ID: 990735473

View in Genome Browser
Species Human (GRCh38)
Location 5:58856255-58856277
Sequence CTCCAAACAGAGAGAGTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 285}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990735473 Original CRISPR CTCCAAACAGAGAGAGTGGA GGG Exonic
900306941 1:2015058-2015080 CACCAAACAGAGAAAATGGCAGG - Intergenic
901726057 1:11243067-11243089 CTCCAACCAAATGGAGTGGAAGG + Intronic
902342358 1:15792276-15792298 CTCCAAACTGCAAGAGGGGAAGG + Intergenic
902816763 1:18920881-18920903 TTCCAAGCAGAGGAAGTGGAAGG + Intronic
904452337 1:30621841-30621863 CTACAAACACAGGGAGTGGGTGG + Intergenic
905396802 1:37671752-37671774 CTCCAGAGAGAGAGAGTCGGGGG - Intergenic
906687561 1:47772317-47772339 CTCCAAGCAGAGAGAGGAGCAGG + Intronic
909707082 1:78598374-78598396 ATCCAAACAGAGAGAAAGAAAGG + Intergenic
909849805 1:80446472-80446494 CTCCAAGCAGGGAGATTGTAGGG - Intergenic
911807069 1:102223597-102223619 CTACAAAGGGAGAGAGTGGTAGG + Intergenic
913315064 1:117542842-117542864 GTGCAAACAGTGAGTGTGGATGG + Intergenic
914448895 1:147773455-147773477 CACAAAAGAGAGAGAGGGGAGGG - Intergenic
916787916 1:168099467-168099489 CGCCAAACAGAGTCGGTGGAAGG - Intronic
917473390 1:175345164-175345186 CACCAAAAAAAGAGAGAGGAAGG + Intronic
917761242 1:178160800-178160822 CTCCAACCAGAGAAGGGGGATGG + Intronic
917855062 1:179093000-179093022 CTCCAAAAAGAGAGAAAGCACGG + Intronic
917926076 1:179790152-179790174 CTCCAAGCCTAGAGACTGGAGGG + Intronic
918469525 1:184857144-184857166 CTTCCAACAGATAGAGTGCAAGG + Intronic
918473503 1:184899385-184899407 ATAGAAACAGAGAGACTGGAGGG - Intronic
919287706 1:195585483-195585505 CTCAGAACAGAGAGAGAGAAAGG + Intergenic
920087128 1:203425662-203425684 CTCTATACAAAGAGAGGGGAGGG + Intergenic
920667326 1:207972570-207972592 CTCCAAACAGAGAGGGAGTGGGG - Intergenic
921331436 1:214042223-214042245 TTCCAAGAAGAGACAGTGGAAGG - Intergenic
922963382 1:229667063-229667085 CTCAAAACCCAGAGAGTGGTGGG + Intergenic
923226099 1:231940172-231940194 CCACACACAGAGAGAGGGGAAGG - Intronic
923544809 1:234916453-234916475 CCACAAAAAGAGAGAGTGAATGG + Intergenic
923563486 1:235059473-235059495 ATCCAGACAGAGAGCGGGGATGG - Intergenic
924185566 1:241485759-241485781 CACCACTCAGAAAGAGTGGAGGG - Intergenic
924484688 1:244469744-244469766 CTTGAAACAGAAAAAGTGGAAGG + Intronic
1063150098 10:3328825-3328847 CTTCAAAGAAAGAGAGGGGAAGG - Intergenic
1063888436 10:10603736-10603758 CTCTAAACAGAGACAGAGCAGGG + Intergenic
1070940191 10:80337691-80337713 CTCCAGGCAGAGAGCATGGAAGG - Intronic
1071287412 10:84161849-84161871 CTCCAGAGAGAGAGAGAGCAAGG + Intergenic
1072116423 10:92374472-92374494 CTCCAAAAGGAGGGAGGGGAGGG - Intergenic
1072219700 10:93316941-93316963 CTCTGTACAGATAGAGTGGAAGG - Intronic
1073574984 10:104615062-104615084 CTCTAGACAGAAAGATTGGATGG - Intergenic
1074727970 10:116334090-116334112 CTCCCAAGAGAGATAGAGGAAGG + Intronic
1074864415 10:117536557-117536579 CTCCATCCCGAGAGAGTGCAAGG + Intergenic
