ID: 990722944

View in Genome Browser
Species Human (GRCh38)
Location 5:58718526-58718548
Sequence TAGAATAAGCCTGAGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 308}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990722944_990722950 25 Left 990722944 5:58718526-58718548 CCTTCTGCCTCAGGCTTATTCTA 0: 1
1: 0
2: 2
3: 29
4: 308
Right 990722950 5:58718574-58718596 CATTGTAAAATGAAGGTTTTTGG No data
990722944_990722948 18 Left 990722944 5:58718526-58718548 CCTTCTGCCTCAGGCTTATTCTA 0: 1
1: 0
2: 2
3: 29
4: 308
Right 990722948 5:58718567-58718589 TGGATGCCATTGTAAAATGAAGG 0: 1
1: 0
2: 1
3: 17
4: 199
990722944_990722947 -2 Left 990722944 5:58718526-58718548 CCTTCTGCCTCAGGCTTATTCTA 0: 1
1: 0
2: 2
3: 29
4: 308
Right 990722947 5:58718547-58718569 TATTAGGTTTTACTTAGAAGTGG 0: 1
1: 0
2: 1
3: 33
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990722944 Original CRISPR TAGAATAAGCCTGAGGCAGA AGG (reversed) Intronic
901527255 1:9831380-9831402 GAGGGAAAGCCTGAGGCAGAAGG + Intergenic
902089115 1:13888931-13888953 TCCTATAACCCTGAGGCAGAGGG - Intergenic
902289160 1:15425603-15425625 TTGGACAAGCCTGAGGCACAAGG - Intronic
902289712 1:15428165-15428187 CAGCAGAAGCCTGAGCCAGAAGG + Intronic
902335552 1:15752351-15752373 AAGAATAAGAGTGAGGCATATGG + Intergenic
903316685 1:22513455-22513477 AAAAATAAGGCTGAGGCAGGCGG + Intronic
903790607 1:25890409-25890431 TTCCATAACCCTGAGGCAGAGGG + Intronic
904626146 1:31804646-31804668 AAAGATAAACCTGAGGCAGAAGG + Intronic
906820111 1:48920414-48920436 TAGAATCTGCCTGAGGAAGTAGG - Intronic
907097324 1:51793613-51793635 CAGAATAAGGCTGAGGCCCAGGG + Intronic
907315106 1:53564003-53564025 AAGAATAAGCTTCAGGAAGAAGG + Intronic
907847447 1:58222033-58222055 TAGAATATGCTTTAGGCAGAGGG + Intronic
908743578 1:67354113-67354135 TAGAATAAGCATGAGGTAAGAGG + Intronic
908783239 1:67710979-67711001 TAGGCTATGCCTGAAGCAGAAGG - Intronic
909270511 1:73617753-73617775 TAGAATAACCCTGAACCGGAAGG - Intergenic
909321060 1:74286348-74286370 TAGAATGAGCCTGAGGCCTGAGG - Intronic
909814373 1:79973710-79973732 TAAAATAAGCCAGACACAGAAGG - Intergenic
912018533 1:105072871-105072893 TTGAATGAGCCCTAGGCAGAGGG - Intergenic
912172415 1:107116790-107116812 TAGAAAAATCCTGTGGCAAAAGG + Intergenic
912929732 1:113946864-113946886 GATAATGAGCCTAAGGCAGATGG + Intronic
915144495 1:153787810-153787832 CTGAATGAGCCTGGGGCAGATGG + Intergenic
918657416 1:187045645-187045667 TAGAGGATTCCTGAGGCAGATGG - Intergenic
919126181 1:193396143-193396165 TACTATAACCCTGAGGCAGAGGG - Intergenic
920087649 1:203429452-203429474 TTCTATAACCCTGAGGCAGAGGG - Intergenic
920092732 1:203465747-203465769 TGGAATATGCCTCAGGCAGAGGG - Intergenic
921001267 1:211045941-211045963 TGAAATAAGCCAGACGCAGAAGG - Intronic
1064174056 10:13058900-13058922 TAGAATATGCCTGAGTCATATGG - Intronic
1064600387 10:16986562-16986584 AAAAATAAGCCTGAAGCAGTCGG - Intronic
1065390824 10:25178894-25178916 TAGGATAAACCAGAGGCAGAAGG - Intronic
1066222269 10:33346740-33346762 TAAAATAAGCCTGTGGAAAATGG + Intergenic
1067047763 10:42994985-42995007 TAGAATAAGCCAGACACAAAAGG + Intergenic
