 GTCTCACTGGGCTAAAATCAAGG - Intronic
976537539 4:86235938-86235960 GTCTCACTGGGCTAAAGTCAAGG + Intronic
976744651 4:88391119-88391141 GTCTCACTGTGCTAAAGTCAAGG + Intronic
976932602 4:90587195-90587217 GTCTCACTGGTCTAAAATCAAGG - Intronic
978107184 4:104917127-104917149 GTCTCACTATACTAAAGTCAAGG - Intergenic
978753276 4:112276139-112276161 TTCTCACTGGACCAAAATCAAGG + Exonic
978963143 4:114708791-114708813 ATCCCACTGGGCTAAAATCAAGG + Intergenic
979238064 4:118423975-118423997 GTGCCACTGGACCTAAGACAAGG + Intergenic
979520199 4:121657091-121657113 GTATCACTGGACTAAAGTAAAGG - Intergenic
979942202 4:126775651-126775673 GTTTCACTGGACTAAAATCAAGG - Intergenic
980499621 4:133631633-133631655 ATTCCACTGGACTAAAATCAAGG + Intergenic
980847896 4:138345712-138345734 GTCTCACTGGGGCAAAATCAAGG - Intergenic
981291611 4:143082851-143082873 GTCTCACTGGGCTAAAGTTAAGG - Intergenic
981561034 4:146048660-146048682 GTCTCACTGGGCAAAACTCAAGG + Intergenic
982179681 4:152738273-152738295 GTACCACTGCACCATAGGCAGGG - Intronic
982359185 4:154500342-154500364 GTCTCACTGGGCCAAAATCAAGG - Intergenic
982828623 4:160031186-160031208 CTCCCACTGCACTAAAGTCTGGG + Intergenic
982923922 4:161311010-161311032 GTCTCACTGGACTAAAACCAAGG + Intergenic
982942332 4:161573912-161573934 GTTTCACTGAACTAAAGTCAAGG + Intronic
983085489 4:163438965-163438987 GTTTCACTGAACCAAAATCAAGG - Intergenic
983394458 4:167175980-167176002 GTCTCACTGGACTAAAATCAAGG + Intronic
983568504 4:169179346-169179368 GTCTCCCTGGGCCAAAATCAAGG - Intronic
983679099 4:170331309-170331331 GTTCCACTGGGCCAAAGTCTAGG + Intergenic
984874072 4:184352026-184352048 GTCTCACTGGACTAAAATCAGGG + Intergenic
986044764 5:4026485-4026507 GTCCCACTGGAAGACCGTCAGGG + Intergenic
986249787 5:6045419-6045441 GCCCCACCTGCCCAAAGTCAGGG - Intergenic
987385492 5:17325170-17325192 GTCTCACTGGGCTAAAGTGAAGG - Intergenic
988116019 5:26892021-26892043 GTCTCACTGGGCTAGAGTCAAGG - Intronic
988243950 5:28652861-28652883 GTCTCATTGGTCCAAAGTCAAGG + Intergenic
988593571 5:32570078-32570100 GTTTCACTGGGCTAAAGTCAAGG - Intronic
988722648 5:33893269-33893291 GTCTCACTGGGCTAAAATCAAGG + Intergenic
988994581 5:36702685-36702707 GTATCACTGGGCCAAAATCAAGG + Intergenic
989001591 5:36766498-36766520 GTTTCACTGGGCCAAAATCAAGG + Intergenic
989002262 5:36773622-36773644 GTGTCACTGGACTAAAATCAAGG - Intergenic
989114513 5:37939425-37939447 GTCTCACTGGGCTAAAATCAAGG + Intergenic
989610583 5:43286958-43286980 GTCTCAGTGGACTAAAATCAAGG + Intergenic
990441970 5:55855666-55855688 GTCTCACAGGACCAAAGCAAAGG - Intronic
990515615 5:56528535-56528557 GTTCCACTGGGCCAAAGTCAAGG + Intronic
990593921 5:57294325-57294347 GTTCTACTGGACAAAAATCAAGG + Intergenic
990719706 5:58680583-58680605 GTCCCACTGGACCAAAGTCAGGG + Intronic
990997147 5:61744317-61744339 GTCTTACTGGACTAAAGTTAAGG - Intronic
