ID: 990723713

View in Genome Browser
Species Human (GRCh38)
Location 5:58729112-58729134
Sequence CGTGATCTGCAGAAAGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990723713_990723714 -10 Left 990723713 5:58729112-58729134 CCTGGCACTTTCTGCAGATCACG 0: 1
1: 0
2: 0
3: 11
4: 132
Right 990723714 5:58729125-58729147 GCAGATCACGTAAGACCTAGCGG 0: 1
1: 0
2: 0
3: 3
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990723713 Original CRISPR CGTGATCTGCAGAAAGTGCC AGG (reversed) Intronic
900498356 1:2987186-2987208 CCAGATTTGCAGAAAGTGCCCGG - Intergenic
904756056 1:32769607-32769629 AGTGCCCTGCAGAATGTGCCTGG + Intronic
906190332 1:43894870-43894892 AGTGATCTGCCTAAAGTGCTGGG + Intronic
915181018 1:154059999-154060021 AGTGATCTGCCCAAAGTGCTAGG - Intronic
915230713 1:154443506-154443528 AGTGCTCTGCACAAAGTGGCAGG - Intronic
917550319 1:176020073-176020095 TGTGATCTGCCCAAAGTGCTGGG - Intronic
922308182 1:224362728-224362750 CGTAATCTGCCCAAAGTGCTGGG + Intronic
1063450697 10:6148142-6148164 TGTGCTCTCCAGCAAGTGCCAGG + Intronic
1063990395 10:11555039-11555061 CATGATCTGCCCAAAGTGCTGGG + Intronic
1064872083 10:19948892-19948914 CGTGATTTGCCCAAAGTGCTGGG - Intronic
1065878737 10:30021141-30021163 CATGAGCTGAAGAAAGAGCCAGG - Intronic
1068818373 10:61344495-61344517 CCTGACCTGCAGAAACTGCAAGG - Intergenic
1075275076 10:121085929-121085951 CAGGTTCAGCAGAAAGTGCCTGG + Intergenic
1077321213 11:1942928-1942950 GGTGATCTGCAGCCAGGGCCTGG + Intergenic
1077999058 11:7478538-7478560 AGTGAGCTGCAGAAAGTGTTGGG + Intergenic
1078359598 11:10658120-10658142 GGAGATCTGCTGAAAGTGCTGGG + Intronic
1080322337 11:31025999-31026021 TGTAAAATGCAGAAAGTGCCAGG + Intronic
1080803750 11:35633159-35633181 AGTGATCTGCCCAAAGTGCTAGG + Intergenic
1081381236 11:42417915-42417937 CTTCATCTTCACAAAGTGCCTGG + Intergenic
1081425911 11:42926308-42926330 TGTGATAAGCAGAAATTGCCAGG - Intergenic
1082704519 11:56477238-56477260 TGTGATCTGAGGCAAGTGCCAGG + Intergenic
1083870758 11:65487065-65487087 CGTGACCTGCTGAAGGTCCCAGG + Intergenic
1084750601 11:71202344-71202366 CCTGAGCTGCAGAGAGTGGCTGG - Intronic
1085714045 11:78856070-78856092 TGAGATCTCCAGAAAGTGCCAGG + Exonic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1090327618 11:125902962-125902984 CGAGAGCTCCAGAAAGTACCAGG + Intronic
1090812710 11:130260909-130260931 AGTGATCAGCAGACAGTTCCAGG - Exonic
1095121508 12:38424871-38424893 AGTTTTCTGCAGAAAATGCCAGG + Intergenic
1098626249 12:72673433-72673455 CGTGACATGCTGAAACTGCCTGG - Intergenic
1098690317 12:73479911-73479933 CTTCATCTTCAGAAAGGGCCTGG - Intergenic
1101840745 12:108325883-108325905 CCAGTTCTGCAGAAAGTGCAAGG + Intronic
1102010080 12:109612842-109612864 AGTGATGTCCAGAAAGTCCCAGG - Intergenic
1102078967 12:110082685-110082707 CGTGATCCGCCCAAAGTGCTGGG + Intergenic
1102919917 12:116784251-116784273 CGTGAGCTGCAGTGAGAGCCAGG - Intronic
1103061109 12:117859381-117859403 AGTGATCTGCCAAAAGTGCTGGG + Intronic
1103122935 12:118395928-118395950 GGTGATCTGCCCAAAGTGCTGGG + Intronic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1113806268 13:113111299-113111321 CGTGAGCTGGAGAAAGTCCCAGG - Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1121030713 14:90656568-90656590 CTTGCTCTGTAGAAAGTCCCAGG + Intronic
1121795176 14:96728567-96728589 TGTGGTCTGCAGGGAGTGCCGGG - Intergenic
