ID: 990728193

View in Genome Browser
Species Human (GRCh38)
Location 5:58779739-58779761
Sequence GGTAGATGGTCTTTGTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990728186_990728193 30 Left 990728186 5:58779686-58779708 CCTTTACGATATAAGATTTTAAA 0: 1
1: 0
2: 0
3: 27
4: 333
Right 990728193 5:58779739-58779761 GGTAGATGGTCTTTGTGTACTGG 0: 1
1: 0
2: 0
3: 10
4: 95
990728191_990728193 -8 Left 990728191 5:58779724-58779746 CCAGAACTGAACACTGGTAGATG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 990728193 5:58779739-58779761 GGTAGATGGTCTTTGTGTACTGG 0: 1
1: 0
2: 0
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990728193 Original CRISPR GGTAGATGGTCTTTGTGTAC TGG Intronic
902807689 1:18871400-18871422 GGTGGATGGTCTTTCTGGAGGGG - Intronic
903823977 1:26128964-26128986 GGAAGAAGGTCTTTCTGTTCTGG - Intergenic
916318145 1:163473207-163473229 GGAAAATGGTCTCTGTGTGCTGG - Intergenic
917804393 1:178600033-178600055 GTTAGCTGGTCATAGTGTACTGG - Intergenic
1068937672 10:62651870-62651892 GGTATTTGGTCTTTGTCTAGGGG + Intronic
1069167316 10:65178149-65178171 CTTAGATGTTGTTTGTGTACAGG + Intergenic
1070892414 10:79951709-79951731 GGTACTTGGTCTTTGTTTTCTGG + Intronic
1075565195 10:123498295-123498317 GGTAGATGCTCCATGAGTACTGG + Intergenic
1082128166 11:48456296-48456318 GATAGATGGCCTTAGTGTAATGG + Intergenic
1083244154 11:61412937-61412959 GGTTGATGGTCCTTGTATAGAGG + Intronic
1084881555 11:72175016-72175038 GGTGGATGGGCTGTGTGTACAGG - Intergenic
1094110027 12:26852819-26852841 GGCAGATGGTCTTTGTTAAGTGG - Intergenic
1094204093 12:27822319-27822341 TGTAAATGGTGTTTGTGTATTGG + Intergenic
1100743668 12:97622525-97622547 CCTAGATTGTCTTTGGGTACTGG + Intergenic
1102584703 12:113914883-113914905 GGAAGATGGCCTTTGGGTCCTGG - Intronic
1106202393 13:27550775-27550797 GGTACATGACCTTTTTGTACAGG - Intronic
1107994987 13:45850861-45850883 GTTAGATGCGCTCTGTGTACTGG - Intronic
1108791578 13:53974422-53974444 TATAAATAGTCTTTGTGTACTGG - Intergenic
1113394018 13:109927471-109927493 GATAAATGTTCTCTGTGTACTGG - Intergenic
1117587017 14:57218969-57218991 GGTACATGGACTTTGTCTATCGG + Intronic
1129190908 15:73937115-73937137 GGCAGATGGTCTTTGTCCTCCGG + Intronic
1132999958 16:2844880-2844902 GGTAGGTGTTCATTTTGTACTGG + Intergenic
1133803952 16:9108737-9108759 AGTACATAGTCTTTGTGTATAGG + Intronic
1134365770 16:13577391-13577413 GGTAAATGTTCTGTGTGTACTGG - Intergenic
1135480295 16:22815686-22815708 GGTAGGTGGTCTTTGAGTAGTGG + Intronic
1138427819 16:56947980-56948002 GGTAGATGGGCTGTTTCTACTGG - Intergenic
1140143684 16:72285091-72285113 GGTACATGTTCATTGTGAACTGG + Intergenic
1142681625 17:1553014-1553036 GGTAGATCTTGTGTGTGTACTGG + Exonic
1143202246 17:5121237-5121259 TGCAGAGGGTCTTTGTGTGCAGG + Intronic
1144627177 17:16849920-16849942 TGCAGAGGGTCTTTGTGTGCAGG - Intergenic
1151503123 17:74505258-74505280 GGTAGATGATCTTTGCTGACAGG + Intergenic
1152026356 17:77811959-77811981 GGCAGATGGTCTTCGTGCATGGG - Intergenic
1156162734 18:34379832-34379854 GGTAGAGGGTCTTTCTGCCCTGG + Intergenic
1159154677 18:64568512-64568534 GGTAGTTGGTCATCATGTACTGG + Intergenic
1162281745 19:9703575-9703597 GGGAGCTGGTCTGTGTGTCCTGG - Intergenic
1164483484 19:28633852-28633874 GGTACTTGGTCTTTGTTTACTGG - Intergenic
1167313070 19:48748467-48748489 GGAAGTTGGTCTTTGTCTGCAGG - Exonic
925857684 2:8146187-8146209 GGGAGAAGGCCTTTGTGTACTGG - Intergenic
933937412 2:87217677-87217699 GGTAGAAGGGCTTTGAGGACTGG + Intergenic
936355728 2:111748125-111748147 GGTAGAAGGGCTTTGAGGACTGG - Intergenic
937459840 2:122076205-122076227 CTTAGATGGTCTTGGTGAACAGG - Intergenic
938977081 2:136489731-136489753 GGTAGATGGTTTTTATCTGCTGG + Intergenic
943560124 2:189451514-189451536 GCTATAAGGACTTTGTGTACAGG - Intronic
944975880 2:205050249-205050271 GGTAGATGCTCTTTGGGAAACGG - Intronic
948184480 2:236009388-236009410 GGGGGATGATCTTTGTGTAAAGG + Intronic
1173674775 20:44824172-44824194 GGCAGATGGTCTTAGACTACAGG - Intergenic
1174239125 20:49118617-49118639 GTTAGATGCTCTTTGTGGGCAGG - Intronic
1177281126 21:18984441-18984463 GGAAAATGGTCCTTGTGTCCTGG - Intergenic
1179801453 21:43813309-43813331 GGTGGATGGTCTGGGTGTCCAGG - Intergenic
1181955120 22:26582765-26582787 GGCAGATGGGCTTTGAGTCCTGG + Intronic
1183506621 22:38212787-38212809 GCTGGATGGGCTTTGTGTAAAGG + Intronic
1184632776 22:45797273-45797295 GGTGAATGTTCTATGTGTACTGG - Intronic
951155098 3:19342714-19342736 CGTAGGTGGTATGTGTGTACAGG + Exonic
954064985 3:48098660-48098682 GCTAGAGGGACTTTGTGTTCAGG - Intergenic
955445904 3:59009031-59009053 TATAGAAAGTCTTTGTGTACTGG - Intronic
957422088 3:79983717-79983739 GGTAGACTGTCTTTGTGTTCAGG - Intergenic
959079998 3:101790160-101790182 GGTATATATTCTATGTGTACTGG + Intronic
962421992 3:135237142-135237164 GGTAGAAGCTCTTGGTGTAGAGG - Intronic
963056417 3:141189747-141189769 GGTTTATGTTCTTTGTTTACAGG + Intergenic
971557626 4:28034917-28034939 GGTACATGATATTTTTGTACAGG - Intergenic
971721116 4:30246470-30246492 TATAGAGAGTCTTTGTGTACTGG + Intergenic
975502126 4:75099096-75099118 GGTAGATGTTCTTTGGTGACTGG + Intergenic
978130890 4:105196027-105196049 GGTAGAAGTTCTTGGTCTACAGG - Intronic
978320024 4:107482750-107482772 GGTCTTTGGTCTTTGTTTACTGG - Intergenic
978326795 4:107566807-107566829 GTTTGATGGTCTTTCTGTAGTGG - Intergenic
978375793 4:108074169-108074191 GAAAGATGGTCTTTCTTTACAGG + Intronic
979638890 4:122989349-122989371 GGTGGATGGTCTTGGTGTCTAGG + Intronic
