ID: 990729228

View in Genome Browser
Species Human (GRCh38)
Location 5:58790134-58790156
Sequence AAACTCAGCATGTCCAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 2, 2: 13, 3: 40, 4: 301}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990729227_990729228 -10 Left 990729227 5:58790121-58790143 CCATAGGCATCTCAAACTCAGCA 0: 1
1: 7
2: 23
3: 87
4: 404
Right 990729228 5:58790134-58790156 AAACTCAGCATGTCCAAAATAGG 0: 1
1: 2
2: 13
3: 40
4: 301
990729226_990729228 -9 Left 990729226 5:58790120-58790142 CCCATAGGCATCTCAAACTCAGC 0: 1
1: 4
2: 35
3: 97
4: 364
Right 990729228 5:58790134-58790156 AAACTCAGCATGTCCAAAATAGG 0: 1
1: 2
2: 13
3: 40
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990729228 Original CRISPR AAACTCAGCATGTCCAAAAT AGG Intronic
901009162 1:6189130-6189152 AGACTCACCATCTCCAAAAAAGG + Intronic
902321293 1:15668799-15668821 AAACTCAGGAATCCCAAAATTGG + Exonic
903618068 1:24676681-24676703 AAAATTAACATGTCCAAAATAGG + Intergenic
904363495 1:29994225-29994247 AAACTCAGCAAACCCAAACTGGG + Intergenic
904888911 1:33763373-33763395 CAATTCAGTAGGTCCAAAATGGG - Intronic
905272400 1:36795739-36795761 AAATTCTGCATGTCCACAAAGGG + Exonic
905675968 1:39825303-39825325 AGACTCACCATGTCCAAGACAGG - Intergenic
909328183 1:74379526-74379548 AAACTGAGCATGTCAGAAATGGG - Intronic
911588157 1:99714827-99714849 AGACTTAACATGTCCAAAATGGG - Intronic
911959270 1:104279485-104279507 AAATGCAGCATTTCTAAAATAGG + Intergenic
912277170 1:108272442-108272464 AATCCCAGTATGGCCAAAATAGG + Intergenic
912291058 1:108421914-108421936 AATCCCAGTATGGCCAAAATAGG - Intronic
912326772 1:108771056-108771078 AAACACAACATTACCAAAATCGG - Intronic
915062234 1:153195746-153195768 CATCTCAGCATGTTCAAAACAGG - Intergenic
917511289 1:175671200-175671222 AAACCCAACATGTCCAAAGCTGG - Intronic
917868410 1:179220193-179220215 AAACTCTTCATCTACAAAATGGG + Intronic
917952631 1:180056376-180056398 AAGCTCAGCAAATCCTAAATAGG - Intronic
918982350 1:191579313-191579335 ATACGCAGCATGTCCAAATTTGG - Intergenic
919687589 1:200498633-200498655 AAAATCAGCCTGGCCAACATAGG + Intergenic
919753152 1:201050820-201050842 ACACTCAGGATGACCAGAATGGG + Intronic
919796945 1:201326644-201326666 AAACTCAACCTCTCCAAATTGGG - Intronic
919934114 1:202240465-202240487 AAACTCAACATGTCCCAGAGGGG - Intronic
920415468 1:205796476-205796498 AAACTGGGCATGTGCAAAATGGG - Intronic
921595217 1:217047304-217047326 AAATTTGGCATGTCCAAAACTGG + Intronic
921686114 1:218091038-218091060 CAGCTCAACATATCCAAAATTGG - Intergenic
923135288 1:231111743-231111765 TCACACAGCATATCCAAAATAGG + Intergenic
923678501 1:236100382-236100404 AAATTCAGCACTTCCAAAACTGG + Intergenic
1062990974 10:1817425-1817447 AAAATCAGGATATCCAAACTAGG - Intergenic
1065308753 10:24394227-24394249 AAACTCAGCAGGCTGAAAATAGG - Intronic
1065555096 10:26907114-26907136 AATCCCAGCGTGCCCAAAATTGG - Intergenic
1065811958 10:29450665-29450687 AAACTAATCATGTCCAAAGGAGG - Intergenic
1066550216 10:36547664-36547686 AAACTTAACATGTCCAGACTGGG + Intergenic
1068610957 10:59059512-59059534 AATCTCAGCATTTCAAAAAGAGG + Intergenic
1069946286 10:71988166-71988188 ATAATGAGCATGACCAAAATGGG + Intronic
1071057192 10:81525545-81525567 AAAGTCAGCAGATTCAAAATAGG - Intergenic