991111903 5:62909941-62909963 GTTTCACTGGGCTAAAGTCAAGG + Intergenic
992359780 5:76025248-76025270 GTCCCACTGGAGCATAGGCAGGG + Intergenic
992466047 5:77005973-77005995 GTCTCACTGGACTACAGTCAAGG - Intergenic
992644983 5:78803541-78803563 GCCCCAGTGGACCAAGGCCAGGG - Intronic
992647897 5:78829142-78829164 GTCTCACTGGACTAAATCCAGGG - Intronic
992654844 5:78898670-78898692 GTCTCACTGGGCTAATGTCAAGG + Intronic
993646840 5:90473665-90473687 AACCCACTTGACCAGAGTCAAGG - Intronic
994321899 5:98404171-98404193 GTCCCATTAGACTAAAGTCAGGG - Intergenic
994617205 5:102118791-102118813 GTCTCACTAGACTAAAATCAAGG - Intergenic
994633507 5:102315528-102315550 GTCTCACTGTACTAAAATCAAGG + Intergenic
995439758 5:112177157-112177179 GTCCTACTGGACTAAAATCAAGG + Intronic
995938488 5:117548463-117548485 GTCTCACTGGGCTAAAATCAAGG + Intergenic
996218460 5:120897361-120897383 GTCTCACTGGGCAAAAATCAAGG - Intergenic
996437719 5:123453894-123453916 GTCTTACTGTACCAAAGCCAAGG + Intergenic
996463916 5:123778393-123778415 GTTACACTGGGCTAAAGTCAAGG + Intergenic
997262277 5:132474415-132474437 GTCTCACTGGGCTAAACTCAAGG + Intronic
998745628 5:145256081-145256103 GTCTCACTGGGCTAAAATCAAGG + Intergenic
998877820 5:146618383-146618405 GTCTCACTGGGCTAAAGTCAAGG - Intronic
1000241297 5:159410943-159410965 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1000248288 5:159468593-159468615 GTCTCACTGGGCTAAACTCAAGG - Intergenic
1000263079 5:159608264-159608286 GTCCCACTGCACTCAAGTCTGGG + Intergenic
1000512730 5:162203887-162203909 TTGCCACTGCACCATAGTCATGG - Intergenic
1001172067 5:169428798-169428820 GTCTCACTGGGCTAAAATCAAGG - Intergenic
1001316268 5:170643282-170643304 GTTGCACTGGGCTAAAGTCAAGG - Intronic
1001516670 5:172360052-172360074 GTCTCACTGGCCTAAAATCAAGG - Intronic
1002072675 5:176689678-176689700 GTCCCATTGGACTAACATCAAGG + Intergenic
1002447671 5:179299603-179299625 GTCTCACTGGGCTAAAATCAAGG + Intronic
1002738491 5:181415951-181415973 CTGCCACTGGACCTAAGACAAGG + Intergenic
1003133153 6:3412950-3412972 GTCTCACTGGTCTAAAGTCGGGG - Intronic
1003416185 6:5910487-5910509 GTCTCACTGGGCAAAAGTCAAGG + Intergenic
1003804607 6:9713111-9713133 GTCCCATTGGGCTAAAGTCAAGG - Intronic
1003900192 6:10647786-10647808 GTCTCACTGGACTAAATTCAAGG + Intergenic
1004003480 6:11618229-11618251 GTCTCACTGGACCAAAGTCAAGG + Intergenic
1004487823 6:16084130-16084152 GTATCACTGGGCCAAAATCAGGG + Intergenic
1004785656 6:18964808-18964830 GTCTCACTGGGCTAAAATCAAGG - Intergenic
1004981627 6:21031066-21031088 GTCTCACTGGGCTGAAGTCAAGG + Intronic
1005105355 6:22218706-22218728 GTCTCACTGGACTAAAATCAAGG - Intergenic
1005347410 6:24904223-24904245 GTCTCACTGGACTAAAATCAAGG + Intronic
1005377655 6:25200299-25200321 CTCTCACTGGACTAAAATCAAGG - Intergenic