986914210 5:12596771-12596793 TGTAGATGTTCGTTGTTTACTGG + Intergenic
988422277 5:31020921-31020943 GGTAAATGGTCTTTCTCTATTGG - Intergenic
989177482 5:38542744-38542766 GGTAGATGATCTGTCTGTGCGGG - Intronic
990728193 5:58779739-58779761 GGTAGATGGTCTTTGTGTACTGG + Intronic
991405890 5:66300863-66300885 GGGACATGGTATTTGTGTAAGGG + Intergenic
991414671 5:66379830-66379852 TGTAGATTGGCTTAGTGTACTGG - Intergenic
994213485 5:97110949-97110971 GGTAGATTGGCTTTGTGTTATGG + Intronic
994646544 5:102476895-102476917 GGTAGATCATCTATTTGTACAGG - Intronic
1002831904 6:830059-830081 GGTAGATGCCCATTGTGAACTGG + Intergenic
1004671213 6:17799274-17799296 GGGAGAAGGTCACTGTGTACTGG + Exonic
1014532124 6:122570605-122570627 TATAGAGGGTCTTTGTGCACTGG - Intronic
1017173406 6:151478935-151478957 GGGAAATGGTTTTTGTGAACAGG + Intergenic
1019379521 7:713512-713534 GGGAGATGGTGTCTGTGTACAGG - Intronic
1020899474 7:13987638-13987660 AGTAGATGGTTTTAGTGTAAAGG + Intronic
1024929064 7:54650714-54650736 GCCAGATGGCCTTTGTGTAGGGG + Intergenic
1030194101 7:106836173-106836195 GGTAGATGATCTTTGCTTGCAGG + Intergenic
1033534053 7:142295951-142295973 GGAAGATCTTCTTAGTGTACAGG - Intergenic
1040092215 8:43409792-43409814 AGTAGATAGCCTTTGTGTAGTGG + Intergenic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1041629563 8:60071053-60071075 GGTAGATAGTTTTTATGTACTGG - Intergenic
1042084292 8:65090299-65090321 TATAGAGAGTCTTTGTGTACTGG - Intergenic
1044942110 8:97353953-97353975 GATGGATGCTCTTTGAGTACTGG - Intergenic
1045878533 8:107011210-107011232 GGTAGATGGTGTTTGGGTCATGG + Intergenic
1046581746 8:116101816-116101838 GAGAGATTGTCTTTGTTTACTGG - Intergenic
1046710140 8:117501968-117501990 GGTGGAAGGTCTGTGTGTTCTGG + Intergenic
1051229110 9:14935458-14935480 GGTAGCTGGCCTTTTTGTAAAGG - Intergenic
1054847324 9:69810656-69810678 GGGAGAGGTTCTTTATGTACCGG - Intergenic
1055933586 9:81584503-81584525 GGTAAATGGTTTGTGAGTACTGG - Exonic
1057762622 9:97889007-97889029 GGTAGATGGTCTGTGAGTATTGG - Intergenic
1058355021 9:104074230-104074252 GGTAGCTGGGCTTTGTGCATGGG - Intergenic
1060636481 9:125203495-125203517 TGTAAATAGTCTCTGTGTACTGG + Intronic
1061674940 9:132210371-132210393 GGAACATGGTCTGTGTGTTCAGG - Intronic
1061968806 9:134032138-134032160 GCCATATGGTCTTTGAGTACGGG - Exonic
1185837735 X:3360854-3360876 GGTTTCTTGTCTTTGTGTACCGG + Intergenic
1187014787 X:15316100-15316122 GGTAAATGGTCTTTTTTAACTGG - Intergenic
1188934300 X:36154328-36154350 GCTAAATGGTGTTTGTGTCCTGG - Intergenic
1191770382 X:64750168-64750190 TATAGAGGGTCTTTGTGCACTGG + Intergenic
1192603278 X:72487112-72487134 GATTGATGGCTTTTGTGTACAGG - Intronic
1193300897 X:79887224-79887246 TGTAGATAGGCTTAGTGTACTGG - Intergenic