1067246755 10:44553890-44553912 TAGGAGAGGCCTGAGGCACAAGG - Intergenic
1068354496 10:55894267-55894289 TAGGAGAAGGCTGAGGCTGATGG + Intergenic
1069273869 10:66565558-66565580 TAGGGAAAACCTGAGGCAGAGGG + Intronic
1070895482 10:79980363-79980385 TAGACTCACCCTGAGACAGAAGG + Intronic
1074188973 10:111119414-111119436 TAGAAAAAGACTGAAGAAGAAGG + Intergenic
1076093023 10:127704877-127704899 CAGCATAAGCCTGAGGTAAATGG - Intergenic
1076990712 11:272062-272084 TTGAATAAGCCAGACACAGAAGG - Intergenic
1078882806 11:15469143-15469165 TAGAATAAGCCAGTCACAGAAGG + Intergenic
1079013183 11:16846417-16846439 TAGAATCAGCCTGAGGTCCAAGG + Intronic
1079887994 11:26013357-26013379 TAAAATAAGCCAGACACAGAAGG + Intergenic
1080013573 11:27482195-27482217 TAACATTAGCCTGAGGCAGAGGG - Intergenic
1081762555 11:45586541-45586563 TAGAATGAGACTGAGGCTGAGGG + Intergenic
1082649271 11:55768427-55768449 TAAAATAAGCCAGTTGCAGAAGG + Intergenic
1084206048 11:67593619-67593641 TTCTATAACCCTGAGGCAGAGGG + Intergenic
1084883680 11:72189717-72189739 GAGCAGAAGCCTGAGCCAGACGG + Intronic
1084954324 11:72683470-72683492 TAGAAATGGCCTGAGGCAGGGGG - Intergenic
1085448402 11:76616200-76616222 TTGAACAAGCATGTGGCAGAGGG - Intergenic
1087285098 11:96256441-96256463 TAGAAGATTCCTCAGGCAGAGGG - Intronic
1087947643 11:104183605-104183627 TAGAATAAGCCTGATGGAAAGGG + Intergenic
1088508074 11:110545795-110545817 CAGAAAAAGCCTGAACCAGATGG + Intergenic
1088642532 11:111887221-111887243 TAAAATAAGCCAGACACAGAAGG - Intergenic
1089010752 11:115129835-115129857 TAGAAGAAGCGATAGGCAGAAGG + Intergenic
1090951151 11:131474521-131474543 TATAAAGAGCCTGAGGCATATGG - Intronic
1091268405 11:134288457-134288479 TGGCATAAGCCTAAGGCAGGAGG + Intronic
1092495507 12:8989783-8989805 TAGAATAAGTTTAAAGCAGAGGG + Intronic
1095133617 12:38571815-38571837 TAGACAAATCCTGAGCCAGAAGG + Intergenic
1095285846 12:40409461-40409483 GGGAATAAGCCAGAGACAGAAGG - Intronic
1096195027 12:49644253-49644275 AGGAAGAAGTCTGAGGCAGACGG - Exonic
1096876965 12:54636978-54637000 GAGAATAAACCTGAGGCAGAGGG - Intergenic
1097368303 12:58743946-58743968 TAAAATAAGCCAGATACAGAAGG + Intronic
1098609059 12:72432488-72432510 TCCTATAACCCTGAGGCAGACGG - Intronic
1100986274 12:100204275-100204297 TAGAGGAAGGCTGAGGCAGGAGG - Intronic
1101089912 12:101274681-101274703 CAGAATATTCCTCAGGCAGAAGG - Intergenic
1101321901 12:103680010-103680032 TGAAATAAGCCAGAGACAGAAGG + Intronic
1102382496 12:112479375-112479397 TAAATTAAACCTAAGGCAGATGG + Intronic
1102413792 12:112743056-112743078 CTGAATAAGACAGAGGCAGAGGG - Intronic
1104145517 12:126030407-126030429 TTCTATAACCCTGAGGCAGAGGG + Intergenic
1104241357 12:126993249-126993271 TAGAAAAAGCAGGTGGCAGAAGG + Intergenic
1104241570 12:126994752-126994774 TAGAAAAAGCAGGTGGCAGAAGG - Intergenic
1104503368 12:129307386-129307408 GCAAATAAGCATGAGGCAGAGGG - Intronic
1107148103 13:37081408-37081430 TGAAATGAGCCTGAGGCAGGAGG + Intergenic
1107553580 13:41498535-41498557 GAGAATGACTCTGAGGCAGATGG - Intergenic
1108444076 13:50488834-50488856 TAAAATAAGCCAGACACAGAAGG - Intronic