1005522198 6:26611319-26611341 CTCCCACTGAACCCTAGTCAGGG + Intergenic
1006662251 6:35657315-35657337 GTCTCACTGGGCTAAAATCAAGG + Intronic
1008547026 6:52592148-52592170 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1008938261 6:57016398-57016420 GTCTCACTAGACTGAAGTCAAGG + Intronic
1009705856 6:67251390-67251412 GTCACACTGTTCCAAGGTCACGG - Intergenic
1010014640 6:71090509-71090531 GTCTCACTGGACTAAAATCAAGG + Intergenic
1010062563 6:71641007-71641029 GTATTACTGGACCAAAGGCAAGG - Intergenic
1010366887 6:75061244-75061266 GGACCACTAGAGCAAAGTCATGG + Intergenic
1010719638 6:79268205-79268227 ATCTCAATGGACTAAAGTCAAGG - Intergenic
1011671499 6:89687868-89687890 ATCCCACTGGATAAAAGGCAAGG + Intronic
1012254072 6:97012486-97012508 GTCTCACTGGGCTAAAATCAAGG - Intronic
1012593437 6:101011482-101011504 GTCTCACTGGACTAAAATGAAGG - Intergenic
1012682406 6:102198475-102198497 GTCCCACTAGCCCAAGTTCAGGG + Intergenic
1013420311 6:109961104-109961126 GTCTCACTGGGCTAAGGTCAAGG - Intergenic
1013670865 6:112401031-112401053 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1014028460 6:116674894-116674916 GTCTCACTGGGCTAAAATCAAGG - Intergenic
1014212452 6:118721043-118721065 GTCTCACTGGGCTAAAGTCAAGG - Intergenic
1014328593 6:120030796-120030818 GTATCACTGGGCTAAAGTCAAGG - Intergenic
1014987167 6:128025644-128025666 GTATCACTGGGCCAAAATCAAGG + Intronic
1015028468 6:128566457-128566479 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1015281080 6:131434377-131434399 GTCCCACTGGGACAAAGGAAAGG + Intergenic
1015366629 6:132403006-132403028 GACCCACTGGGCAAATGTCAAGG + Intergenic
1015574438 6:134656331-134656353 GTTCCACTGGGCTAAAGTCAAGG - Intergenic
1015889336 6:137954265-137954287 GTCTCACTGGGCTAAAGTCAAGG + Intergenic
1017186795 6:151609624-151609646 GTCCCACTGGAAGAAAATTAGGG + Intronic
1017619692 6:156283536-156283558 GTCTCACAGGACCAAAATCAAGG - Intergenic
1018000724 6:159576322-159576344 GTCTCACTGGGCCCAAATCAAGG - Intergenic
1018968329 6:168506566-168506588 GACTCAATGGATCAAAGTCATGG - Intronic
1019214379 6:170433905-170433927 GTCTCACTGGGCTAAAATCAAGG - Intergenic
1019243594 6:170691503-170691525 CTGCCACTGGACCTAAGACAAGG + Intergenic
1020211142 7:6158974-6158996 GTCCCACTGCACCGATGACAGGG + Intronic
1020490162 7:8772528-8772550 TTCTCACTGGACCAAAATTATGG - Intergenic
1020602611 7:10294663-10294685 GTATCACTGGGCCAAAATCAAGG - Intergenic
1021476377 7:21066418-21066440 GTTTCACTGGCCCAAATTCAAGG + Intergenic
1021629365 7:22629323-22629345 GTTTCACTGGGCTAAAGTCAAGG - Intronic
1021932914 7:25599312-25599334 ATGCCACTGGACCAATGACAAGG + Intergenic
1022486520 7:30783107-30783129 GTCTCACTAGACTAAAGGCAAGG + Intronic
1023460053 7:40386593-40386615 GTCACAATGAATCAAAGTCATGG - Intronic
1023981227 7:45071612-45071634 GTCCCACTGGGCTAAAGTTGAGG + Intronic