1072034422 10:91551416-91551438 AAACACAGCATGGCCAAACATGG + Intergenic
1072603474 10:96955298-96955320 AAACTCTGCCTTTCCAAAAATGG + Exonic
1072609775 10:97010457-97010479 GAAATCAACATGTTCAAAATTGG + Intronic
1072751068 10:97979268-97979290 TAACTGAGCATGTCCAGAGTGGG - Intronic
1074512824 10:114133396-114133418 AACTTTAGCATTTCCAAAATCGG - Intronic
1075757660 10:124827359-124827381 AAAACCAGCCTGGCCAAAATGGG - Intronic
1077621822 11:3731735-3731757 ATACTCAACATGTACAAAGTTGG - Intronic
1078181243 11:9013185-9013207 AAAATTAGCATGTCCAATAAAGG - Intergenic
1078644144 11:13123473-13123495 AAACTCCACATGGCCAAAACTGG + Intergenic
1078759974 11:14243965-14243987 AAACTCATCATGTCCAAAATGGG + Intronic
1079870223 11:25788830-25788852 CAAGTCAGAATGTCCAAAAAAGG - Intergenic
1080060728 11:27954022-27954044 GAACTCAACATGTCAATAATTGG - Intergenic
1080144881 11:28969507-28969529 AAATTCAGCATGTTCAACATAGG + Intergenic
1080694634 11:34591486-34591508 AAATACATCATGTCCAAATTTGG - Intergenic
1081196454 11:40167195-40167217 AAGCTTAGGTTGTCCAAAATTGG + Intronic
1083790352 11:64980783-64980805 AAATTTAACATGGCCAAAATAGG + Intergenic
1084578013 11:70003187-70003209 AAAATCGGCATGACCACAATAGG + Intergenic
1085392275 11:76188611-76188633 AATCCCAGAATGTCCAAGATGGG + Intronic
1085777041 11:79376353-79376375 AACCTCAGCATGTAGAAAACAGG + Intronic
1086314562 11:85577523-85577545 AAACTTATCATGGCCAAAACTGG - Intronic
1086391329 11:86367034-86367056 AAGCTTAGCAAGTCCCAAATAGG - Intergenic
1087502113 11:98970927-98970949 AAACTCAGGAATTCCCAAATCGG - Intergenic
1088067222 11:105734177-105734199 AAACTAAGTATGTATAAAATTGG + Intronic
1090197519 11:124829425-124829447 GACCTCAGCAAGACCAAAATTGG + Intergenic
1090434562 11:126676077-126676099 AAATTCAGTATGTCCCAAACTGG - Intronic
1090556478 11:127882191-127882213 AAACTCAGCATGAAAAAAAATGG + Intergenic
1090913704 11:131144023-131144045 ATACTCAGCATATCTAAAAACGG - Intergenic
1091026727 11:132148065-132148087 AAACTTGGCATGACCAAACTTGG - Intronic
1091057439 11:132432018-132432040 AAAGTCACCATGTCCATGATGGG + Intronic
1091066565 11:132519065-132519087 AAACTATGCATGTCAGAAATGGG - Intronic
1091073781 11:132594717-132594739 TATATCACCATGTCCAAAATAGG + Intronic
1091553157 12:1552172-1552194 AAAGTCAGCAGGTCCAAAAATGG - Intronic
1091890575 12:4050701-4050723 TAACCCAGTATTTCCAAAATAGG - Intergenic
1091974858 12:4816117-4816139 AAGCTTAGCATGTCTAAAAATGG + Intronic
1091984751 12:4900158-4900180 AAACTGAGCATTTTTAAAATAGG - Intergenic
1093169621 12:15845238-15845260 CAAGTCAGCATCTCCAAACTTGG - Intronic
1094079476 12:26516911-26516933 AGACTCAGCATATACATAATTGG + Intronic
1094558665 12:31528715-31528737 AAAATCAGTATGTTCAAAACTGG - Intronic
1094561653 12:31560194-31560216 AAACTCAGAATGTCCAAAAATGG + Intronic
1095921845 12:47539649-47539671 GAGCTCAGCATATCTAAAATCGG - Intergenic
1096746255 12:53729044-53729066 AATCTCATCATGTGTAAAATGGG - Intergenic
1097210901 12:57368870-57368892 AAACTCTGCAGTTCCAAAAGTGG + Intronic
1098020972 12:66156251-66156273 AAACTTAACATGGCCAAAACTGG + Intronic
1098611054 12:72458649-72458671 AAACTCAGTATGTCCAAAGCAGG + Intronic
1098910063 12:76199758-76199780 AACCTCATTATGTCCAAAACAGG + Intergenic
1098928323 12:76378967-76378989 AAAATCAGCTTGGCCAACATGGG - Intronic
