ID: 990724021

View in Genome Browser
Species Human (GRCh38)
Location 5:58733456-58733478
Sequence CTAATTTGCCAGATATCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990724017_990724021 18 Left 990724017 5:58733415-58733437 CCATGTGGTAAAAATGTGTGTCA 0: 1
1: 0
2: 0
3: 9
4: 225
Right 990724021 5:58733456-58733478 CTAATTTGCCAGATATCTATTGG 0: 1
1: 0
2: 0
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990724021 Original CRISPR CTAATTTGCCAGATATCTAT TGG Intronic
903728853 1:25474452-25474474 CTAATCTGCCATATATTAATGGG + Intronic
905696681 1:39979782-39979804 CTATTTTGCCAGGCATATATGGG - Intergenic
909040086 1:70639116-70639138 CTAAAGAGACAGATATCTATGGG + Intergenic
909134729 1:71783785-71783807 CTATTTTGCCAGATTTTTATAGG - Intronic
909381321 1:75002086-75002108 TTAATTGGCCATAGATCTATGGG + Intergenic
909579718 1:77220776-77220798 TTAATTCAACAGATATCTATTGG + Intergenic
912892053 1:113543975-113543997 CTAAATTGTCAGCTATCTAAAGG - Intronic
913473052 1:119209379-119209401 CTAATTTATCAGATAACTATTGG - Intergenic
914452408 1:147804157-147804179 CCAATTTCCCAGTTATCTACAGG - Intergenic
916673781 1:167048577-167048599 TTAATTTACCAGAGATCAATAGG + Intergenic
918380760 1:183952913-183952935 CTAATTTTCCAGATATGGAAAGG + Intronic
920112933 1:203599789-203599811 CGAATTTCCCATATATCTCTAGG + Intergenic
921613604 1:217240975-217240997 CTAATCTGTCAGATATTTATGGG - Intergenic
921857784 1:220006488-220006510 CTAACATGCCAGACATATATTGG + Intronic
924790102 1:247238252-247238274 TTTGTTTGACAGATATCTATAGG - Intergenic
1063222828 10:3986758-3986780 TTAATTTGCCAAAGATTTATTGG + Intergenic
1065119497 10:22514793-22514815 CTATTTTGCCTGAGATCTAAAGG - Intergenic
1065380545 10:25085820-25085842 CTGAGTTTCCAGATATCTAGAGG + Intergenic
1066481975 10:35805333-35805355 ATTATTTGCCAGAAATCAATGGG - Intergenic
1067011992 10:42722872-42722894 GGAATTTTCCAGATATCTATAGG - Intergenic
1068013468 10:51483517-51483539 CTAATTTGTCAGGTCTTTATAGG + Intronic
1068871799 10:61953356-61953378 TTAATTAGCCAGGTAACTATAGG - Intronic
1070084200 10:73219601-73219623 CTAATTGGCCACATATGTGTGGG - Intronic
1070970975 10:80566947-80566969 GTAATTCTCCAGATATATATAGG - Intronic
1071709214 10:88032567-88032589 ATAATTTGCCATTTATCCATAGG + Intergenic
1074339817 10:112617159-112617181 CTAATTTGCCATCTGTTTATAGG - Intronic
1075846180 10:125546499-125546521 CTCATTTGCCAGACATCTGAGGG - Intergenic
1079569560 11:21925463-21925485 CAATTTTGGCAGATATCTTTTGG + Intergenic
1079793618 11:24770781-24770803 CGATTTTGTAAGATATCTATAGG - Intronic
1081068540 11:38578744-38578766 CTCATTTGCTAGATATTCATTGG - Intergenic
1081225111 11:40512160-40512182 CTTATTTTTCAGTTATCTATCGG + Intronic
1082678147 11:56134827-56134849 TTAATTTGCCAGAAATGTTTGGG - Intergenic