1025937433 7:66048482-66048504 GTCTCACTGGGCTAAAATCAAGG - Intergenic
1026142456 7:67718024-67718046 GTCCCATGGGCTCAAAGTCATGG - Intergenic
1026442069 7:70453570-70453592 GTTTCACTGGGCCAAAATCAAGG + Intronic
1026473809 7:70717072-70717094 GTGCCACTGCACCACAGTCTGGG - Intronic
1026975053 7:74492715-74492737 TTACCACTGGGCCAAAATCAAGG + Intronic
1028527641 7:91803003-91803025 GTCTCACTGGGCTAAAATCAAGG + Intronic
1028977248 7:96927641-96927663 GTCCCACTGGAAGGAATTCAGGG - Intergenic
1030021082 7:105275884-105275906 TTTCCACTTGACAAAAGTCAGGG - Intronic
1030284432 7:107811304-107811326 ATCTCACTGGACTAAAATCAAGG + Intergenic
1030360553 7:108590753-108590775 GCCTCACTGGTCTAAAGTCAAGG - Intergenic
1030629123 7:111875775-111875797 GTTCCACTGGGCTAAAATCAAGG - Intronic
1030632060 7:111906884-111906906 GTCTCACTGAACTAAAATCAAGG - Intronic
1030866772 7:114709946-114709968 GTCTCAGTGGACTAAAGTCAAGG + Intergenic
1031632485 7:124061523-124061545 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1032112818 7:129091331-129091353 GTCCTTCTGGACCAGGGTCACGG - Intergenic
1032853414 7:135814339-135814361 GTCCCACTGGACTAAAAGCAAGG - Intergenic
1033068585 7:138180375-138180397 GTCTCACTGGGCTAAAATCAAGG - Intergenic
1033208964 7:139446248-139446270 GTCTCACTGAGCCAAAATCAGGG + Intergenic
1034341750 7:150361657-150361679 GTTTCACTGGGCCAAAGTCAAGG - Intergenic
1034396328 7:150828099-150828121 GTCTGGCTGGGCCAAAGTCAAGG + Intronic
1034860480 7:154590944-154590966 CACCCACTGGACCACAGTGATGG + Intronic
1034969600 7:155410823-155410845 GTCTCACTGGGCTAAGGTCAAGG + Intergenic
1035310808 7:157967362-157967384 GTCTCACTGGGCTGAAGTCAAGG + Intronic
1035504528 8:116657-116679 CTGCCACTGGACCTAAGACAAGG - Intergenic
1036201363 8:6773818-6773840 GTCTCACAGGACCTGAGTCATGG + Intergenic
1036527540 8:9548998-9549020 GTTTCACTGGGCTAAAGTCAAGG - Intergenic
1037145337 8:15565102-15565124 GTCTCACTGGGCTAAAGTCAAGG + Intronic
1037887504 8:22602545-22602567 CTCCCACTGGGACAAGGTCAAGG + Exonic
1038062069 8:23924944-23924966 GTATCACTGGGCCAAAATCAAGG + Intergenic
1038424502 8:27455716-27455738 GTCCAACTGGGCTAAAGTCAAGG - Intronic
1039486634 8:37915299-37915321 ATCCCAGGGGCCCAAAGTCATGG + Intergenic
1041113768 8:54513478-54513500 GTCTCACTGGACTAAAGTTAAGG - Intergenic
1041283686 8:56237857-56237879 GTCCCACTTGAGAAAAGTAAAGG - Intergenic
1041474122 8:58244416-58244438 GTCTCACTGGAATAAAATCAAGG + Intergenic
1042104851 8:65315519-65315541 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1042928196 8:73988323-73988345 GTTTCACTGTACTAAAGTCAAGG - Intergenic
1043514919 8:80986899-80986921 GTCTCACTGGGCTAAAATCAGGG - Intronic
1043830703 8:84985338-84985360 GTTTCACTGGACTACAGTCAAGG + Intergenic
1044233753 8:89807412-89807434 GTTTCACTGGGCGAAAGTCAAGG - Intergenic