1098986007 12:77013091-77013113 CAACACAGCATGGCCAACATGGG - Intergenic
1099423862 12:82499193-82499215 AAACTCAACATACACAAAATAGG - Intergenic
1100238862 12:92689674-92689696 AAACTAAGCATGTTTTAAATTGG + Intergenic
1100543245 12:95577911-95577933 AAAACTAGTATGTCCAAAATTGG + Intergenic
1104573336 12:129944606-129944628 GAACTTAGCATCTTCAAAATTGG + Intergenic
1105320833 13:19320013-19320035 AAACTTGTCAGGTCCAAAATCGG - Intergenic
1106190183 13:27445646-27445668 AGACTCAGCATCTCCAACAGTGG + Intronic
1106674168 13:31940111-31940133 AAACTCAGCATGTATAAAACTGG - Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1108471825 13:50774591-50774613 AAACTCCGCAAATCCCAAATAGG - Intronic
1108941299 13:55958031-55958053 AAACTCAACATGACCTAAAGTGG + Intergenic
1110399521 13:75073467-75073489 AAGCCCAGCATGGACAAAATAGG - Intergenic
1110862701 13:80360280-80360302 AAACCAAGCATGTCAAAATTTGG + Intergenic
1112333676 13:98496974-98496996 AATCTCAGCATGTTAAAACTTGG - Intronic
1112569922 13:100584915-100584937 AAGCTCAACATTACCAAAATAGG - Intronic
1114620404 14:24093215-24093237 AAACTCAGCATATCTATGATGGG - Intronic
1117187117 14:53251296-53251318 AAACTTAGTATGTCCAAAGCTGG + Intergenic
1117287109 14:54296609-54296631 AATCTCTGCATCTCTAAAATAGG - Intergenic
1118681903 14:68250593-68250615 AAAAGAAGCATATCCAAAATAGG + Intronic
1119460995 14:74803624-74803646 AAATGCAGCATATTCAAAATGGG + Intronic
1122463133 14:101912186-101912208 AAATTTAACATGTCCAAGATTGG - Intronic
1125203474 15:37123633-37123655 AAAATCAGCATGTAACAAATTGG + Intergenic
1125256545 15:37770548-37770570 AAAATCTGCATCTGCAAAATGGG - Intergenic
1125893768 15:43285330-43285352 AGACTCAGCCTGGCCAACATGGG + Intronic
1128671714 15:69578644-69578666 AACCTCAGCATCACCAAAATTGG - Intergenic
1129237539 15:74232821-74232843 GAACTCACCAAGTCCAAAGTTGG - Intergenic
1129550955 15:76448475-76448497 AAACTTAGCATGCCCAGAACTGG - Intronic
1129605618 15:77023642-77023664 AAATTCAGCGTGTCCAAAACCGG - Intronic
1129912926 15:79243130-79243152 ATACTCAGCATGTCTGAACTGGG - Intergenic
1131787650 15:95930467-95930489 TTACACAGCATGTCAAAAATAGG - Intergenic
1133767266 16:8846737-8846759 CAACTCCCCATCTCCAAAATGGG - Intronic
1134543460 16:15088939-15088961 AAACTTAGCATGTCCACTCTTGG - Intronic
1135321433 16:21500364-21500386 AAACTAAGCATGTCAATCATAGG + Intergenic
1135374267 16:21931860-21931882 AAACTAAGCATGTCAATCATAGG + Intergenic
1135437519 16:22438854-22438876 AAACTAAGCATGTCAATCATAGG - Intergenic
1136261489 16:29080300-29080322 AAACTTAGCATGTCCACTCTTGG + Intergenic
1136332910 16:29593478-29593500 AAACTAAGCATGTCAATCATAGG + Intergenic
1136447605 16:30333567-30333589 AAACTAAGCATGTCAATCATAGG + Intergenic
1136462565 16:30420791-30420813 ACATTCAGCATGTCCAGACTGGG - Intronic
1136775037 16:32867372-32867394 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1136895581 16:33994140-33994162 AGACTCAGCTTGTCCAAAATGGG + Intergenic
1138985346 16:62321537-62321559 AATCTCAGCAAGTCCACAAGAGG + Intergenic
1203077455 16_KI270728v1_random:1129481-1129503 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1143561298 17:7696838-7696860 AAACTCAATTTGTCCATAATAGG - Intronic
1144528086 17:16008279-16008301 ATACTTAACATGTCCAAAATAGG + Intronic
1144901831 17:18601003-18601025 AAACTTACCAGGTCCAAGATTGG - Intergenic
1144929236 17:18844942-18844964 AAACTTACCAGGTCCAAGATTGG + Intronic
1145130671 17:20345067-20345089 AAACTTACCAGGTCCAAGATTGG + Intergenic
1145832937 17:27931973-27931995 AAACTCAACATGACCCAAACTGG - Intergenic
1146319023 17:31832018-31832040 AATCCCAGTGTGTCCAAAATTGG + Intergenic
1146477034 17:33171359-33171381 AAACTCAACATGTCCACACTTGG + Intronic
1146754105 17:35410946-35410968 AAACTCAGAATTTCCACAGTGGG - Intergenic
1146800647 17:35817371-35817393 AAACTAATCAGGTCCAAAAAGGG - Intronic
1150513356 17:65779882-65779904 AAACTCAGTAGGTCCAGTATAGG - Intronic
1151520526 17:74626031-74626053 AAACTCACCATGTCTAATATAGG + Intergenic
1153755281 18:8276347-8276369 AAGAGCAGCTTGTCCAAAATGGG - Intronic
1153942792 18:9991868-9991890 AGACTCAGCAGGTCCACAGTGGG + Intergenic
1155088779 18:22485479-22485501 CAAATCAGCATGCCCAAAAATGG - Intergenic
1156330732 18:36119253-36119275 AAACTCAGCATATTCCAAAAAGG + Intronic
1159266030 18:66080829-66080851 GAACTCAGCATGTGGAAACTGGG + Intergenic
1159343449 18:67167534-67167556 AAATTCAGCAAGTCAAGAATTGG - Intergenic
1159382117 18:67674110-67674132 AAACTTAACATGTCCCAAACTGG + Intergenic
1159396604 18:67865926-67865948 AAGATCAGCATGTTCAAAAGAGG - Intergenic
1159587158 18:70291570-70291592 AAAGTCAAAAAGTCCAAAATTGG - Intronic
1160262199 18:77304848-77304870 AAACTCAGCATATTCATCATTGG + Intergenic
1162802774 19:13120109-13120131 AAACTCAGTCTGTCCCAAAGGGG - Intronic
1164269624 19:23660086-23660108 AAATTCAGTCTGTCCAAAATGGG + Intronic
1166723932 19:45013994-45014016 CAACTCAGCATCACCAATATTGG - Intronic
925356581 2:3246224-3246246 AAACACAACATTTACAAAATGGG + Intronic
926390788 2:12390462-12390484 AAACTCAGAATTTCCAAAACTGG - Intergenic
926976435 2:18520974-18520996 AAACTCAGGATTTCCAAATGAGG - Intergenic
927232533 2:20838259-20838281 AAGATCAGCATGTCCCAGATTGG + Intergenic
927371646 2:22362724-22362746 CAACTCAGCAATTCCATAATTGG - Intergenic
927385598 2:22530119-22530141 TAACTCAGCATTTCAAAAGTAGG - Intergenic
928897353 2:36280839-36280861 AAACACAGCCTGTGCCAAATGGG + Intergenic
930180652 2:48352624-48352646 AAATTCAGTGTGTCCGAAATTGG + Intronic
930495217 2:52132950-52132972 AATGTCAGAATGTCCAAACTAGG - Intergenic
930732853 2:54744746-54744768 AAACTCAGCATGTCTGAAATAGG - Intronic
930852763 2:55978356-55978378 AAAGTCAGCATATTCAAAATAGG - Intergenic
931621174 2:64211196-64211218 AAACTTAACAAGTCCAAACTTGG + Intergenic
931623225 2:64231953-64231975 AAACTTAACAAGTCCAAACTTGG - Intergenic
934475565 2:94591254-94591276 ACACTCAACATGTCCAGAAAGGG + Intronic
935534374 2:104276605-104276627 AATCTCAGCATCTCTAAAACTGG + Intergenic
936807680 2:116356737-116356759 AAGGTCAGCTTTTCCAAAATTGG + Intergenic
938453108 2:131441520-131441542 AAACTTAATATGTCCAAAATGGG - Intergenic
939546665 2:143563157-143563179 CAACTCTTCATTTCCAAAATGGG + Intronic
939562503 2:143749451-143749473 TAAGTCAGCATGTTCAAGATAGG + Intronic
941366230 2:164614814-164614836 AAGTTCAGCATGTCCAAAGTGGG + Intronic
941409933 2:165142309-165142331 AAAATCAGCATGACCTAATTAGG - Intronic
941505372 2:166337325-166337347 AAACACAGGATGTCCAAAATTGG - Intronic
942479452 2:176368390-176368412 CAACTCAATATGTCCAAAACTGG - Intergenic
942634118 2:177983328-177983350 AAACACAGCAGGTCCTCAATGGG - Intronic
943153300 2:184141244-184141266 AAACTCAACATGTGAAATATGGG + Intergenic
944891828 2:204125495-204125517 AAAATCAGGATGTCAGAAATGGG + Intergenic
945271010 2:207940040-207940062 AAACTCAACAGTTCCCAAATTGG - Intronic
945403308 2:209415108-209415130 AAACACAGCATATCAAAATTTGG + Intergenic
947151394 2:227120056-227120078 AGACTCATCATGTAAAAAATAGG - Intronic
947541083 2:230979147-230979169 AAACTCAGAATGACCAAGAGTGG + Intergenic
947780531 2:232756905-232756927 AAAATCAGCAAACCCAAAATAGG - Intronic
948711284 2:239827282-239827304 AAACTCAGCAGGTCTCAAGTGGG - Intergenic
1168835298 20:873637-873659 AAACACAGCATGTGAAAGATGGG - Intronic
1169173365 20:3485541-3485563 AAACATATCATGGCCAAAATGGG - Intronic
1169799164 20:9497450-9497472 TAACTAAACATGTCCACAATGGG - Intergenic
1170205249 20:13791139-13791161 AAACTCAACATATCTAAAACAGG - Intronic
1170426803 20:16243243-16243265 AAACTCAGCGTTTCCAAACATGG - Intergenic
1170738389 20:19030569-19030591 AAACTCAACAAGCCCCAAATAGG - Intergenic
1174750931 20:53110878-53110900 TGACTCAGTATGCCCAAAATGGG - Intronic
1179295777 21:40061125-40061147 AAATTCAACATGACCCAAATAGG + Intronic
1179644970 21:42770227-42770249 ACCCCCAGCATGTCCAAAACAGG + Intronic
1180046803 21:45310340-45310362 ACACTCAGCATGTCCACAGGTGG + Intergenic
1182604892 22:31495672-31495694 AAAATTAGCATGTAGAAAATAGG + Intronic
1183137535 22:35903603-35903625 AAACTCAACATGCCCAAAATTGG + Intronic
1183555483 22:38523107-38523129 AAATGCAGCAGGTCCAACATAGG + Intronic
949565469 3:5240788-5240810 AAACCCAGCATTTCCAAAGATGG + Intergenic
951165051 3:19475408-19475430 AAAGTCAGCATTTCCAAATTTGG - Intronic
951416971 3:22436361-22436383 AATCTCAGCAATTTCAAAATTGG + Intergenic
951713462 3:25611050-25611072 AAACTCAGCATGTCTGAAACTGG - Intronic
952001966 3:28796416-28796438 AAATTCACCTTGTCCAAAACTGG - Intergenic
952450661 3:33429526-33429548 AAAATCAGCCTGGCCAACATGGG - Intronic
953846874 3:46434455-46434477 AAGCCCAACATGCCCAAAATTGG + Intergenic
954600743 3:51866010-51866032 AAAGTCAGCAGGTTCAAAGTAGG - Intergenic
956083182 3:65581417-65581439 AACTTCAGCATGTACAATATAGG - Intronic
956687351 3:71842497-71842519 ACACTCAGCATTTTAAAAATTGG + Intergenic
957301504 3:78397567-78397589 AAACTCAGTATTTCCAAATCTGG - Intergenic
957552941 3:81730446-81730468 AAACTCACCAAGCCTAAAATTGG - Intronic
957931522 3:86884564-86884586 AAACTTAGCATGTCCAAATCTGG - Intergenic
958174119 3:89973480-89973502 GGACTCAGTATGTTCAAAATAGG + Intergenic
958174252 3:89974961-89974983 GAACTCAGTATATCCAAAATAGG + Intergenic
958741853 3:98083205-98083227 AGATTCACCATGTCCAAATTTGG - Intergenic
959641187 3:108638230-108638252 TAATCCAGCATGTCCAAAACTGG + Intronic
960459992 3:117921851-117921873 AGACTCAGCATGACAAGAATGGG - Intergenic
961268961 3:125672937-125672959 AAACCCAGTGTGTCCAGAATTGG - Intergenic
961460652 3:127048027-127048049 AATCTCAGTGTGTCCAGAATTGG - Intergenic
962027714 3:131566242-131566264 AAACTCTTCGTGACCAAAATGGG + Intronic
962084938 3:132180765-132180787 AAACTCAGCAAGTCCGAGACAGG + Intronic
962556689 3:136559763-136559785 AAACTCAGCCTCTCAAAGATAGG - Intronic
964636385 3:158862082-158862104 AAAATTAGTATGTCCCAAATAGG - Intergenic
965218366 3:165894227-165894249 AAACTCAGTATGTCCAAAATCGG + Intergenic
965781136 3:172287288-172287310 AAACTCAGCATGTCCAAGAATGG - Intronic
966617038 3:181924773-181924795 AAAATCAGCATATTCAAAACTGG + Intergenic
966643545 3:182217073-182217095 AAACACAGCAAGTCTAAAATAGG + Intergenic
967921820 3:194619629-194619651 AACCTCACCATGGCCAAATTAGG + Intronic
969461845 4:7333180-7333202 AAACTCAGCCAGTCAGAAATGGG - Intronic
970889672 4:21028803-21028825 AAACTCACCATGTCTAAGTTGGG + Intronic
972228665 4:37044685-37044707 AATCTCAGCATCTGTAAAATAGG - Intergenic
972384591 4:38552771-38552793 AAACTCAGAAGGTGCAAAGTTGG + Intergenic
974147900 4:57968689-57968711 AATCTAAGTGTGTCCAAAATTGG - Intergenic
974445938 4:61981321-61981343 AAAATCTGCAGGTCTAAAATGGG + Intronic
976685177 4:87806307-87806329 AAATTCTGCTTATCCAAAATAGG - Intronic
977408712 4:96633940-96633962 AAACTCAGCATGTTCACTAATGG - Intergenic
977437491 4:97017932-97017954 AAACTCAGCATGTTCTCCATTGG - Intergenic
977885598 4:102249372-102249394 AAACCCATTATGTCCAGAATTGG + Intergenic
978157254 4:105504199-105504221 AAACTCATCAGCTCCAAAAAAGG - Intergenic
978595807 4:110375733-110375755 AAACTTAGTATGTCCAAAGCTGG - Intronic
980165458 4:129220890-129220912 AAGCTAAACATGTCCCAAATTGG + Intergenic
980806538 4:137822545-137822567 ACACTCAGAATGTCAAAATTAGG + Intergenic
983198104 4:164830623-164830645 AACGACAGCATATCCAAAATGGG + Intergenic
983735452 4:171053207-171053229 AAAGTCAGCAGATTCAAAATGGG - Intergenic
986082890 5:4412410-4412432 GAACTCAGCAAGTAAAAAATAGG - Intergenic
987483749 5:18495574-18495596 AAACTCAAAATAACCAAAATAGG + Intergenic
987512635 5:18859665-18859687 AAACTCAGAATATACAAATTGGG - Intergenic
987518287 5:18944397-18944419 ACACACAACATGTCCACAATGGG - Intergenic
987571206 5:19662234-19662256 AACATCAGCATCTCAAAAATGGG - Intronic
988406486 5:30829857-30829879 AAACTCAGTATGTTTAATATTGG + Intergenic
989271432 5:39538073-39538095 AAACTTAACATGTCCCAAATTGG - Intergenic
990727104 5:58768142-58768164 AAAGTCAGCATGTTCAAGACAGG - Intronic
990729228 5:58790134-58790156 AAACTCAGCATGTCCAAAATAGG + Intronic
991439100 5:66627587-66627609 AAACTCAGCATATACAATTTGGG + Intronic
992566917 5:78005750-78005772 GAACACAGCATGATCAAAATTGG + Intronic
992810583 5:80383898-80383920 AAACTCAACATCTCCAAATATGG + Intergenic
994942885 5:106347510-106347532 TTACTCAGCATGTCTAAAACTGG + Intergenic
995086356 5:108115217-108115239 AAAATCAGAATGTTCAAACTAGG + Intronic
995253073 5:110016595-110016617 GAACTCAACATGTCCTAAACTGG + Intergenic
995265969 5:110161082-110161104 AAACTCAAGTTGTCTAAAATTGG + Intergenic
995447026 5:112255846-112255868 AAATTCAACATGTTCAAAACGGG + Intronic
996148296 5:120002502-120002524 AAACTCAAAATGTTAAAAATGGG + Intergenic
996546846 5:124688472-124688494 AATGTCAGCAAGTCCAAAGTTGG + Intronic
997409255 5:133678598-133678620 AAAATGAGCATGTCCAAAACTGG - Intergenic
998019256 5:138755744-138755766 AAACTCAAGGTGTCCAAAGTGGG + Intronic
998499446 5:142619374-142619396 AAACCCAGCATATACAAAACAGG + Intronic
998744092 5:145237104-145237126 AAAAACTGCATGTCCCAAATTGG + Intergenic
998939317 5:147263342-147263364 ATACTCAGAATGTCCAAACAGGG + Intronic
1001943670 5:175759977-175759999 AAACACAGCATATCAAAATTTGG + Intergenic
1002056626 5:176601572-176601594 AAACTCAGCTTGTCCAAAAACGG - Intronic
1002683614 5:180989510-180989532 TAACTCAGCATGTGCATAACTGG - Intronic
1003564283 6:7209352-7209374 AAAATGAGCATTTCTAAAATTGG + Intronic
1003719152 6:8681138-8681160 AAACTCAGCAGATGCAAAACTGG - Intergenic
1004540257 6:16543088-16543110 AATCACAGCATGTCCACAAATGG + Intronic
1004805236 6:19196740-19196762 ACAATCAGCATATCAAAAATGGG - Intergenic
1004913603 6:20310682-20310704 AAGCTGAGCAAATCCAAAATAGG + Intergenic
1006702766 6:35989578-35989600 AAACTCAGGATTCCAAAAATGGG + Intronic
1008313891 6:50014992-50015014 AAACTCTACATGTCCAAAATTGG + Intronic
1008799728 6:55351793-55351815 AAAATCAGCATGTCAAAATATGG + Intronic
1010771904 6:79841394-79841416 ACACTCAGCATGTCTAAAGATGG - Intergenic
1011747420 6:90419662-90419684 AATCTCAGCAGAACCAAAATGGG - Intergenic
1012109259 6:95205536-95205558 AAACTTAAAATGTCCAAAAAAGG - Intergenic
1013186211 6:107761238-107761260 AAGCTCAGCAAATCCTAAATAGG + Intronic
1013480227 6:110546646-110546668 AAACTCAGTATGTTCAAAAGTGG + Intergenic
1013781512 6:113733654-113733676 AGAGTCAGCATGTCCAGAACAGG + Intergenic
1014944971 6:127486676-127486698 AGCCTCAGCTTGTCCAAAAGAGG + Intronic
1015422917 6:133031779-133031801 AATCTCAGCATGATCCAAATAGG - Intergenic
1018193222 6:161329702-161329724 AAACTCAGGAAGTCCTACATTGG - Intergenic
1018409557 6:163529905-163529927 GAACTCCACATGTCCAAACTGGG - Intronic
1018766239 6:166935277-166935299 AAACTCAATATATCAAAAATAGG - Intronic
1021232944 7:18107780-18107802 ATAATGAGCAAGTCCAAAATGGG - Intronic
1021800020 7:24295776-24295798 AAGTTCAGTATGTCCAAAATTGG + Intergenic
1023855198 7:44178795-44178817 AATCTCAGCATGGCCCAACTTGG + Intronic
1023855444 7:44180574-44180596 AATCTCAGCATGGCCCAACTTGG - Intronic
1024823367 7:53360592-53360614 AAACTCAAAATGGCTAAAATTGG - Intergenic
1026055740 7:66982054-66982076 AAAACCAGCCTGGCCAAAATAGG + Intergenic
1028210319 7:88066459-88066481 ACACTTAACATGTCCAAACTTGG - Intronic
1028772858 7:94647165-94647187 AAACTAAGCTTGTCCAAACTAGG + Intronic
1029636346 7:101786928-101786950 TAATTCAGCAAGTCCAAGATGGG + Intergenic
1029874036 7:103729379-103729401 AAACACTGCACGTCAAAAATTGG + Intronic
1030276976 7:107732125-107732147 AAACTCAGGAAGTAAAAAATTGG - Intergenic
1030333162 7:108294810-108294832 AAACTAAGCATGTCCAAAAAAGG - Intronic
1031588017 7:123556238-123556260 AAACTTAACATGTCCAAAATGGG - Intronic
1032733390 7:134666575-134666597 AAAGTCATCATATCCAGAATGGG - Intronic
1032870468 7:135979149-135979171 AAACTTAACATGTCCAGAATAGG + Intergenic
1032913652 7:136462527-136462549 GAACTCATCATGTCCCAAAAGGG + Intergenic
1033411457 7:141121842-141121864 AAGCTCAGCAAGTCAAAAAGGGG - Intronic
1034839165 7:154379825-154379847 AAACTAAGCATTGCCAATATTGG + Intronic
1035131416 7:156657735-156657757 AAACTCATGATTTTCAAAATAGG - Intronic
1038438714 8:27557005-27557027 AGACTCAGCAAGTCCAGAACAGG + Intergenic
1039363245 8:36902919-36902941 AAGGTCAGCTTGACCAAAATGGG - Intronic
1042195325 8:66227240-66227262 CACCCCAGCATGTCCAGAATGGG - Intergenic
1042687506 8:71458767-71458789 AAACTCAACGTGTACAAAATTGG - Intronic
1043521000 8:81045081-81045103 ACACACAGAATGTCCAAAGTGGG + Intronic
1044278194 8:90326415-90326437 AAACTCAACATGTCTAAAAATGG + Intergenic
1044288378 8:90437834-90437856 AAACTCAAGATCTCAAAAATTGG + Intergenic
1044756424 8:95466971-95466993 AAAATCAGGACATCCAAAATGGG - Intergenic