1083013210 11:59424066-59424088 CTTAACTGCCAGATATGTATGGG - Intergenic
1084867534 11:72071836-72071858 TTATTTTGCAAAATATCTATAGG + Intronic
1086266379 11:85003687-85003709 CTAATTATCCATCTATCTATAGG - Intronic
1086885674 11:92202510-92202532 CTTATTTGCCAGAAGTCTAATGG - Intergenic
1087519348 11:99210934-99210956 TTAATTTGACAAATATTTATTGG - Intronic
1087677280 11:101177634-101177656 TTTATTTGCCAAATATTTATTGG + Intergenic
1090466381 11:126938131-126938153 CTACTTTGCCAGGTAGGTATAGG - Intronic
1092992494 12:13916546-13916568 CTCATTTGATAAATATCTATCGG + Intronic
1093724912 12:22493556-22493578 TTACTTTAACAGATATCTATAGG + Intronic
1094249948 12:28348228-28348250 CTCATTTGCCAGCTATGTTTAGG + Intronic
1097237943 12:57552432-57552454 CTGTTTTGCCTGATATCTGTAGG + Intronic
1098756716 12:74373009-74373031 CTACTTTTTCAGATATCCATAGG - Intergenic
1100105419 12:91165318-91165340 CTAACTAGCCATATATCTATTGG - Intronic
1102288649 12:111680768-111680790 CTCATTTGCCAGATCTCTACTGG - Intronic
1109350407 13:61172936-61172958 ATAATTTGTCAGATATTTCTGGG - Intergenic
1109735187 13:66474454-66474476 TTAATTTGGCAGATATTTATTGG - Intronic
1109743658 13:66590147-66590169 CAAATTTACATGATATCTATGGG - Intronic
1111593496 13:90380103-90380125 TTAACTAGCCAGATATCCATTGG + Intergenic
1111816106 13:93154739-93154761 TTACTTTGACAAATATCTATTGG - Intergenic
1116254034 14:42526774-42526796 TTTTTTTGCCAGAAATCTATTGG - Intergenic
1117088384 14:52224504-52224526 CTAATTTTCCAGTTATTTGTGGG - Intergenic
1118622833 14:67629856-67629878 AAAATTTGCCAAGTATCTATCGG - Intronic
1120981745 14:90296018-90296040 ATAAGTTTCCAGATATCTAATGG - Intronic
1139755231 16:69137419-69137441 CTAATTTGCACGATATCTGAAGG + Intronic
1140017450 16:71201375-71201397 ATAATTTCGCAGATATTTATTGG + Intronic
1140884888 16:79234304-79234326 TTAATTTTCCAGACATCTCTGGG - Intergenic
1141010144 16:80389382-80389404 CAGATTTTCCAGACATCTATGGG + Intergenic
1148259416 17:46166752-46166774 CTAAATTTCCAGATGTCAATAGG + Intronic
1149046663 17:52254541-52254563 CTAATTTTTCATATATTTATGGG + Intergenic
1149279388 17:55085438-55085460 CTAATATGCCATATATTAATGGG - Intronic
1150705186 17:67480367-67480389 ATAATTTGACAGATATGTAAAGG + Intronic
1156480092 18:37430841-37430863 CTAATGTGCCAGATCCCCATGGG - Intronic
1157564020 18:48667777-48667799 CTAGTGAGCCAGATATCCATGGG - Intronic
1160368871 18:78354187-78354209 CAAATTGGCCATATATCTATTGG - Intergenic
1163841748 19:19615566-19615588 CAAATTTGGCCGATATTTATCGG - Intronic
1164472932 19:28550819-28550841 CTAGTTTTCCAGATTTCTCTGGG - Intergenic
1166636151 19:44453208-44453230 CAGCATTGCCAGATATCTATCGG - Intergenic
927229662 2:20809807-20809829 CTGATTTGCTGGATATGTATAGG + Intronic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
928775811 2:34762010-34762032 TGAATTAGCCAGATATCTAAAGG + Intergenic