1127299385 15:57637950-57637972 CATGATCTGCAGGATGTGGCTGG - Intronic
1129184949 15:73900288-73900310 CGTGCTAAGCAAAAAGTGCCCGG + Intergenic
1131425326 15:92341216-92341238 CGTGTTCCGCAGGATGTGCCGGG - Intergenic
1132074329 15:98807084-98807106 CGTGAGCTGAAGAATGTCCCAGG - Intronic
1133101125 16:3480665-3480687 CGTGATCTGCCCAAAATGCCGGG - Intronic
1135693609 16:24566501-24566523 GGTGATCTGCACAAAGTGCTGGG - Intronic
1136075376 16:27813668-27813690 CGGGATCTGCAGAATCTGCAGGG + Intronic
1137582744 16:49643887-49643909 CGTCAGCAGCAGAAAGAGCCAGG + Intronic
1139324293 16:66139982-66140004 CGTGAGCTGCAGAAAGAGTGAGG - Intergenic
1142874757 17:2844963-2844985 CGTGGACTGCAGAAACTGGCAGG - Intronic
1143679380 17:8465030-8465052 CCTGTACTGCAGACAGTGCCCGG - Intronic
1146559321 17:33854624-33854646 CAAGATCTGCAGAAAGAGCAGGG + Intronic
1149825450 17:59824011-59824033 GGTGATCTGCCCAAAGTGCCGGG - Intronic
1150102365 17:62434871-62434893 CCTGGTGTGGAGAAAGTGCCAGG + Intronic
1150854874 17:68742663-68742685 CTTGATCTGCAGCAAGTATCTGG - Intergenic
1150998889 17:70351175-70351197 CGTGATCTACCAAAAGTGCTGGG - Intergenic
1151364950 17:73611302-73611324 GGTTCTCTGTAGAAAGTGCCAGG - Intronic
1151978724 17:77497054-77497076 CCTGCTCTCCAGAAAGTTCCTGG - Intronic
1152081121 17:78187714-78187736 CGTGATCCGCCAAAAGTGCTAGG - Intronic
1153112374 18:1607480-1607502 CTGGAGCTGCAGAAAGTCCCTGG - Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1155875000 18:31075264-31075286 CGTGATCTGGAGACAATGACAGG + Intronic
1159639966 18:70852098-70852120 CGTAAACTGGAGAAAGTTCCAGG - Intergenic
1160490515 18:79333793-79333815 CCTGAGCTACAGAAAGTTCCTGG + Intronic
1161915522 19:7225336-7225358 GCTGATCTGGAGAAAGTGTCGGG - Intronic
1162032317 19:7922830-7922852 CGGGATCCTCAGAAAGAGCCAGG - Exonic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1168323394 19:55523973-55523995 CGTGATCCGCCCAAAGTGCTGGG - Intergenic
926579461 2:14618813-14618835 CGTGCTCTGCAGACAGTGGGAGG - Intergenic
929622729 2:43372939-43372961 AGTGATCTGCCCAAAGTGCAGGG + Intronic
930706563 2:54510194-54510216 GGTGATCTGCCCAAAGTGCTGGG + Intronic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
932147191 2:69332553-69332575 AGTGATCTGCCCAAAGTGCTGGG + Intronic
933755714 2:85636741-85636763 GGTGATCTGCCCAAAGTGCTAGG + Intronic
934654792 2:96111801-96111823 TGTGGTCAGCAGAAAGAGCCTGG + Intergenic
934869157 2:97844760-97844782 CTTAATCTGCAGAAAGTAACAGG - Intronic
937239338 2:120450277-120450299 GGTGATCTGGAGAAAGCCCCTGG + Intergenic
938832841 2:135070740-135070762 CGTGATCCGCCCAAAGTGCTAGG + Intronic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
942108934 2:172660790-172660812 AGAGAACTGAAGAAAGTGCCTGG - Intergenic
943802957 2:192085405-192085427 TTTGATGTGCAGAAAATGCCAGG - Intronic
945256773 2:207809777-207809799 CGTGATCCGCCCAAAGTGCTGGG - Intergenic
1169026468 20:2375829-2375851 AGTGATCTGCCCAAAGTGCTGGG - Intergenic
1170321267 20:15100724-15100746 TCTGATCTGCAGAAGGTTCCAGG - Intronic
1171385701 20:24768158-24768180 GGGGATCTGCACAAAGTGGCAGG - Intergenic
1173595984 20:44258597-44258619 CGAGATCCGCAGTGAGTGCCAGG + Exonic
1174374770 20:50118859-50118881 CGTGATCCGCCCAAAGTGCTGGG + Intronic
1182174988 22:28275929-28275951 ACTGATCTACAGAAAGTGACAGG + Intronic