1046155007 8:110276869-110276891 AAAATCAGAATGTTAAAAATAGG + Intergenic
1046315842 8:112500794-112500816 GGACTAGGCATGTCCAAAATGGG + Intronic
1048009109 8:130442844-130442866 AAACGCAGCAGGTCCCAAAATGG + Intronic
1051262049 9:15273961-15273983 TAAATCAAGATGTCCAAAATGGG + Intronic
1052157876 9:25217023-25217045 ATCCTCAGCATCTCCAAAATTGG - Intergenic
1052165519 9:25321914-25321936 AAACTCAGCATAGCTAGAATAGG - Intergenic
1053223087 9:36327583-36327605 AAACTCAACATATCCAAATATGG - Intergenic
1053682501 9:40494824-40494846 ACACTCAACATGTCCAGAAAGGG - Intergenic
1053932484 9:43123150-43123172 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054281213 9:63130105-63130127 ACACTCAACATGTCCAGAAAGGG + Intergenic
1054295600 9:63330324-63330346 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054393621 9:64634828-64634850 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054428269 9:65140041-65140063 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054502110 9:65881502-65881524 ACACTCAACATGTCCAGAAAGGG + Intronic
1055166989 9:73208918-73208940 AAACTCAGTATATACAACATGGG + Intergenic
1055620765 9:78122671-78122693 AAACTTAACATGTCCAAAAATGG + Intergenic
1056234441 9:84578443-84578465 AAGCTCAGTAAGTCCCAAATAGG + Intergenic
1058045064 9:100349856-100349878 AAGCTGAGCATGTGAAAAATGGG + Intronic
1058926935 9:109675229-109675251 AAACTTATCATGTTCAAATTTGG + Intronic
1059976621 9:119724694-119724716 AAACTCAGCATGTCCCAAAGTGG + Intergenic
1186332155 X:8545906-8545928 CAACTCAGTGTGTCCACAATTGG + Intronic
1186376068 X:9003075-9003097 AGCCTCAGCATGTCCACACTGGG + Intergenic
1186443965 X:9609923-9609945 AAACTCAGAAAGTGCAATATTGG - Intronic
1186753067 X:12641615-12641637 AAACTTACCAAATCCAAAATTGG + Intronic
1188573404 X:31617000-31617022 AAATTCAGTATGACCCAAATAGG - Intronic
1189125263 X:38438736-38438758 AAACTCAGCATCTGGCAAATGGG - Intronic
1189175675 X:38955062-38955084 AAACTCTGCCTGGCCAAACTAGG - Intergenic
1189280028 X:39814522-39814544 AGACACAGCATGACCAAAATGGG + Intergenic
1190119005 X:47645173-47645195 AAACTGACCATCTCCAAAACTGG - Intronic
1190156311 X:47995675-47995697 AGGCTCAGCAAGTCCAAAACAGG + Intronic
1191881650 X:65848750-65848772 AAACTCAGGATGTATCAAATGGG - Intergenic
1192024822 X:67438461-67438483 AAACTCAACATATTCAAAATTGG + Intergenic
1193456725 X:81740489-81740511 TAACTCAGCATGTCCACTACTGG - Intergenic
1193505578 X:82338258-82338280 AAACTCAGCAGAACCAAAACTGG - Intergenic
1193511979 X:82413510-82413532 GAACACAGCATGTCCAAAAATGG - Intergenic
1195538329 X:106034274-106034296 AAAATCAGCATTTTCAGAATAGG + Exonic
1196318757 X:114264004-114264026 AAATGCACCATGTTCAAAATAGG + Intergenic
1196821593 X:119705587-119705609 AAACTCAACATGTCCCAAACTGG - Intergenic
1196935272 X:120724353-120724375 AAAGTCAGCAGATTCAAAATAGG + Intergenic
1197288948 X:124631578-124631600 AAGCTCAGCAAGTCCGAAGTAGG + Intronic
1198453688 X:136793996-136794018 AAACTCAGTATGACCCAAATTGG + Intergenic
1200021069 X:153209291-153209313 AACCTCATAATGTCCAATATTGG - Intergenic
1200104902 X:153706688-153706710 AGACTCAGCTTGTCCAAAACGGG + Intronic
1200309612 X:155064868-155064890 ATACTCAGCAGATCCAAATTAGG + Exonic
1200854923 Y:7927327-7927349 AGAGTCAGCATCTCAAAAATGGG + Intergenic