1075219963 10:120576336-120576358 CTGCAAAGACAGAGAGAGGAAGG - Intronic
1079105573 11:17570179-17570201 ATCCAAAAGGAGAGAGTGGGAGG - Intronic
1080380513 11:31767165-31767187 CTCCAAAATGAAATAGTGGAGGG - Intronic
1081053325 11:38374398-38374420 TTCCAAAAAGGGAGAGTGGGAGG - Intergenic
1083087616 11:60167035-60167057 ATCCAAATAGAAAGAGAGGAAGG - Intergenic
1084681686 11:70670089-70670111 CTCCCCACAGAGAGACTGGGTGG + Intronic
1085919515 11:80935411-80935433 CTCCCAATAGACAGAGTGGTTGG - Intergenic
1087336873 11:96854523-96854545 CTCCAAAGAGATAGAGGGCAAGG + Intergenic
1088042285 11:105401843-105401865 CAACAAAAAGAGAGAGTTGAAGG - Intergenic
1088850065 11:113697105-113697127 CTCCAAACAGAGAAATGGGCTGG + Intronic
1091278836 11:134370526-134370548 CTCCAGACAGGGAGTGTGGGGGG + Intronic
1092511244 12:9159061-9159083 CTACAAAGAGAGAGAGAGAAAGG + Intronic
1092736015 12:11583711-11583733 AACCAAACAAAGAGAATGGAAGG + Intergenic
1096434628 12:51578497-51578519 TGCCAAACAGGGAGAGAGGACGG - Intergenic
1098014165 12:66086834-66086856 ATCCACACAGAGACAGTGGAAGG + Intergenic
1098165063 12:67687803-67687825 ACTCAAACAGAGAGAGTAGAAGG + Intergenic
1098497131 12:71149574-71149596 CCCCAAACAGAGGGACTGGCTGG + Intronic
1098682160 12:73369880-73369902 CTCCAAAAAGAGAGAGAAGAAGG + Intergenic
1099585553 12:84508424-84508446 CTCCCAACAGGGAGTGTGCAAGG - Intergenic
1099913574 12:88863325-88863347 CTTAAAACTGAGAGAGTGAATGG + Intergenic
1100641486 12:96485721-96485743 CTCAAAAAAAAGAGAGAGGAGGG - Intergenic
1102454179 12:113061268-113061290 CCCCAACCAGAGAGGGAGGAAGG + Intronic
1103199301 12:119073619-119073641 CTCAAAAAAGAGAGAGAGGCCGG - Intronic
1106196664 13:27499812-27499834 CTACTCAGAGAGAGAGTGGAAGG - Intergenic
1107764628 13:43721063-43721085 GTCCAAAAGGAGAGAGTGGTGGG + Intronic
1108103857 13:46987764-46987786 CTCCAACCAGAGGTAGGGGATGG + Intergenic
1108574868 13:51782275-51782297 ATCCCAACAGAGAGTGTGGGAGG + Intronic
1108791525 13:53974051-53974073 CTCCAAACGGAGGGACTGGCTGG - Intergenic
1109360901 13:61293542-61293564 CCCCAAAAAGGGTGAGTGGAAGG - Intergenic
1110354027 13:74545531-74545553 CTCAAGACAGAGTGAGTGGCCGG + Intergenic
1110529054 13:76575325-76575347 CCCCAAACAGAGGGACTGGCTGG + Intergenic
1111031312 13:82603057-82603079 CACAAAAAAGAGAGAGTTGAAGG - Intergenic
1111544977 13:89720639-89720661 CTTCAAACAGAGAAAATGTATGG - Intergenic
1111858817 13:93674873-93674895 CTCCAAAGAAAGACAGTGTAAGG + Intronic
1112372217 13:98803987-98804009 CTTTAAAAAGAGAGACTGGATGG - Intronic
1113464917 13:110506343-110506365 CGAGAAAGAGAGAGAGTGGACGG - Intronic
1113464924 13:110506384-110506406 CGAGAAAGAGAGAGAGTGGACGG - Intronic
1113667838 13:112153289-112153311 CTCCCTAGAGAGAGACTGGAAGG - Intergenic
1113743256 13:112725353-112725375 CTGAGAGCAGAGAGAGTGGAGGG - Intronic
1116662183 14:47724568-47724590 CTCCAAAAAAAGAAAGTGCAAGG - Intergenic
1117705504 14:58463080-58463102 CTCCAGACAGAGGAAGTGGCAGG - Intronic
1117759832 14:59015226-59015248 CTCCAAGCAGAGAGCTTGGGTGG + Intergenic
1119128977 14:72154489-72154511 CCCCAAACAGAGGGACTGGCTGG - Intronic
1119765635 14:77185853-77185875 CTCCACACAGAGCCACTGGAAGG + Intronic
1120613828 14:86676648-86676670 ATTCAAACAAAGTGAGTGGAAGG - Intergenic
1121316500 14:92964156-92964178 CTCCAAACAGAAAGATTTGGGGG + Intronic
1121683796 14:95816773-95816795 GAAGAAACAGAGAGAGTGGAAGG - Intergenic
1121941062 14:98071224-98071246 CACCCACCAGAGAGACTGGAGGG - Intergenic
1122758687 14:104003594-104003616 GTCCAAGGAGAGAGAGTGAAGGG - Intronic
1122944063 14:104997316-104997338 ATCCAAACACAGAGAGGGGAGGG + Intronic
1123786890 15:23683537-23683559 CTCTAAATAGAAAGACTGGAGGG - Intergenic
1123843263 15:24270166-24270188 CCCCACACAGAGGGAGCGGAGGG - Intergenic
1123970346 15:25502716-25502738 CTCCACAAAGAAAGAGTGGGAGG - Intergenic
1124653981 15:31493970-31493992 CTCAAAGCAGAGAGGGAGGAGGG + Intronic
1125534658 15:40436302-40436324 CTCCAGAGGGAGAGCGTGGAGGG - Intergenic
1126639167 15:50807303-50807325 CTCGAAAGAGAGAGAGAGGAAGG - Intergenic
1128812147 15:70580528-70580550 CTTCAAAAAGAGAGAAGGGAGGG - Intergenic
1128908188 15:71487241-71487263 CTCCAAACAGAGAGATAAGTTGG - Intronic
1129396412 15:75251075-75251097 ATCCAAAAAGAGAGTGTGGGTGG - Intergenic
1129762804 15:78140757-78140779 TTCCAAACAGAAAGAAGGGAAGG - Intronic
1131721061 15:95169476-95169498 CTCAAATAAGAGGGAGTGGAGGG + Intergenic
1133596077 16:7294123-7294145 GTCGAAACACAGAGAGTGGGTGG + Intronic
1133724005 16:8520825-8520847 CTCAAAAAAGACAGAGAGGAAGG + Intergenic
1133923884 16:10179318-10179340 CTCCAAACCCAGAGCATGGAGGG - Intronic
1135718985 16:24798623-24798645 CTCCAAACCAAGACAGTAGATGG + Intronic
1135736428 16:24935177-24935199 CTCCAAACAGAGCGAGGGCTTGG + Intronic
1135995030 16:27241365-27241387 CTCCCGACAGACAGGGTGGACGG + Intronic
1137037619 16:35579830-35579852 CTCCAGCCCGGGAGAGTGGATGG + Intergenic
1138247488 16:55478669-55478691 ATGGAAACAGAGACAGTGGAAGG - Intronic
1140118975 16:72067036-72067058 CCCAAAACTGAGAGAGGGGAAGG + Intronic
1140945897 16:79768200-79768222 GGGCAAACAGAGGGAGTGGAGGG + Intergenic
1141888890 16:86913186-86913208 CAACACACAGAGAGAGGGGATGG + Intergenic
1142740632 17:1930018-1930040 CTCCAGCCAGAGAGATTGGAGGG - Intergenic
1142937054 17:3343468-3343490 CTCCAAAATGAGATATTGGATGG - Intergenic
1143233735 17:5379965-5379987 CTCCAATAAGAGGGAATGGATGG - Intronic
1145233005 17:21188614-21188636 TTCAAAACAGAGAGCGTGAATGG + Intronic
1145830198 17:27909948-27909970 AAACAAACAGAGAGAGTGGGAGG + Intergenic
1146405443 17:32532796-32532818 CACCAAACAATGGGAGTGGAGGG - Intronic
1146536361 17:33656248-33656270 CTCCAAAAAGAGAGAGAGAGAGG + Intronic
1149471205 17:56916558-56916580 CACCAAAAAGAGAGAGAGGAAGG + Intergenic
1149967957 17:61186674-61186696 CTCTAAACAGAGAAACTGGGTGG - Intronic
1150960659 17:69908806-69908828 CTGGCAACAGAGAGAGTGGTGGG - Intergenic
1155354960 18:24943156-24943178 CACCAAACAGAGAGACTCAAAGG - Intergenic
1156562792 18:38147612-38147634 CTCAGCACTGAGAGAGTGGAGGG - Intergenic
1156955076 18:42952547-42952569 CCCCAAAAAAAGAGCGTGGAAGG + Intronic
1157791095 18:50531924-50531946 CTCCTAACACAGGCAGTGGAAGG - Intergenic
1157880853 18:51319839-51319861 CTGGAGACAGAGAGAGTGAAGGG + Intergenic
1158046344 18:53159918-53159940 CTCCACACAGGAAGAATGGAAGG + Intronic
1159964140 18:74579392-74579414 CTCCAAAAAGAAAGAAGGGAAGG - Intronic
1160168462 18:76532850-76532872 CTGCAAATAGGGAGAGTGGCAGG + Intergenic
1160257962 18:77263657-77263679 ATCCAGGCAGAGAGAGTAGAGGG - Intronic
1163190210 19:15672189-15672211 CTCCAAAAAGAGGGACTGAAGGG - Intergenic
1163202963 19:15781245-15781267 CTCCAAAAAGAGGGACTGAAGGG + Intergenic
1164326489 19:24197266-24197288 CCCCAAACAGAGGGACTGGCTGG - Intergenic
1164705273 19:30314815-30314837 CTCCACCCAGAGAAAGGGGAGGG - Intronic
1164826868 19:31290375-31290397 GTGCAAACAGAGAGAGGAGATGG + Intronic
1165050576 19:33139075-33139097 CTCCATCCACAGAGACTGGATGG + Intronic
1165452688 19:35893838-35893860 CTTGAAAGTGAGAGAGTGGATGG + Intronic
1166267268 19:41691980-41692002 CTCCCCAGAGAGAGAGAGGAAGG - Intronic
1167539110 19:50074186-50074208 CTCCAGGCAGAAAGAGAGGAAGG + Intergenic
1167834478 19:52056420-52056442 CCCCAAACAGAGAGACCAGATGG + Intronic
926163434 2:10503673-10503695 TTCCAAACAGAGGTAGCGGAAGG + Intergenic
927326157 2:21807743-21807765 CCTGAAACAGAGAAAGTGGAGGG - Intergenic
927576876 2:24207818-24207840 CTGCAAAGGGAGAGGGTGGATGG + Intronic
929396617 2:41531139-41531161 ATCCAAAAAGAGTGAATGGAAGG + Intergenic
931286285 2:60834688-60834710 CTCCATCCAGAGAGAGCAGAGGG + Intergenic
931849853 2:66241549-66241571 CTTAAAACAGAGAGAGTCAAAGG + Intergenic
932297839 2:70641765-70641787 TTCCAAGCACAGATAGTGGAGGG - Intronic
932538682 2:72627684-72627706 CTCCAAAAAGAGAGATTGCATGG - Intronic
933031924 2:77339090-77339112 CTCCAAAAAGAGGGAATGAAGGG + Intronic
934220522 2:90078072-90078094 CCCCATACAGAGACAGGGGAAGG + Intergenic
934721557 2:96581026-96581048 CTCAAAACAGAGAGTCTGCAGGG - Intergenic
934756107 2:96825867-96825889 CTCCAGCCTGAGAGACTGGAGGG + Intronic
934888402 2:98045117-98045139 CTCCTCACAGAGTGAGTGCAAGG + Intergenic
935461049 2:103334845-103334867 CTCCATACAGAGACAGAGGGAGG + Intergenic
935585205 2:104794600-104794622 CCCCAAACAGAGAACCTGGATGG - Intergenic
936247755 2:110843365-110843387 CTCCAAACTGTGAAAGTGGCAGG + Intronic
936833692 2:116681023-116681045 TTCCAAACAGACACAGTGGTTGG - Intergenic
937334073 2:121050106-121050128 CTCCAAGGAGAGAGAATGCAAGG - Intergenic
937835734 2:126468781-126468803 CTTCAAGCAGAGGCAGTGGATGG - Intergenic
938100800 2:128496951-128496973 CTCCAAGCCCAGACAGTGGAGGG - Intergenic
939193960 2:138949531-138949553 TTACGAATAGAGAGAGTGGACGG + Intergenic
939659425 2:144869915-144869937 CTCCAAAAGGAAACAGTGGATGG - Intergenic
939659628 2:144872005-144872027 CTCCAAAAGGAAACAGTGGATGG + Intergenic
940939335 2:159540013-159540035 CTCCAAACAGGGATGGAGGAAGG - Intronic