1108816742 13:54301676-54301698 TAGAATCACCCTGGGCCAGAAGG - Intergenic
1110053884 13:70940256-70940278 TAATATAAGCGTGAGGTAGAAGG - Intergenic
1110418676 13:75279947-75279969 TTCTATAACCCTGAGGCAGAGGG + Intergenic
1111328998 13:86737754-86737776 TTCTATAACCCTGAGGCAGAGGG - Intergenic
1111547099 13:89753455-89753477 TATTGTAAGCATGAGGCAGAAGG - Intergenic
1111768712 13:92568875-92568897 TAGAATATGCCTGACCTAGAGGG - Intronic
1112496236 13:99907252-99907274 GATAATAAGACTGAGGCACAGGG - Intergenic
1112607229 13:100918874-100918896 TGAAATAAGCCAGAGACAGAAGG + Intergenic
1114144663 14:19960404-19960426 TAAAATAAGTCTGAGAGAGAAGG - Intergenic
1114238756 14:20846789-20846811 CAGAACAAGTCTGAGGCAAAGGG - Intergenic
1114379819 14:22190583-22190605 TAGAATAACCCTGATGAATAAGG - Intergenic
1115129170 14:30032960-30032982 TAGAATAAGCCTCATTGAGAAGG - Intronic
1115749694 14:36477084-36477106 CAGAACAGGCCTGAGGGAGAGGG - Exonic
1116192548 14:41679491-41679513 TAGACAAATCCTGAGCCAGAAGG + Intronic
1117439862 14:55749370-55749392 TGGGATAAACCTGAGGCACATGG - Intergenic
1118134150 14:63003007-63003029 CACAGTAAGCTTGAGGCAGAAGG + Intronic
1119080250 14:71686188-71686210 TAAAGTAAGCCAGAGGGAGAGGG + Intronic
1119177987 14:72583649-72583671 AAGAAGAAGGCTGAGCCAGAGGG - Intergenic
1119379910 14:74221940-74221962 GAGAAAAAGCCTGAGGCCGGAGG + Intergenic
1119413565 14:74454698-74454720 TTCTATAACCCTGAGGCAGAGGG - Intergenic
1120175539 14:81289509-81289531 TTCTATAACCCTGAGGCAGAGGG + Intronic
1120445911 14:84595643-84595665 TAAAATAAGCCAGAGACAGAAGG - Intergenic
1120954220 14:90067342-90067364 TAAAATAAGCCAGACACAGAAGG + Intronic
1121449872 14:94000508-94000530 GAGAATGACCCTCAGGCAGAGGG + Intergenic
1121894816 14:97637091-97637113 GACAATAAGCCCGAGGCAGGAGG - Intergenic
1122177332 14:99930615-99930637 TTTAATAAGCCTGAGGGAGCTGG - Intronic
1123879477 15:24662975-24662997 GAGAATAAGCCTGATGCAGGTGG + Intergenic
1124604012 15:31157429-31157451 TAGAATTTGTCTAAGGCAGATGG + Intronic
1125344213 15:38702537-38702559 TTCTATAACCCTGAGGCAGAGGG + Intergenic
1125766372 15:42139292-42139314 TTCTATAACCCTGAGGCAGAGGG - Exonic
1125871055 15:43102173-43102195 TAGATTAGGCATGAGGCAAAAGG - Intronic
1126204493 15:46029682-46029704 TAAAATAAGCCAGACACAGAAGG - Intergenic
1127215255 15:56817126-56817148 AATAATAAGACTAAGGCAGAGGG - Intronic
1127539395 15:59921966-59921988 CAGAAGAGGGCTGAGGCAGATGG + Intergenic
1127746813 15:61985657-61985679 CAGAATAAACCTGTGGCTGAAGG + Intronic
1128567716 15:68712075-68712097 TAGGATGAGCCTGAGGGAAATGG + Intronic
1129936562 15:79455637-79455659 TGGAAGAAGCCAGAGTCAGAAGG - Intronic
1130661542 15:85834818-85834840 CAGAATAACCCTGAGGCTGTAGG - Intergenic
1131087718 15:89590970-89590992 TAAAATAAGCCTGATGGAGGAGG - Intronic
1131250037 15:90824346-90824368 TTCTATAACCCTGAGGCAGAGGG - Intergenic
1131641935 15:94302278-94302300 GAGAGTAAGCCTGTGGCAGTGGG + Intronic
1131780382 15:95850116-95850138 TAAAATGAACCTGAGGGAGAAGG - Intergenic
1132124398 15:99209674-99209696 TAGCAAAAGCCTGACACAGAAGG + Intronic
1132181819 15:99760242-99760264 TAGAATATGCCTGACCTAGAGGG + Intergenic
1133642027 16:7726339-7726361 AAGGAGAAGGCTGAGGCAGAAGG - Intergenic
1134455236 16:14390562-14390584 TAGAAAAAGCCTGAAGCAGCTGG - Intergenic
1135472328 16:22742518-22742540 TATAGTATGCCTGAGGCAGAAGG + Intergenic
1135757466 16:25109835-25109857 TGGAAGAAGGCGGAGGCAGATGG - Intergenic
1137748394 16:50840550-50840572 TAGACTAAGACTGTGGCAGTAGG + Intergenic
1137868725 16:51929110-51929132 TTGAGTACACCTGAGGCAGAAGG - Intergenic
1137904622 16:52308235-52308257 TTGGATAAGTTTGAGGCAGATGG + Intergenic
1137914231 16:52411371-52411393 TAGAATTAGAATGAGGGAGAAGG - Intergenic
1138190516 16:55010097-55010119 GAGACAAAGCCAGAGGCAGAGGG - Intergenic
1138786495 16:59852616-59852638 TAGAAAAATCCAGAGGGAGAGGG - Intergenic
1138923286 16:61558918-61558940 TAGACTATGCCTGAGGTACAAGG - Intergenic
1139319253 16:66100138-66100160 TAAAATAAGCCAGACACAGAAGG + Intergenic
1139403574 16:66700780-66700802 TAGAATAAGGCTGAGTGAGGTGG + Intergenic
1140620749 16:76729172-76729194 TAAAGAAAGCCAGAGGCAGAAGG + Intergenic
1141021323 16:80499331-80499353 TAGGATAAGGCTGAAGCAGATGG - Intergenic
1141957022 16:87379350-87379372 TTCTATAACCCTGAGGCAGAGGG + Intronic
1143240345 17:5438602-5438624 TAGAATAAGACTAAGGAAAAAGG + Intronic
1144250666 17:13413546-13413568 GAGGATATGCCTGATGCAGATGG + Intergenic
1144713464 17:17418602-17418624 TAGATAAGGCCTGAGTCAGATGG - Intergenic
1146143088 17:30386713-30386735 AAAAATAAGCCTGATGCAAAAGG - Intronic
1148347564 17:46913511-46913533 TAGCTTAGGCCTGAGACAGAGGG + Intergenic
1148800597 17:50222656-50222678 GAAAATAAGCCTGAGGCAGCTGG - Intergenic
1149294636 17:55250708-55250730 CAGAAAGAGCTTGAGGCAGAGGG + Intergenic
1149808424 17:59641357-59641379 TAGACTGAGGCTGAGGCAGGTGG + Intronic
1149972676 17:61234760-61234782 TGGAAAAAGCCTGAGCCAGAGGG - Intronic
1150793470 17:68219259-68219281 TAGAAAAAGGCTGATGCAGCTGG - Intergenic
1152463160 17:80451716-80451738 AAGAGTCAGCCTGAGGCAGCAGG - Intergenic
1153445857 18:5172074-5172096 TGAAATAAGCCAGATGCAGAAGG + Intronic
1154282716 18:13020338-13020360 TAAAATAAGCCAGACACAGAAGG - Intronic
1155719457 18:28992859-28992881 TAGATGATGCCTGAGGCAAATGG + Intergenic
1156977346 18:43238519-43238541 TTGAATAAGCCCTAGCCAGAGGG - Intergenic
1157517543 18:48321487-48321509 TAGAATCAGCCTGGGGAAGCTGG - Intronic
1158310916 18:56157115-56157137 AAAAAGAAGGCTGAGGCAGAAGG + Intergenic
1158456070 18:57608892-57608914 TAGAAAAAGCAAGAGGAAGAAGG + Intronic
1158754039 18:60300660-60300682 TAGAAAGAGCCAGAGCCAGATGG + Intergenic
1161271283 19:3390751-3390773 TAAAATAAGCCAGACACAGAAGG + Intronic
1161871509 19:6874050-6874072 TTCTATAACCCTGAGGCAGAGGG + Intergenic
1162599546 19:11657366-11657388 TTCTATAACCCTGAGGCAGAGGG + Intergenic
1162876505 19:13624523-13624545 TAGAATAGGCATCAGGCAGCAGG + Intergenic
925264463 2:2556955-2556977 TGGAATAAGCCAGGCGCAGAAGG - Intergenic
925583694 2:5440974-5440996 TGGAGCAAGACTGAGGCAGAGGG + Intergenic
925689573 2:6507220-6507242 TAAAATAAGCCTAAGGTACAAGG + Intergenic
925709606 2:6726135-6726157 TACAATAACCCTAAGGAAGAAGG + Intergenic
926119886 2:10236151-10236173 AAAAATCTGCCTGAGGCAGAAGG - Intergenic
926411208 2:12604659-12604681 GAGAATGAGCCTGGGGCAGCAGG - Intergenic
926489071 2:13501423-13501445 AAGAATATTCATGAGGCAGAAGG - Intergenic
927820452 2:26259520-26259542 TTCTATAACCCTGAGGCAGAGGG - Intronic
928342840 2:30460408-30460430 TAGAAAAAGGCTGAGGGGGAGGG - Intronic
928671303 2:33606239-33606261 TAGGATAAGGCAGAGGCAGGGGG + Intergenic
931992111 2:67801177-67801199 TAGCAGAAGACTGAGGCAGGAGG - Intergenic
932878149 2:75474499-75474521 TAGAAAAAGCCTGGGGAAAATGG + Intronic
934898212 2:98136909-98136931 TGAAATAAGCCAGTGGCAGAAGG - Intronic
939274339 2:139980953-139980975 TTAAATAAGCCAGATGCAGAAGG - Intergenic
940615832 2:156047756-156047778 TAGAATCAGCCTAAGCCAGCTGG + Intergenic
941092501 2:161194686-161194708 TAGCATAAGCCTTAGGCTAAAGG - Intronic
943102622 2:183507165-183507187 AAGAATAATCCTGAAGTAGAGGG - Intergenic
943373205 2:187042198-187042220 TAAAATAAGCCAGAGACAAAAGG - Intergenic
943922868 2:193732047-193732069 TAAAATAAGCCAGACACAGAAGG + Intergenic
944364924 2:198906612-198906634 AAGAATTAGACTGAGGCAGTTGG + Intergenic
944458796 2:199922385-199922407 TAAAAAAAGCCTGAGGCTGGGGG - Intronic
945752618 2:213807053-213807075 TAGGATAAGCCAGATGTAGAAGG - Intronic
947327557 2:228994289-228994311 TAGAATACTCCTGAGGCATGAGG - Intronic
1169003184 20:2183206-2183228 TATAAGAGGCCAGAGGCAGATGG - Intergenic
1170605886 20:17874850-17874872 TAGAATAGGCCTGAGGGAGTAGG + Intergenic
1171917798 20:31074068-31074090 TAGAATCAACCTGAGGGAAATGG + Intergenic
1172645683 20:36467858-36467880 TACAATAAGCCAGAGGCAGATGG + Intronic
1174602392 20:51735159-51735181 ACAAATAAGCCTGAGGCAGGGGG + Intronic
1175520739 20:59601225-59601247 TAAAAGAAGCCAGTGGCAGAAGG - Intronic
1175550318 20:59813342-59813364 TGGATTAACCCTGAGGCAGAAGG - Intronic
1177546072 21:22561015-22561037 TAGAATAACCCTAGGGAAGAAGG + Intergenic
1177669890 21:24210984-24211006 TAGAATAAGACTATAGCAGATGG - Intergenic
1179482700 21:41688488-41688510 TCAAATAAGGCTGAGGCAGGTGG + Intergenic
1184041907 22:41949390-41949412 AAGAAGAGGCCTCAGGCAGAAGG + Intergenic
1184114745 22:42415939-42415961 CAGAAAGAGCCTGAGGCAGAAGG + Intronic
949380475 3:3439615-3439637 AAGAATAAGGCTAAGGCAAATGG - Intergenic
949670082 3:6389409-6389431 TTCTATAACCCTGAGGCAGAGGG - Intergenic
949893133 3:8748060-8748082 GAGAATGGGCCTGAGGCAGGAGG + Intronic
949944349 3:9178291-9178313 TAAGATAAGCCTGGGGCAGCTGG + Intronic
949983528 3:9519794-9519816 TATACTCAGGCTGAGGCAGAAGG - Intronic
951097401 3:18648014-18648036 TGCAATGAGCCTGAGTCAGAAGG - Intergenic
951785885 3:26418606-26418628 GAAATTCAGCCTGAGGCAGAAGG - Intergenic
952106961 3:30081988-30082010 TTCTATAACCCTGAGGCAGAGGG + Intergenic
952404275 3:32991677-32991699 TATAAGAAGCCTGAGTCACATGG + Intergenic
952670676 3:35963676-35963698 TGGAATAAGCAGGAGGAAGAAGG + Intergenic
956475353 3:69613606-69613628 AATAATAAGCCTGAGGTAGGTGG - Intergenic
956649969 3:71495793-71495815 TTGAGCAAGCCTGAGTCAGAAGG - Intronic
959801798 3:110504022-110504044 TAGATTAAATTTGAGGCAGAAGG + Intergenic
960797938 3:121508101-121508123 GAAAATTAGGCTGAGGCAGAAGG - Intronic