1044855042 8:96467173-96467195 GTTCCACTGGACTAATCTCAAGG - Intergenic
1045634004 8:104161736-104161758 GTCTCACAAGACCAAAATCAAGG + Intronic
1046307032 8:112382239-112382261 GCACCACTGCACCAAAGTCTGGG + Intronic
1047010425 8:120667137-120667159 GTCCCACTGCAGCAAAGCCTGGG - Intronic
1047089339 8:121556413-121556435 GTCTCACTGGACTAAAATCAAGG - Intergenic
1047167097 8:122451549-122451571 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1047201903 8:122774302-122774324 GTCTCACTGGACTGAAATCAAGG + Intergenic
1047308846 8:123675853-123675875 GTCCCACTGGGTCACAGTCAGGG - Intergenic
1047690548 8:127349280-127349302 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1048140858 8:131792695-131792717 GCCCCACTAGGCCAAAATCAAGG - Intergenic
1048519083 8:135137292-135137314 GACCCACTGGGCTAAAATCAAGG - Intergenic
1048663884 8:136638750-136638772 GTCTCACTTGACTAAAATCAAGG - Intergenic
1048751788 8:137685306-137685328 GTTCCACTGGGCTAAGGTCAAGG + Intergenic
1049663894 8:143834472-143834494 GTCTCACTGGACTAGAATCAAGG - Exonic
1049711081 8:144063618-144063640 GTGCCTCTGGAGCAAAGCCAGGG - Intronic
1050642536 9:7683653-7683675 GTCTCACTGGGCCAAAATCAAGG - Intergenic
1051640361 9:19219390-19219412 GTACCACTGGGCTAAAATCAAGG + Intergenic
1051741762 9:20259208-20259230 GTCTCACTGGGCTAAAATCAAGG - Intergenic
1053132162 9:35621903-35621925 GTCTCACTGGGCTAAAGTCAAGG - Intronic
1053290393 9:36875884-36875906 GTCTCACTGGGCTGAAGTCAAGG - Intronic
1053290711 9:36878110-36878132 GTATCACTGGGCCAAAATCAAGG - Intronic
1053471641 9:38350647-38350669 GTTTCACTGGGCTAAAGTCAAGG + Intergenic
1053475504 9:38379370-38379392 GTTTCACTGGGCCAAATTCAAGG - Intergenic
1054862389 9:69967278-69967300 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1055030947 9:71770701-71770723 GTTTCACTGGGCCAAAATCAAGG - Intronic
1055071676 9:72173114-72173136 GTTTCACTGGTCCAAAATCAAGG + Intronic
1055538550 9:77276591-77276613 GTCTCACTGGGCAAAACTCAAGG + Intronic
1056896937 9:90559817-90559839 CTCCCACTGGGCTAAAATCAAGG + Intergenic
1057393802 9:94661548-94661570 GTCCCACTGGACTCCAGTCTGGG - Intergenic
1058549071 9:106093816-106093838 GTCCCACTGTCCCATTGTCAGGG - Intergenic
1058562564 9:106245499-106245521 GTCCCACTGGGTTAAGGTCAGGG + Intergenic
1059087162 9:111316546-111316568 GTCTCAATGGACTAAAGTCAAGG - Intergenic
1059486253 9:114629258-114629280 GTCTCACTGGACTAAAATCTAGG + Intronic
1060064574 9:120493215-120493237 GTCCCACTGGACTAAAATCAAGG - Intronic
1060235577 9:121860341-121860363 GTCCCGCTGGTCCAGGGTCATGG + Exonic
1060921446 9:127423349-127423371 GTCTCACTGGGCTAAAATCAAGG - Intergenic
1061339294 9:129966334-129966356 GTGCCACTAGACCAAGGTAAAGG + Intronic
1061410362 9:130417728-130417750 GCCTCACTGGGCCAAAGTTAAGG - Intronic
1061461927 9:130746896-130746918 GTATCACTGGGCCAAAATCAGGG + Intronic