931896910 2:66742601-66742623 CTAATTCACCAGATATCTCTTGG - Intergenic
932574906 2:72957302-72957324 ACCATTTGCCAGATATCTATTGG - Intronic
936832809 2:116669613-116669635 CTAATTTCCTAGATATATGTTGG + Intergenic
937639451 2:124194999-124195021 CTATTTGGCCAGTTTTCTATTGG - Intronic
944407380 2:199400305-199400327 TTCATTTGCCAAATATTTATTGG - Intronic
947058356 2:226133475-226133497 CAAATATGCCAGATATCAAGGGG + Intergenic
947089498 2:226494260-226494282 CTCATTTGCTAGATTCCTATTGG - Intergenic
1169640109 20:7742007-7742029 CTAATTCCCCAGATGTCTAAAGG - Intergenic
1170321894 20:15109373-15109395 TTAATTACCTAGATATCTATTGG + Intronic
1176790749 21:13316522-13316544 CTAATGTGGCAGAGATCTAGAGG - Intergenic
1177400488 21:20597126-20597148 GAAATATGCCAGATCTCTATTGG + Intergenic
1177874453 21:26614067-26614089 AGACTTTGACAGATATCTATAGG + Intergenic
1179949162 21:44699943-44699965 CTGAGCTGCCAGATATCTTTGGG + Intronic
1185022621 22:48388566-48388588 TGAATTTTCCAGATATCTTTTGG - Intergenic
951589518 3:24248360-24248382 CTAAATTTCCAAATATCTCTTGG - Intronic
956179509 3:66504036-66504058 CTAAATAGCCTGAAATCTATTGG + Intergenic
958471574 3:94527487-94527509 TTAATTTTCCAGATACATATGGG + Intergenic
965381712 3:167997422-167997444 CTTATTAGCCAGATAACCATGGG - Intergenic
966009601 3:175058338-175058360 TTAATTTGTCAAATATTTATTGG + Intronic
966657949 3:182380949-182380971 GTAATATGCCACATATCTACTGG - Intergenic
967359295 3:188611237-188611259 CTAATTTGGAATCTATCTATCGG - Intronic
971975834 4:33685217-33685239 TTAATTTATCAGATATGTATAGG - Intergenic
972699316 4:41478834-41478856 CTCATTTGCCAGTTCACTATTGG - Intronic
975663927 4:76715273-76715295 CTCATTTCCCAGGTATATATAGG + Intronic
976093377 4:81480313-81480335 CTATTTTGGCAGATCTCTCTGGG + Intronic
978572596 4:110155101-110155123 CAAATTTGCTAAATATTTATTGG - Intronic
979408829 4:120348791-120348813 CTAATTAACCAAATATCTAGAGG + Intergenic
982439765 4:155422137-155422159 CTAAGTTGCTTGATATATATTGG - Intergenic
983905780 4:173181031-173181053 CTTATTTGCCAAAAATCTAATGG - Intronic
984810419 4:183791545-183791567 CTAATGTTTCATATATCTATGGG + Intergenic
990724021 5:58733456-58733478 CTAATTTGCCAGATATCTATTGG + Intronic
993667593 5:90720050-90720072 CTAATATGGCAGATATTTGTAGG - Exonic
993773893 5:91966691-91966713 CGATTTTCCCAGATATCTCTTGG + Intergenic
995004677 5:107177814-107177836 TTGATTTGACAGATATTTATTGG + Intergenic
1001149705 5:169216527-169216549 GTAATTGGCCAAATCTCTATAGG - Intronic
1003652015 6:7969472-7969494 CTGCTTTGCAAGATATCTAGTGG + Intronic
1003692775 6:8371015-8371037 TTTATTTGCCAGATATTTGTAGG + Intergenic
1005117522 6:22355241-22355263 ATAATTTGCCAGGAATATATTGG + Intergenic
1011154908 6:84320135-84320157 TTAATTTACCAGGTATTTATTGG + Intergenic
1012115692 6:95294910-95294932 CTTAACTGTCAGATATCTATTGG + Intergenic