961710209 3:128822693-128822715 TGAAATAAGCCTGAAACAGAAGG + Intergenic
962179343 3:133189243-133189265 TAGAATAATACAGAAGCAGATGG - Intronic
962421129 3:135230040-135230062 TAGGATGAGCCTGGGGCTGAGGG + Intronic
963508359 3:146216580-146216602 GAGAATAAAACTGAGGCATAAGG + Intronic
963928890 3:150981260-150981282 TGGAATAAGCCAGACTCAGAAGG + Intergenic
965887763 3:173469539-173469561 GAGAATATTCCTAAGGCAGATGG + Intronic
966556113 3:181261915-181261937 TGGAATAAGCCAGACACAGAAGG - Intergenic
967023861 3:185546688-185546710 TACACTGAGCCTGTGGCAGAAGG + Intronic
967149626 3:186636838-186636860 CAGAGTATGCCTGAGGCACAAGG - Intronic
967215450 3:187206026-187206048 TGAAATAAGCCAGATGCAGAAGG - Intergenic
967394612 3:188993133-188993155 TGGAATAGGCCTGGGGTAGAAGG + Intronic
967489776 3:190076962-190076984 TAGTAACACCCTGAGGCAGATGG - Intronic
968138909 3:196240203-196240225 TAGAATAAGCCAGTGATAGAGGG - Intronic
968829804 4:2927290-2927312 TGGAATTAGCCTGGGGCAGCTGG + Intronic
969233574 4:5849347-5849369 GAGAATCAGACTGAGGTAGAAGG + Intronic
971359574 4:25924150-25924172 TGGAATACCCCAGAGGCAGATGG + Intronic
971401168 4:26276556-26276578 AAGAACAAGCCTGAGGCCCAAGG - Intronic
973754081 4:54055281-54055303 TACATTAAGCGTAAGGCAGAAGG + Intronic
974199010 4:58614625-58614647 TATAATAAGTCTGAAGCAAAGGG + Intergenic
974287010 4:59881910-59881932 TTCTATAAGCCTGTGGCAGAGGG - Intergenic
974637648 4:64585431-64585453 AAGGATAAGCCTGAGGGAGAAGG - Intergenic
976722021 4:88178296-88178318 TAGAAACACCCTGAGCCAGAAGG + Intronic
978910320 4:114054903-114054925 TAGAAAAAGCAGGATGCAGAAGG - Intergenic
980094695 4:128477085-128477107 TAAAATAAGCCAGACACAGAAGG + Intergenic
980154750 4:129091059-129091081 TAGAAAAAGTCAGAGGCAGGTGG + Intronic
980382931 4:132048867-132048889 AAAAATAAGCCTGAAGCACAAGG - Intergenic
981123308 4:141077368-141077390 TAGAAGAAGCCAGATGCAAAAGG + Intronic
981856570 4:149300904-149300926 TAGGATAAGCCTGTGGAAGAAGG + Intergenic
982854839 4:160368332-160368354 TAGAATAAACCAGAAGCAAAAGG + Intergenic
982893207 4:160882386-160882408 TAAAATAAGCCAAATGCAGAAGG + Intergenic
983110895 4:163748146-163748168 TTCTATAACCCTGAGGCAGAGGG - Intronic
983228204 4:165104919-165104941 GAGAATGAGCTAGAGGCAGAGGG - Intronic
984679504 4:182590957-182590979 AAGAATAAGCCAAAAGCAGAGGG - Intronic
985059606 4:186063953-186063975 TGAAATAAGCCAGATGCAGAAGG + Intergenic
989605066 5:43236370-43236392 TACAAGGAGGCTGAGGCAGAAGG + Intronic
990722944 5:58718526-58718548 TAGAATAAGCCTGAGGCAGAAGG - Intronic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
995119209 5:108518323-108518345 TAAAATAAGGCTGAGACATATGG - Intergenic
995497088 5:112758006-112758028 AAAAATAAGTCTGAGGCAGAGGG + Intronic
995598730 5:113774153-113774175 TAGCATAAGCCTGAACCACAAGG + Intergenic
995804796 5:116039140-116039162 GAGTGTAAGCCTGGGGCAGAAGG + Intronic
997048915 5:130355481-130355503 GAGAATAAGGCTATGGCAGATGG + Intergenic
997295535 5:132766222-132766244 GAGAATACCACTGAGGCAGAAGG - Intronic
997354280 5:133252429-133252451 CTGCATCAGCCTGAGGCAGAGGG - Intronic
997605813 5:135175029-135175051 TAAAATAAGCCTTGGGCCGATGG + Intronic
998361190 5:141589191-141589213 AAGAATAAGCATGAGAAAGAAGG + Intronic
999700828 5:154226348-154226370 AAGAATAAGCTTCAGGCAGAAGG - Intronic
1000482903 5:161802031-161802053 TAGAATAATCCTGGGGAAGTAGG - Intergenic
1001242207 5:170079502-170079524 TAGAATAGGCCTGGGGCTGGGGG - Intronic
1002340569 5:178514167-178514189 TGAAATAAGCCAGACGCAGAAGG - Intronic
1002449769 5:179312034-179312056 TAACATTAGCCTGGGGCAGAGGG - Intronic
1004009550 6:11669088-11669110 TTCTATAACCCTGAGGCAGAGGG - Intergenic
1004115213 6:12760113-12760135 TAGAACAAGCATGAAGCAGAAGG - Intronic
1004184177 6:13407765-13407787 TACAATAGGCCTCAGTCAGATGG + Intronic
1004605568 6:17192030-17192052 AAGAATAAGCTTCAGGCAGATGG - Intergenic
1004657149 6:17674058-17674080 TAGAATAAGCCAGACTCAAAAGG + Intronic
1004883346 6:20029891-20029913 TAAAATAAGCCAGACACAGAAGG - Intergenic
1006428223 6:33979288-33979310 GAGAAGAAACCTGGGGCAGAGGG - Intergenic
1006898434 6:37485006-37485028 CAAAGTAGGCCTGAGGCAGAGGG - Intronic
1007153311 6:39717300-39717322 TAGAGTAAGCAAGAGGTAGAGGG - Intronic
1008938000 6:57013290-57013312 TAGAATCAGCCTAAGAAAGAGGG + Intronic
1010499306 6:76576652-76576674 TAAAATTAGCCTGTGGGAGAGGG + Intergenic
1011005350 6:82638228-82638250 TAAAAGAAGCCAGTGGCAGAAGG + Intergenic
1011171803 6:84513141-84513163 TTTTATAAGGCTGAGGCAGAAGG - Intergenic
1012331629 6:97997441-97997463 TAAAAGAAGGCTGAGTCAGAAGG - Intergenic
1012643665 6:101653530-101653552 TAGAAAAATACTCAGGCAGAGGG - Intronic
1013925653 6:115468555-115468577 TAGAATCACCCTGGGCCAGAAGG - Intergenic
1015264179 6:131273789-131273811 AAGAAAAAACCTGAGGCAGAAGG - Intronic
1016098028 6:140061973-140061995 TAGAAGAATGCTGAGGGAGATGG + Intergenic
1020891050 7:13878091-13878113 CAGAGTAAGCCTCATGCAGAAGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023676203 7:42632784-42632806 TCGAATGAGCCTGGGGCTGATGG + Intergenic
1024269764 7:47633482-47633504 GAGAACAAGCCTGAGACGGAAGG - Intergenic
1025953791 7:66167039-66167061 AGGGATAAGGCTGAGGCAGAGGG - Intergenic
1027428880 7:78089361-78089383 TAGAATAAATCTGGGGGAGAAGG + Intronic
1028679220 7:93506238-93506260 TACAATATGTCTGATGCAGATGG + Intronic
1031314754 7:120242065-120242087 TGCAATAAGCCAGACGCAGAAGG + Intergenic
1031421342 7:121555739-121555761 TATAATAGGCCTGAGGAGGATGG - Intergenic
1033906975 7:146217524-146217546 TAGAAGAAACCTGAGGCGCAGGG + Intronic
1034617267 7:152429373-152429395 TAGAAAAAGCCTCAGGTAAAAGG - Intronic
1035820210 8:2583476-2583498 TAAAATAAACCAGAAGCAGAAGG - Intergenic
1037197954 8:16215060-16215082 TTCTATAACCCTGAGGCAGAGGG + Intronic
1038102005 8:24388147-24388169 TTCTATAACCCTGAGGCAGAGGG - Intronic
1039069739 8:33638842-33638864 TAAAATAAGCCAGACGCAAAAGG - Intergenic
1039166807 8:34690510-34690532 TTGAATCATCCTCAGGCAGATGG - Intergenic
1039880920 8:41625188-41625210 CAGAGTAAGCCTCAGGCTGACGG - Intergenic
1040562355 8:48535043-48535065 TGAAATAAGCCAGATGCAGAAGG + Intergenic
1042374183 8:68029915-68029937 TAGAATAAGCCTGAGTAATTGGG + Intronic
1042953742 8:74226549-74226571 AAGAATAAGCATGGGGAAGATGG + Intergenic
1042994990 8:74687564-74687586 TAGAATAAGCCAGGCGCAGAGGG + Intronic
1043699430 8:83267002-83267024 TATCATAAGGCTGAGGCAGCAGG + Intergenic
1043944836 8:86238201-86238223 TTCTATAACCCTGAGGCAGAGGG - Intronic
1044523563 8:93226464-93226486 TAAAATAAGCAAGAAGCAGATGG - Intergenic
1045062353 8:98421250-98421272 TAGGATATGCCTGAGGCCAAGGG + Intronic
1045157016 8:99487705-99487727 TAGAATAAGCCAGACACAAAAGG - Intronic
1045186626 8:99844661-99844683 TAAAAGAAGCCTGAGGCCGGGGG - Intronic
1045272827 8:100676423-100676445 TTTAATAGGCCTGAGGCAGGAGG - Intergenic
1045505952 8:102778908-102778930 TAAAAGAAGCCAGATGCAGAAGG + Intergenic
1046639338 8:116709133-116709155 TATGATAAGCCTGAGCCAGCTGG - Intronic
1046846731 8:118924823-118924845 TAAAACAAGCGTGAGGCAAAAGG + Intronic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1049104377 8:140602594-140602616 TTGAATTAGCCTGAGCCACAGGG - Intronic
1049955448 9:688817-688839 GAGAATAAGCCTGAGACAAAAGG - Intronic
1050085050 9:1956445-1956467 TGAAATAAGCCAGATGCAGAAGG + Intergenic
1050819179 9:9856129-9856151 GAGAATAATCCTGCCGCAGATGG - Intronic
1051814003 9:21083004-21083026 TAAAAGAAGCCTGAGCCTGAGGG - Intergenic
1052183607 9:25562706-25562728 TAAAATAAGCCAGATACAGAAGG + Intergenic
1052950516 9:34206315-34206337 AAGACTAAGCCTGAGCCAAACGG + Intronic
1055368062 9:75567094-75567116 TTCTATAACCCTGAGGCAGAGGG - Intergenic
1056133829 9:83610978-83611000 TAGACTTAGCCTGAAGCATAGGG - Intergenic
1057673928 9:97121800-97121822 ATGAATAAGCCTGCGGCTGATGG + Intergenic
1058626736 9:106941336-106941358 TAGATTAGGCCTGAGGCTTAGGG - Intronic
1059586852 9:115616525-115616547 AAGAATAAAACTGAGGCTGAAGG + Intergenic
1059657769 9:116371684-116371706 AAGAAGGAGGCTGAGGCAGAAGG - Intronic
1059897396 9:118882222-118882244 TAGAATAAGCTAGAGACAGTAGG + Intergenic
1060703382 9:125779165-125779187 TAGAATAAGCCAGACACAAAAGG - Intronic
1061129187 9:128698495-128698517 TTTAATAGGCCTGAGGCAAAGGG + Intergenic
1185483170 X:463298-463320 TAAAATAAGCGTGTGGCAGACGG - Intergenic
1185833621 X:3324024-3324046 TGGTACAAGCCTGAGTCAGATGG + Exonic
1186473100 X:9836452-9836474 TAGACTGAGGCTGAGGCTGAAGG - Intronic
1187211962 X:17240831-17240853 TAGAGTAAGAATGAGGCATAAGG + Intergenic
1187636792 X:21238168-21238190 TAGAAACACCCTGGGGCAGAAGG + Intergenic
1188611650 X:32106832-32106854 TACAATTACCATGAGGCAGAGGG + Intronic
1192623957 X:72708588-72708610 TAGACTAAGGTTGAGGCAGAAGG + Intronic
1192678759 X:73229519-73229541 TTGAATAAGCCTGAAGGAAAAGG - Intergenic
1193219367 X:78904360-78904382 TGAAACAAGCCAGAGGCAGAAGG - Intergenic
1196975842 X:121156713-121156735 TAACATAAGCCTCAGGCACAGGG - Intergenic
1198006800 X:132503238-132503260 CAGAATAAGCCAGAGGAGGAGGG + Intergenic
1198658843 X:138944325-138944347 TTCAATAAGCCTAAGGGAGATGG + Intronic
1199056923 X:143307529-143307551 TTCTATAACCCTGAGGCAGAGGG - Intergenic
1199156107 X:144550903-144550925 TAGACAAACCCTGAGCCAGAAGG + Intergenic
1199417567 X:147603442-147603464 AAAAATAAGTCTAAGGCAGAAGG - Intergenic
1199564776 X:149204070-149204092 TAGAATAAGTCTTAGGAAAAAGG + Intergenic
1199593908 X:149492163-149492185 TTCTATAACCCTGAGGCAGAGGG - Intronic