1061721245 9:132552731-132552753 GACCCACTGGATCAGAGTCCTGG - Intronic
1061925051 9:133801906-133801928 GTCTCACTGAGCCAAAGTCCAGG - Intronic
1062727173 9:138081324-138081346 GTCCCCATGGACCTCAGTCATGG + Intronic
1203603783 Un_KI270748v1:40726-40748 CTGCCACTGGACCTAAGACAAGG + Intergenic
1186002351 X:5026850-5026872 ATCTCACTGGGCCACAGTCAAGG - Intergenic
1186044342 X:5518824-5518846 GTCTCACAAGAACAAAGTCAAGG + Intergenic
1186528392 X:10270571-10270593 GTCTCACAAGACCAAAGCCAAGG - Intergenic
1186624521 X:11278491-11278513 GTTGCACTGGACAAAAATCAAGG - Intronic
1186624988 X:11283833-11283855 GTCTCACTGGGCTAAAATCATGG - Intronic
1186698907 X:12068238-12068260 GTTTCACTGGGCCAAGGTCAAGG - Intergenic
1186965706 X:14784276-14784298 GTCTCACTGGGCTACAGTCAAGG + Intergenic
1188270006 X:28127679-28127701 GTCTCACTGGACTAAAGTCAAGG + Intergenic
1188990023 X:36807051-36807073 GTCACACTGGGCTAAAGGCAAGG + Intergenic
1189021550 X:37346997-37347019 GTCACACTGGACTAAAATCAAGG - Intergenic
1189114674 X:38330302-38330324 GTCTCACTGGACTAAAATCAAGG - Intronic
1189161566 X:38814334-38814356 GTCTCACTGGGCTAAAATCAAGG - Intergenic
1189396053 X:40623817-40623839 GTGCCACTGTACCAACGTGATGG + Intergenic
1189730127 X:44011493-44011515 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1189800242 X:44685203-44685225 GTCTCAAAAGACCAAAGTCAAGG - Intergenic
1191967652 X:66777532-66777554 ATCTCACTGGACTAAAATCAAGG - Intergenic
1192222944 X:69209843-69209865 GTATCACTGGGCCAAAATCAAGG - Intergenic
1192269341 X:69564253-69564275 GTTCCACTAGGCCAAAATCAAGG + Intergenic
1192341339 X:70266092-70266114 GTTTCAATGGACCAAAATCAAGG + Intergenic
1193429252 X:81380409-81380431 GTCTCACTGGGCCAAAATCAAGG + Intergenic
1194149197 X:90302412-90302434 GTGCCACTGGACTCAAGTCTGGG - Intergenic
1195288152 X:103405328-103405350 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1195970923 X:110472373-110472395 GTCTCACTGGGCTAAAATCAAGG - Intergenic
1196689960 X:118548728-118548750 GTCTCACTGGGCTAAATTCAAGG - Intronic
1196840610 X:119855641-119855663 GTCTCACTGGGCTAAAATCAAGG + Intergenic
1197714167 X:129694342-129694364 GTCCCACTGGGCTAAAATCAAGG - Intergenic
1198377360 X:136052987-136053009 ATCCCACTGGACTAAAATCAAGG - Intergenic
1199434338 X:147796066-147796088 GTCTCACTGGGCTGAAGTCAAGG - Intergenic
1199694763 X:150336045-150336067 GTCACACTGGGCTAAAATCAGGG + Intergenic
1199735340 X:150680792-150680814 GTCTCACTGGGCTAAACTCAAGG - Intergenic
1200495570 Y:3879149-3879171 GTGCCACTGGACTCAAGTCTGGG - Intergenic
1201111010 Y:10799487-10799509 GTCCCACTGCACTACAGTCTGGG - Intergenic
1201115011 Y:10828780-10828802 GTCCCACTGTACTAAAGTCTTGG - Intergenic
1202385843 Y:24325771-24325793 GTGCCACTGGACCTAAGACAAGG + Intergenic
1202484943 Y:25344357-25344379 GTGCCACTGGACCTAAGACAAGG - Intergenic