1183114709 22:35681900-35681922 CCTTATCTGCATAAAGTGTCTGG + Intergenic
1184195507 22:42924992-42925014 CGTGATCGGCCCAAAGTGCTGGG + Intronic
1184249119 22:43250272-43250294 CTTGATCAGCAGACACTGCCTGG - Intronic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949496403 3:4636095-4636117 CGTGATCCGCCCAAAGTGCTGGG + Intronic
949918737 3:8985351-8985373 CGTGAGCTGCAGCCAGCGCCCGG + Exonic
953321517 3:41976625-41976647 GGTGATCTGCCCAAAGTGCTGGG - Intergenic
959820180 3:110724788-110724810 CCTGATCTGCAGTATGTGGCAGG + Intergenic
962410009 3:135132823-135132845 CATCATCTGCAAAAAGTGCCGGG + Exonic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964313498 3:155419082-155419104 CGTGATCTGCCCAAAGTGCTGGG - Intronic
965373185 3:167890156-167890178 CCTGATCTGTACATAGTGCCAGG + Intergenic
970941614 4:21640944-21640966 AGTTATCTGCAGAGAGTGGCAGG - Intronic
973267867 4:48229536-48229558 AGTGATCTGCCCAAAGTGCTGGG - Intronic
975969913 4:80020909-80020931 CGTGATCTACCCAAAGTGCTGGG - Intronic
982051136 4:151503501-151503523 CTTGATCTGTAGACAGTGTCTGG + Intronic
986687092 5:10284135-10284157 CGTGAGCTGCAGAGCGTGGCCGG - Intronic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
990723713 5:58729112-58729134 CGTGATCTGCAGAAAGTGCCAGG - Intronic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
993355628 5:86903854-86903876 GGTGATCTGCCCAAAGTGCTGGG - Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996397496 5:123027629-123027651 AGTAATCTTCACAAAGTGCCTGG + Intronic
998768160 5:145511753-145511775 GGTGGTCTTCAGAAAGTTCCTGG - Intronic
1001058551 5:168468990-168469012 CGTCATCTGCAGAGAGAGCTGGG - Exonic
1002120260 5:176998224-176998246 GATGATCTGCCGAAAGTGCTGGG - Intronic
1002332182 5:178450850-178450872 CATGAACTGCAGACAGAGCCAGG + Intronic
1003697110 6:8419639-8419661 CGGCATCTGCACATAGTGCCAGG + Exonic
1012234160 6:96792914-96792936 CGTGATCTGAGGAAAGTGGCTGG + Intergenic
1013212432 6:107999107-107999129 AGGGGTCAGCAGAAAGTGCCTGG - Intergenic
1013562401 6:111318805-111318827 GGTGATCTGCCCAAAGTGCTGGG + Intronic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1020253245 7:6485797-6485819 CTTGACCTGCCAAAAGTGCCGGG - Intergenic
1021352926 7:19617462-19617484 AGTGTTTTGCAGAAAGTGCAAGG + Intergenic
1023905267 7:44517240-44517262 GCTGACCTGCGGAAAGTGCCTGG - Exonic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1034678689 7:152911408-152911430 CCTGAACTTCAGAAAGAGCCAGG + Intergenic
1039697988 8:39932458-39932480 TGCGATGTGCAGAAAATGCCTGG - Intergenic
1044618346 8:94165118-94165140 TATGTTCTGCAGAATGTGCCTGG + Intronic
1049050665 8:140192448-140192470 GGTGATCTGCAGAAACCTCCTGG + Intronic
1052731804 9:32294808-32294830 GGGCATTTGCAGAAAGTGCCAGG - Intergenic
1053216635 9:36276611-36276633 CTTTATCTGATGAAAGTGCCAGG + Intronic
1058423539 9:104856380-104856402 CGAGATATGCAGAAAGCACCTGG + Intronic
1059426644 9:114225301-114225323 CATGAAATGCAGAAAGTCCCAGG - Intronic
1187445099 X:19354179-19354201 CGTGATCTGCCCAAAGTGCTGGG + Intronic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194833955 X:98658772-98658794 AGTTATCTGCAGAAGGTCCCAGG - Intergenic
1195504081 X:105636862-105636884 AGGGATCTGCAAAAAGGGCCAGG + Intronic
1196702553 X:118687415-118687437 CGTGATCTGCCAAAAGTGCTGGG + Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic