ID: 990728537

View in Genome Browser
Species Human (GRCh38)
Location 5:58783773-58783795
Sequence TTGTTTGTGGATAAAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990728537_990728542 9 Left 990728537 5:58783773-58783795 CCTTCCCCTTTATCCACAAACAA 0: 1
1: 0
2: 1
3: 20
4: 271
Right 990728542 5:58783805-58783827 TAAGATTTCCTAAGCAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990728537 Original CRISPR TTGTTTGTGGATAAAGGGGA AGG (reversed) Intronic
901200485 1:7464406-7464428 TGATTAGTGGATAAAGGGAATGG + Intronic
904812667 1:33173535-33173557 TTCGTTGTGGCTAGAGGGGAGGG - Intronic
905616673 1:39405777-39405799 ATGTTTGTGGTTACAGGGGTGGG + Intronic
905806422 1:40880814-40880836 TTGTTAGTGAATAGAGGAGAGGG + Intergenic
907091881 1:51732734-51732756 TTGTTTTTGGATAAAAAGGATGG - Intronic
907104589 1:51870979-51871001 TTGTTTGGTTTTAAAGGGGAAGG - Intronic
911510061 1:98800516-98800538 TTGTATGTGGTTAAAGGCAAGGG + Intergenic
914434927 1:147651504-147651526 GTGTGTGTTGATAAAGGAGAGGG + Intronic
914450028 1:147783079-147783101 TAATTAGTGAATAAAGGGGAGGG + Intergenic
914726326 1:150330663-150330685 TTTTTTATGGAGAATGGGGATGG + Intronic
915072426 1:153281617-153281639 TTGGATGTGGATGAAGAGGAAGG + Intergenic
915687078 1:157644456-157644478 TTGTGTGTGGAGAGAGGTGATGG + Intergenic
916179106 1:162069383-162069405 TTGTTTTTGGAGAGGGGGGAGGG - Intergenic
916952592 1:169795536-169795558 TTGCTAGTGGATAATGGGGGAGG + Exonic
917233153 1:172859642-172859664 TTCTTTGTCTATAAAGGGGCAGG - Intergenic
917787536 1:178474895-178474917 TTTTTTCTAGAAAAAGGGGATGG + Intronic
918309583 1:183276127-183276149 GTGGTTGTGGAAAAAGGGGAGGG - Intronic
918856693 1:189764595-189764617 TTTATTGTGGAAAAAGGGGAAGG + Intergenic
919944166 1:202307678-202307700 TTGTTGGTGGATAGAGAGGATGG - Intronic
920044885 1:203126813-203126835 TTGTTTGTGGGTATTGGGCAAGG - Intronic
920072296 1:203311172-203311194 ATGTTTGTTGATAAAGGTCATGG - Intergenic
920913381 1:210237807-210237829 ATGTTTCAGGGTAAAGGGGAGGG + Intronic
922476259 1:225908741-225908763 TTGTTTGTGGGGACTGGGGAAGG + Intronic
923577770 1:235175788-235175810 TTGTTTGTGGCCAAAGGAGCAGG - Intronic
923729336 1:236535638-236535660 TTGTGTGTAGAGAATGGGGAAGG - Intronic
1063374985 10:5548884-5548906 ATGTGTGTGGATAAGGGAGAGGG - Intergenic
1063517792 10:6713490-6713512 GTTTTTATGGATAAAGGGGATGG - Intergenic
1064417198 10:15160199-15160221 GCGTTTGTGGCTAATGGGGAGGG - Intronic
1064700955 10:18021142-18021164 TTGTATATGGTGAAAGGGGAGGG + Intronic
1065713864 10:28545150-28545172 TTGATTCTGGGTAATGGGGAGGG - Intronic
1065979912 10:30883562-30883584 ATGTTTTTGTATAAAGGGGCTGG + Intronic
1066105398 10:32151955-32151977 TTGTGGGTGGAGCAAGGGGAAGG + Intergenic
1068800022 10:61130193-61130215 TTCTTTGTGTATAAAATGGAAGG - Intergenic
1069146611 10:64900098-64900120 TTGTTTCTGAATAAAGAGGCAGG - Intergenic
1072483423 10:95831032-95831054 TTGTCTGTGGGGTAAGGGGAGGG + Intronic
1073420366 10:103419458-103419480 TTCTCTGTGGAGAAAGGAGATGG + Intronic
1075672505 10:124272159-124272181 TTTCATCTGGATAAAGGGGAGGG + Intergenic
1076007523 10:126959719-126959741 TTGTTTCTGGACATAGGGGTTGG + Intronic
1076798193 10:132808901-132808923 TCGTCTGTGGAGAAAGGGGCGGG + Exonic
1078166189 11:8887846-8887868 GTGGTTGTGGATCATGGGGAGGG - Intronic
1079014562 11:16857525-16857547 TTCTGTCTGGAGAAAGGGGATGG - Intronic
1080823812 11:35831111-35831133 TTCTAAGCGGATAAAGGGGAAGG - Intergenic
1080907795 11:36564164-36564186 TTGTTTGAGGAATAAGGAGAAGG + Intronic
1081400871 11:42641339-42641361 ATGTTTGTAGATAGAGGGAAGGG - Intergenic
1082063179 11:47877780-47877802 ATATTTGTGGAGAAAGAGGAAGG - Intergenic
1085034110 11:73289838-73289860 TTCTTCGTCTATAAAGGGGAGGG + Intronic
1085590519 11:77755458-77755480 TTGTTTGTACATAAAGATGATGG + Intronic
1086862491 11:91941377-91941399 TTGCTTGTGAATGAAGGGGAAGG - Intergenic
1088061233 11:105653431-105653453 GTGACTCTGGATAAAGGGGATGG + Intronic
1088574375 11:111256139-111256161 TGGTGTGTGGATAAAGGGAGAGG - Intronic
1088853929 11:113729245-113729267 GTGTTTGTGGGTTCAGGGGAAGG + Intergenic
1089039605 11:115434337-115434359 TTGTCTGTAGCAAAAGGGGAGGG - Intronic
1091123180 11:133073882-133073904 TTGTTTGTGAATAAAGAAAAAGG + Intronic
1091898048 12:4120460-4120482 TGGTTTGAGGACACAGGGGAAGG - Intergenic
1092656058 12:10686599-10686621 TTATTTGTGGATGATGGGGCAGG + Intergenic
1092697465 12:11189622-11189644 GTCTTTGTGGAGAGAGGGGATGG - Intergenic
1095425897 12:42074499-42074521 TGGTTTGAAGAGAAAGGGGAAGG + Intergenic
1096116450 12:49058263-49058285 TTGTTTCGGGACAAACGGGAGGG + Intronic
1096387496 12:51204439-51204461 TGGTTTGGGGAGAGAGGGGAGGG + Intronic
1096449717 12:51728315-51728337 TTTATTGTAGATAAGGGGGATGG - Intronic
1097363426 12:58683643-58683665 CTATTTGTGAAAAAAGGGGAAGG - Intronic
1097880232 12:64680153-64680175 TTGTATGTGGAGGAAGGGGCAGG + Intronic
1097989952 12:65824328-65824350 TCGTGGGCGGATAAAGGGGAGGG - Exonic
1098918649 12:76282798-76282820 TTGTTTTTGTATCATGGGGAAGG + Intergenic
1099074498 12:78089162-78089184 TTTTTTTTGGGAAAAGGGGAAGG - Intronic
1100700607 12:97143866-97143888 GTGTTTTTTAATAAAGGGGAAGG + Intergenic
1100772366 12:97937547-97937569 CTGCTTGTGGAAGAAGGGGATGG - Intergenic
1101578287 12:106018364-106018386 TTGTTTGTCAATGGAGGGGAGGG - Intergenic
1102436107 12:112925286-112925308 TTGTATGAGGAAAAGGGGGAGGG - Intronic
1102815661 12:115863711-115863733 CTCTTTGGGGGTAAAGGGGATGG + Intergenic
1107480182 13:40779700-40779722 TTGTTTGTAGAGAAGGGGGGGGG - Intergenic
1110407097 13:75162853-75162875 TTACTTGTGGAAGAAGGGGAAGG + Intergenic
1111510725 13:89258622-89258644 ATGTTTGTTGATAAAGGTCAGGG + Intergenic
1111548060 13:89770020-89770042 GTGTTTGTGGATGATGGTGATGG - Intergenic
1112165696 13:96917739-96917761 TTTTCTGAGGATACAGGGGAAGG - Intergenic
1113535237 13:111061312-111061334 GTGTTTGTGGAGAAAGAGGGAGG + Intergenic
1114696691 14:24632757-24632779 AAGTTTGTGGAGAGAGGGGAAGG - Intronic
1116278555 14:42870183-42870205 TGGGGTGTGGATAAAGGGAAGGG + Intergenic
1116401280 14:44510740-44510762 TGGGGTGTGGAAAAAGGGGAGGG - Intergenic
1119579897 14:75768527-75768549 TTGTTTATAGACTAAGGGGAAGG + Intronic
1120173590 14:81270903-81270925 TTATTTGGGGAGAAAGTGGAAGG + Intronic
1121843963 14:97157004-97157026 TTGTGTGTGAATCATGGGGAAGG + Intergenic
1121851417 14:97224371-97224393 TTGTTTGGGGAAAGAAGGGAGGG + Intergenic
1125027923 15:35049350-35049372 TTTGTTGTGGATAGAGAGGAGGG + Intergenic
1125656711 15:41363930-41363952 TTGTTTGGGGATAGAGGGAGAGG + Intronic
1127151002 15:56075370-56075392 ATGTTTGTTGATAATGGGGGAGG + Intergenic
1129357146 15:74998781-74998803 TTGTTTGTATATAAAGGTTAGGG - Intronic
1129575664 15:76741805-76741827 TTGGTTTGGGATAAAGGAGATGG + Intronic
1129702349 15:77775146-77775168 TTCTTGGTGGAGAAAGGGGCGGG - Intronic
1130157915 15:81369258-81369280 CTGTCTGTGGATAAAGGAGTTGG - Intronic
1131000508 15:88936322-88936344 TTGTTTGAGGATAAAGAAGTTGG - Intergenic
1131538148 15:93254365-93254387 ATTTTTGTGGATGATGGGGAGGG + Intergenic
1131776703 15:95809592-95809614 TTGTTTGTGGTTAGAGAGTAGGG - Intergenic
1132242224 15:100266622-100266644 TTGCTTGTGGGTGATGGGGAGGG - Intronic
1134311952 16:13083088-13083110 GTGCTGGTGGATAGAGGGGAGGG + Intronic
1134315145 16:13112120-13112142 TTGTTTGTTTTTAAAGGAGATGG + Intronic
1134337420 16:13313578-13313600 GTGTGTGTGGAAATAGGGGAGGG + Intergenic
1134566723 16:15258008-15258030 TTGATTTTGGATAAATGAGAAGG - Intergenic
1134735770 16:16498691-16498713 TTGATTTTGGATAAATGAGAAGG + Intergenic
1134931755 16:18213531-18213553 TTGATTGTGGGTAAATGAGAAGG - Intergenic
1136033918 16:27524157-27524179 GTGTCTGTGGTGAAAGGGGAAGG + Intronic
1137651801 16:50126959-50126981 TAGTCTATGGATAAAGGAGAAGG - Intergenic
1137653657 16:50141652-50141674 TATTTTGTGCAAAAAGGGGAAGG + Intergenic
1138447043 16:57070942-57070964 GTGTTGGTGGTTAATGGGGAAGG + Intronic
1138447050 16:57070978-57071000 GTGTTGGTGGTTAATGGGGAAGG + Intronic
1138447074 16:57071088-57071110 GTGTTGGTGGTTAATGGGGAAGG + Intronic
1138447155 16:57071456-57071478 GTGTTGGTGGTTAATGGGGAAGG + Intronic
1138447195 16:57071601-57071623 GTGTTGGTGGTTAATGGGGAAGG + Intronic
1138933083 16:61685299-61685321 AAGTTTGGGGATTAAGGGGAAGG + Intronic
1139959425 16:70709273-70709295 TTGTTGGGGGACAAAGGGGTGGG - Intronic
1140991317 16:80214676-80214698 ATGTTTGTGGAAAATGGGCATGG - Intergenic
1141288955 16:82699678-82699700 ATGTTTGTGGATTAAGTGTAAGG - Intronic
1143023422 17:3928196-3928218 TTGTGGGTGGGTCAAGGGGAGGG - Intronic
1143906030 17:10209837-10209859 TTTTTTGTGGACAAAGGGGCTGG + Intergenic
1144121515 17:12158537-12158559 CTGGCTGTGGAGAAAGGGGAAGG - Intergenic
1144308571 17:13991755-13991777 TTTTTGGTGGGTCAAGGGGAGGG + Intergenic
1146531692 17:33612673-33612695 GTGTAAGTGGGTAAAGGGGATGG - Intronic
1146636811 17:34512550-34512572 TTGTTAGGGGATAAAGAAGAGGG - Intergenic
1146698096 17:34927194-34927216 CTGTTTGTGCATATAGGAGAAGG - Intergenic
1147470286 17:40652150-40652172 TTGCTTGTGGTTACAAGGGAAGG + Intergenic
1148326419 17:46785827-46785849 TTCTTTGGGGAGAAAAGGGAAGG + Intronic
1149040071 17:52177377-52177399 TTGTTGATGGCTATAGGGGATGG + Intergenic
1149957258 17:61065678-61065700 TTGTTTGTGGAGGAAGGGTGGGG + Intronic
1149957767 17:61072070-61072092 TTTTTGGTGAAAAAAGGGGATGG + Intronic
1150484759 17:65536241-65536263 TGGTCTGTGGCTAATGGGGAGGG - Intronic
1150992513 17:70276113-70276135 TTGTTGCTGGATAATGGGGAGGG + Intergenic
1152728095 17:81957540-81957562 TGGTTGTTGGATATAGGGGAAGG - Intronic
1153077784 18:1185160-1185182 ATGTGTTTGGATAAAGGAGAGGG + Intergenic
1154095726 18:11413482-11413504 TTATTTGTGGGGAAAGGGCATGG - Intergenic
1155808934 18:30207671-30207693 GTGATTGTGGATCATGGGGATGG - Intergenic
1156914765 18:42452739-42452761 TTGAATGTAGATAAAGTGGATGG + Intergenic
1160124240 18:76155744-76155766 TTGTTTGTGGATTTAAGGAAGGG - Intergenic
1160195634 18:76752815-76752837 TTGCTTTTTGATAAGGGGGATGG - Intergenic
1164785556 19:30927660-30927682 CAGCTTGGGGATAAAGGGGAGGG - Intergenic
1165817987 19:38654747-38654769 TTGTTTATGGAGAAAGGGGAGGG - Intronic
1166411135 19:42555918-42555940 TTTTTTCTGCAGAAAGGGGAAGG + Intronic
925345099 2:3166491-3166513 TTGTCGGTGGCTAAGGGGGAGGG + Intergenic
927199477 2:20569605-20569627 TTGTTGGTGGACTTAGGGGAAGG - Intronic
928020199 2:27698551-27698573 TTGTCTGGGGGTAAAAGGGAAGG + Intergenic
931848665 2:66231043-66231065 CTGTTTGTGGGTCAAGAGGAAGG + Intergenic
932260118 2:70319778-70319800 TTTATTGTGGATGAAGGGGTTGG + Intergenic
934049371 2:88197719-88197741 ATGTTTGTGGACAGATGGGAAGG - Intergenic
935319738 2:101874333-101874355 TAGTTTGTGGATAGACAGGATGG + Intronic
935821030 2:106892890-106892912 TTCTTGGTGGAAAGAGGGGAGGG - Intergenic
935842442 2:107128203-107128225 GTGTGTGTGTATAAAGGGAAAGG - Intergenic
937630296 2:124094123-124094145 TGGTGTGTGAATAAAGGGGATGG + Intronic
939674513 2:145055362-145055384 TTGTTTGTGAATAATAGAGACGG + Intergenic
940620383 2:156105440-156105462 TTGTGAGGGGATAGAGGGGAGGG + Intergenic
942988371 2:182168779-182168801 TTTTCTGTGGATAAAGGAAAAGG - Intronic
943546262 2:189283167-189283189 TTGTTTGAAAATAAAGAGGAAGG + Intergenic
943750895 2:191508457-191508479 GTGTTTGTGGAGAAAGAGGGAGG + Intergenic
944019914 2:195089728-195089750 TTTGTTGTAGATAAAGTGGATGG - Intergenic
944715414 2:202372551-202372573 TTCCTTGTGGATAAGGGGCAGGG - Intergenic
944962053 2:204886241-204886263 TGGTTTATGGAGAAATGGGAGGG - Intronic
945081268 2:206088434-206088456 TTGTTTTTGGAGAAAGGGTCTGG - Intergenic
945606133 2:211934560-211934582 TTTTTTGTGGATGAGGTGGAAGG - Intronic
945609626 2:211983300-211983322 TTGTTGTTAGATAAAGGAGAGGG + Intronic
1169091056 20:2861723-2861745 CTGTGTGTGGAGAGAGGGGAGGG + Intronic
1170724078 20:18910402-18910424 GTGTCTGTGGATCCAGGGGAGGG + Intergenic
1173220221 20:41126234-41126256 TTGTTTGGGAAAAAAGGGAAAGG - Intergenic
1174218051 20:48932298-48932320 TTGGTTGTGAGTAAAGAGGACGG + Intronic
1176524279 21:7853609-7853631 TTTATTGTAGATAAAGGGGTTGG + Intergenic
1176974556 21:15305185-15305207 TTGTTAGGGGCTCAAGGGGAGGG - Intergenic
1177514839 21:22135759-22135781 TTGTTTCTTGATAAAGGAGAAGG - Intergenic
1178658299 21:34483622-34483644 TTTATTGTAGATAAAGGGGTTGG + Intergenic
1181734905 22:24874008-24874030 TTGTTAGTGGAAAGAGGAGAGGG + Intronic
1184365387 22:44047854-44047876 GTATTGGTGGACAAAGGGGATGG + Intronic
1184580003 22:45410385-45410407 TGCTTTGTGGATATAGGGGAAGG - Intronic
1185036560 22:48480968-48480990 TTTTTTGTGGATAAAGCGCAAGG - Intergenic
1185363023 22:50420479-50420501 TTGTTTGAGGATATAGGTGCTGG + Intronic
949193356 3:1276541-1276563 TTGTTAGTGCATAATGGGCAAGG - Intronic
950167856 3:10815190-10815212 ATGTTTGTGGCTAGAGAGGAAGG - Intergenic
951999431 3:28768751-28768773 TAGTTTGTGGCCAATGGGGAAGG - Intergenic
953221808 3:40978462-40978484 TTCTTCGTGGATAAAAGGCAAGG + Intergenic
955786877 3:62550406-62550428 TTGTTTGTGTTTAAAGATGAGGG - Intronic
955882307 3:63560528-63560550 ATCTTTGTGAATAAAGAGGATGG - Intronic
956040504 3:65140234-65140256 TTGTTTGTGGAGAGGGAGGAAGG + Intergenic
956420686 3:69083648-69083670 TTGATTCTGGAAAAATGGGATGG - Intergenic
957585167 3:82123656-82123678 TTGTTTGCAAAGAAAGGGGAAGG - Intergenic
957971540 3:87388815-87388837 TTTTTTTTTGATAAAGGGAAAGG + Intergenic
960192816 3:114727365-114727387 TAGTTTGTGGATTAAGGGGCAGG - Intronic
963149300 3:142027954-142027976 TTGTTTGCTCATAAAGGGGCCGG - Intronic
963635739 3:147793368-147793390 ATGTTTGTGAAAAAAGGGCAAGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
966101281 3:176271346-176271368 GTGTTTGTGGATAATGGGATGGG - Intergenic
967959657 3:194910324-194910346 TAGATTGTGGAGAAAGGCGAAGG + Intergenic
969543123 4:7806352-7806374 TTGTTTGTGGGGGCAGGGGAGGG - Intronic
970143246 4:13005927-13005949 TTGTTTGTGGATAAAAGATGAGG - Intergenic
970648017 4:18145464-18145486 ATGTTTGTGGAAGAAAGGGAGGG - Intergenic
971030600 4:22633643-22633665 GTGTGTGTGTATAAAGTGGAAGG + Intergenic
974120218 4:57629051-57629073 TTGTTTGAAGATGAAGGAGATGG + Intergenic
974468004 4:62282517-62282539 ATCTTTGTGGTTAAAAGGGATGG + Intergenic
974468520 4:62289494-62289516 ATGTTTTTGGATGAAGAGGATGG + Intergenic
975365176 4:73520812-73520834 TTGTTTTTGGATACCAGGGAGGG + Intergenic
975921116 4:79389966-79389988 TTTTTTGTGGATTAATGGAAAGG - Intergenic
975974813 4:80082560-80082582 TTTTCTGTAGATAAGGGGGAAGG - Intronic
976501170 4:85791095-85791117 TTGTTTGGTTAAAAAGGGGAAGG - Intronic
984733796 4:183092098-183092120 TTGATTATGGAAAAAGGTGAAGG + Intergenic
984809172 4:183779029-183779051 TTGTTTGTGGAAATGGAGGATGG - Intergenic
985219101 4:187683522-187683544 GTGTGTGTGGTTAAAGGGTATGG - Intergenic
986440862 5:7780491-7780513 TATTGTGTGGGTAAAGGGGAAGG + Intronic
987637170 5:20558705-20558727 TTGTTTGTGGAAATATGGGAAGG + Intronic
989260503 5:39414456-39414478 TTGTTTGTGGATAAAGTATCAGG + Intronic
989455825 5:41642908-41642930 TTTTTTGTGGCTATAGGGAATGG - Intergenic
989467315 5:41772205-41772227 TTGGTTGGGGAGAAGGGGGAGGG + Intronic
990728537 5:58783773-58783795 TTGTTTGTGGATAAAGGGGAAGG - Intronic
990770340 5:59236752-59236774 TTGTGTGTGGTTAAACGGGATGG + Intronic
991554398 5:67878999-67879021 TTCTTTGTTGATAGAGGGAAGGG + Intergenic
992715674 5:79509185-79509207 TTATTTGGGGAAAGAGGGGAAGG + Intronic
995424722 5:112007695-112007717 TTGTTTTTTAATAAAGAGGAAGG + Intergenic
996239362 5:121176170-121176192 TTGGTTGTGGTTAAATGGAAAGG - Intergenic
996709655 5:126531782-126531804 TTGTTGGTGGACAGAGAGGATGG + Intergenic
998189060 5:140007061-140007083 TTGTTTGTGGTAACGGGGGAAGG + Intronic
999139768 5:149351637-149351659 TATTTTGTGGAAAAAGGAGATGG + Exonic
1000444452 5:161302641-161302663 TTGTGTGTGGGTAGAGGAGATGG + Intronic
1000899485 5:166895412-166895434 ATGATTGCAGATAAAGGGGATGG - Intergenic
1001222454 5:169913395-169913417 GTGTTTTTGGAGAAAGAGGAGGG - Intronic
1001897176 5:175392602-175392624 ATGATAGTGGAGAAAGGGGATGG - Intergenic
1005004548 6:21274577-21274599 TTGGTTTTTGATAAAGGGTACGG + Intergenic
1005699816 6:28389201-28389223 TTGTTTGTTTATTTAGGGGAGGG - Intronic
1006168499 6:32079790-32079812 TTCCTTGGGGTTAAAGGGGAGGG - Intronic
1007081073 6:39104706-39104728 TTGAGTGTGTACAAAGGGGAGGG - Exonic
1008281887 6:49605710-49605732 TTGATTCTGGATAATGGGAAAGG + Exonic
1011162274 6:84404467-84404489 TTTTTTGAGGATTGAGGGGAGGG - Intergenic
1012789571 6:103676342-103676364 TTGTTTGTGGAAATAAAGGAGGG + Intergenic
1013189381 6:107789324-107789346 ATGTTTGTGGGTAGACGGGAGGG + Intronic
1015218041 6:130772798-130772820 TTGCTTGTGGAGGATGGGGAAGG + Intergenic
1016825317 6:148382813-148382835 GTGTTTTTGGAGAGAGGGGATGG + Intronic
1017686101 6:156914773-156914795 AGGTTTGTGGATAAAGGGCTGGG - Intronic
1017855021 6:158343162-158343184 TTCTTTGTCTATGAAGGGGAGGG + Intronic
1020805210 7:12781444-12781466 TGCTTTATGGATAACGGGGAGGG - Intergenic
1021228373 7:18055392-18055414 TTGCTTGTGGATAGAGTTGAGGG + Intergenic
1021809057 7:24385525-24385547 AGGTTTGATGATAAAGGGGAAGG - Intergenic
1023366585 7:39470572-39470594 GTGTGTGTGTATAAAGGGGTTGG - Intronic
1024392187 7:48827928-48827950 GTTTTTGTGGATAAATGAGATGG - Intergenic
1028785118 7:94783884-94783906 TATTTTGTGGAAAAAGGAGATGG + Intergenic
1028875576 7:95819433-95819455 CTGACTGTGGATAAAGGTGAAGG - Intronic
1030651213 7:112118080-112118102 ATTTTTGTGGAAAATGGGGACGG - Intronic
1031926488 7:127643557-127643579 ATGTCTGGGGATAAAGGGGAAGG + Intergenic
1031946431 7:127846430-127846452 TAGTTTGTGGTTAAATGGGTAGG + Intronic
1032245106 7:130204919-130204941 TTGTGTGTGGATAAAGGACAAGG + Intronic
1033002945 7:137526908-137526930 CTCTTTATGGATAAAGTGGATGG + Intronic
1033016322 7:137675224-137675246 GTGTTTGTGGATAACGTGGGTGG - Intronic
1034858974 7:154580220-154580242 GTGTGTGTGTATAAGGGGGAGGG - Intronic
1036132014 8:6124294-6124316 CTGTGTGTGGATAAAAGGGAAGG + Intergenic
1038230435 8:25694422-25694444 TTGTTATTGGGAAAAGGGGAGGG + Intergenic
1038448157 8:27618527-27618549 GAGGTTGTGGATAAAAGGGAAGG - Intergenic
1041588137 8:59545423-59545445 TGGTTTCTGGAAGAAGGGGAGGG + Intergenic
1043140440 8:76581998-76582020 TTGTATTTGCTTAAAGGGGAAGG + Intergenic
1043151398 8:76721029-76721051 CTGTTTGTGGCAGAAGGGGATGG + Intronic
1043488041 8:80718383-80718405 ATGTTAGCTGATAAAGGGGATGG - Intronic
1043921856 8:85992029-85992051 TTAAGTGTGGAGAAAGGGGATGG + Intronic
1044605938 8:94047490-94047512 TTGATAGTGGAGAAAAGGGAAGG - Intergenic
1045325593 8:101115482-101115504 TTCTTTCCTGATAAAGGGGAAGG - Intergenic
1045569155 8:103351880-103351902 TCTTTTGTGGAGAAAGGAGATGG - Intergenic
1045598259 8:103682579-103682601 TTGTTTATGTGTAAATGGGAAGG + Intronic
1046503021 8:115102820-115102842 ATGTATGTGGTTAAAGAGGATGG + Intergenic
1046886269 8:119370889-119370911 TTGATGGTGGAAAAAGAGGATGG - Intergenic
1049770686 8:144379587-144379609 TTGGTTGTGGGTACAGGAGAAGG - Intronic
1050655842 9:7828030-7828052 TTGTTTATGGATGAAGTGGTAGG - Intronic
1051537352 9:18175317-18175339 GTGTTTGTGGAGAACTGGGAAGG - Intergenic
1051643934 9:19249589-19249611 TGTTTTGTGGCTAAAGGGAAAGG - Intronic
1051817021 9:21120468-21120490 TTGTGTTTGCATAAAGGAGAAGG + Intergenic
1053363868 9:37509091-37509113 TTATTTGTAGAGACAGGGGAAGG + Intergenic
1056694083 9:88831681-88831703 CTGATTGTGGGTAGAGGGGAAGG + Intergenic
1056756583 9:89385635-89385657 AGCTTTGTGGATACAGGGGAGGG + Intronic
1057456231 9:95214560-95214582 TTGTTTGTGGATAATGCTGGTGG - Intronic
1058435882 9:104962662-104962684 TTGTTTGCTGATAAATGGAAAGG + Intergenic
1059049678 9:110910190-110910212 TTGTTAGGGGATAAAGCGGCTGG + Intronic
1059710052 9:116859551-116859573 TTCTTTGTGGATACAAGGGAAGG - Intronic
1062183042 9:135201127-135201149 GTCTTTGTGGAGAAATGGGATGG - Intergenic
1186868507 X:13745843-13745865 TTCTTTATGTGTAAAGGGGAGGG + Intronic
1188919358 X:35953079-35953101 TTGTTTGAGGAGAAAAGGAAAGG - Intronic
1189169004 X:38891009-38891031 ATCTTTGTGGATAAAGGTCAGGG + Intergenic
1191765830 X:64697500-64697522 TATTTTGTGGAAAAAGGAGATGG - Intergenic
1193436190 X:81477627-81477649 TGTTTTGTGGGTAAATGGGAGGG + Intergenic
1194090660 X:89579649-89579671 AGGTTTCTGGACAAAGGGGAGGG + Intergenic
1194889773 X:99364313-99364335 TTCTTTCTGCATAAAGGAGAGGG + Intergenic
1197162560 X:123340316-123340338 ATGTTTGTGGATAATGAGAAAGG - Intronic
1199449166 X:147960009-147960031 TTATGTGGGGAGAAAGGGGAAGG + Intergenic
1199616016 X:149656788-149656810 TTCTCTCGGGATAAAGGGGATGG - Intergenic
1199626625 X:149746460-149746482 TTCTCTCGGGATAAAGGGGATGG + Intergenic
1199929033 X:152499495-152499517 TTGTTGGTGGATGAAGTGCAGGG - Intergenic
1200443312 Y:3235709-3235731 AGGTTTCTGGACAAAGGGGAGGG + Intergenic
1200685026 Y:6250448-6250470 GTGTTTGTGGGTCAGGGGGACGG - Intergenic
1200990554 Y:9341718-9341740 GTGTTTGTGGGTCAGGGGGACGG - Intergenic
1200993216 Y:9362035-9362057 GTGTTTGTGGGTCAGGGGGACGG - Intronic
1200995872 Y:9382306-9382328 GTGTTTGTGGGTCAGGGGGACGG - Intergenic
1200998536 Y:9402658-9402680 GTGTTTGTGGGTCAGGGGGACGG - Intergenic
1201001046 Y:9471188-9471210 GTGTTTGTGGGTCAGGGGGACGG - Intronic
1201003712 Y:9491516-9491538 GTGTTTGTGGGTCAGGGGGACGG - Intergenic
1201006368 Y:9511797-9511819 GTGTTTGTGGGTCAGGGGGACGG - Intergenic
1201009023 Y:9532106-9532128 GTGTTTGTGGGTCAGGGGGACGG - Intergenic