1013974888 6:116065559-116065581 CTTATTTGCCAGATAAATATGGG + Intergenic
1015840791 6:137474807-137474829 CAAACTTGCTAGATATTTATAGG + Intergenic
1016214993 6:141588549-141588571 ATTATTTGACAGTTATCTATGGG - Intergenic
1018676879 6:166229808-166229830 CAAAGATGTCAGATATCTATTGG + Intergenic
1020599558 7:10254815-10254837 CTAATTTGGGAAATTTCTATAGG - Intergenic
1021457247 7:20843234-20843256 CTACATTGTCAGATATGTATTGG - Intergenic
1022161534 7:27715620-27715642 GTAATTTGTCAGATTTCTCTTGG - Intergenic
1023264400 7:38391298-38391320 TTAATTTACCAAATATTTATGGG + Intronic
1024139037 7:46442928-46442950 CTAATTACCCAGATATTTTTAGG + Intergenic
1028487757 7:91378588-91378610 TTAATTTGACAAATATTTATTGG + Intergenic
1028727713 7:94107632-94107654 CTAATTTCCCAAATATGTATGGG - Intergenic
1030207878 7:106968218-106968240 CTCATTTCCCACATATCTTTTGG - Intergenic
1030977688 7:116147118-116147140 CTAATTAGACAGATATATGTTGG - Intronic
1031214548 7:118873432-118873454 CTTATATGCCACATATCCATGGG + Intergenic
1034315651 7:150129234-150129256 ATCATTTGGCAGATATCTTTTGG - Intergenic
1034580945 7:152042074-152042096 ACAATTTGCCAGATATATGTAGG - Intronic
1034664742 7:152807221-152807243 AAAATTTGGAAGATATCTATGGG + Intronic
1034791238 7:153971571-153971593 ATCATTTGGCAGATATCTTTTGG + Intronic
1040082164 8:43297344-43297366 CAAATCTTCCAGATATGTATGGG + Intergenic
1043538937 8:81237669-81237691 CTTATTTTACAGATATTTATGGG + Intergenic
1043760113 8:84057724-84057746 CTGATTTGCCATATATTTTTAGG - Intergenic
1044725021 8:95187875-95187897 CTAATTTGCAGGAAACCTATGGG + Intergenic
1046287204 8:112109725-112109747 GTAAATTGCCACATATATATGGG - Intergenic
1050496148 9:6244689-6244711 AAAATTTGACAGATATCTCTGGG + Intronic
1050987676 9:12103581-12103603 ATAATTTGCAAGATATTTAAAGG - Intergenic
1055138876 9:72852468-72852490 CCAATTTGCCAAATAATTATTGG + Intergenic
1055329099 9:75163416-75163438 CTAATTTGCCATACATATATGGG + Intergenic
1059791283 9:117643962-117643984 GTTATTTTCCAGATATTTATTGG + Intergenic
1059886258 9:118748204-118748226 CTAAGTTGCCAGTTATAAATGGG - Intergenic
1188104237 X:26129744-26129766 TTAATTTGACAGCTATTTATTGG - Intergenic
1188149876 X:26659600-26659622 ATAATTTACCAGATTTTTATTGG - Intergenic
1189728296 X:43990902-43990924 CTATCTTGCCAGATTTTTATGGG + Intergenic
1193198517 X:78660975-78660997 GTAATTTGCCAAATTTGTATAGG - Intergenic
1194124416 X:89996335-89996357 ATAGTTTGCCAGAAATCTAATGG - Intergenic
1196630444 X:117932974-117932996 GTAATTTTCCATATATCTGTTGG + Intronic
1197568895 X:128124276-128124298 CTTAATTTCCAAATATCTATGGG - Intergenic
1199116071 X:143994381-143994403 TTCATTTGCCAAATATTTATAGG + Intergenic
1200477308 Y:3653950-3653972 ATAGTTTGCCAGAAATCTAATGG - Intergenic
1201958128 Y:19648424-19648446 CTAATTTGGGAGGTCTCTATAGG - Intergenic