942737840 2:179136329-179136351 CTCCATAAAGAGTTAGTGGACGG - Intronic
943099422 2:183470787-183470809 TTCCAAACAAATAGAGTTGAGGG + Intergenic
944477847 2:200125541-200125563 CCCCATACAGAGACAGAGGAGGG + Intergenic
945400895 2:209381277-209381299 CTGCAAACAGAGAAAAAGGATGG + Intergenic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
945633202 2:212310570-212310592 CTCAAAACAGAGAGATTAGATGG - Intronic
947135974 2:226976950-226976972 CCCCAAACAAACAGGGTGGATGG + Intronic
948348580 2:237319905-237319927 CTCCAACCAAAGAGAGATGAGGG + Intergenic
948585415 2:239015934-239015956 CTCCTAGGAGAGAGAGAGGATGG - Intergenic
949035944 2:241815788-241815810 GCCCACACAGAGAGAGCGGAGGG - Intronic
1169321335 20:4635472-4635494 CTCCAAGCAGAGGGAGCAGAGGG - Intergenic
1171430882 20:25082476-25082498 CTCCACCCAGAGAGTCTGGAAGG - Intergenic
1172009507 20:31838177-31838199 TTCCAGACAGAGAGTGAGGAGGG + Intergenic
1172303997 20:33868780-33868802 CTCCCTCCAGAGAGAGTGGCAGG - Intergenic
1175584945 20:60131766-60131788 CTGGAAACAGAGAGAGAGGACGG + Intergenic
1176008624 20:62880216-62880238 CTCCAAACTGAGAGGGAGGGGGG + Exonic
1178257911 21:31072093-31072115 CTCCTAATAGTGAGAGTAGATGG - Intergenic
1178441541 21:32602545-32602567 CTCCACACAGTGAGAGTCCAGGG - Intronic
1181137805 22:20781283-20781305 CTCTAAGCTGAGAGTGTGGAAGG + Intronic
1182342499 22:29635132-29635154 CTGCAAACACAGAGAAGGGATGG + Intronic
1183642539 22:39101204-39101226 TCCCAAACAGAGAGAAGGGAGGG - Intronic
1184308657 22:43626953-43626975 CCACAAACCGAGAGTGTGGAAGG - Intronic
1184821263 22:46910682-46910704 TTCCAAAAAGAGAGTGGGGAGGG + Intronic
1184837786 22:47034224-47034246 CTCCACACTGAGGGAGGGGAGGG - Intronic
949101919 3:155882-155904 GTACAGACAGAGAGAGTAGAAGG + Intergenic
950526761 3:13528897-13528919 GTTCTAACAGAGAGAGGGGAAGG - Intergenic
951081068 3:18450387-18450409 CCCCAAACAGAGGGACTGGCTGG - Intergenic
951111814 3:18812800-18812822 TTCCAAACAGAGAGGAAGGAAGG - Intergenic
952304092 3:32130130-32130152 CTGCGAACAGGGAGAGTGGGAGG + Intronic
956639435 3:71401801-71401823 CTTCAAACAGACAAAGTGAATGG + Intronic
958756773 3:98259500-98259522 CTCAGAACAGAGAGAGAGAATGG - Intergenic
960316053 3:116178542-116178564 CAACATACAGAGAGAGTAGAAGG + Intronic
961478184 3:127161635-127161657 CTCCAGGCAGAGAGAGGGGCAGG - Intergenic
961641798 3:128369401-128369423 CTCCAAACAGAGCAGCTGGATGG - Intronic
963312906 3:143728383-143728405 TTCCATGCAGGGAGAGTGGATGG + Intronic
963344075 3:144072626-144072648 CTCCAAACAAAGAGACCGGCTGG - Intergenic
964670415 3:159219235-159219257 CTCCAGACAGACAGAATGTATGG - Intronic
966016278 3:175141463-175141485 TTTCAAATAGAGAGAGTAGAGGG + Intronic
966090500 3:176129664-176129686 CACCTACCAGAGAGTGTGGAGGG - Intergenic
967364523 3:188670762-188670784 CTCCAAACTGAAAGGTTGGAAGG + Intronic
968363636 3:198167965-198167987 CTCCAAACAGTGAGATTTGGGGG - Intergenic
969312364 4:6361263-6361285 CACCACACAGAGAGCGTGCAGGG - Intronic
969918879 4:10518070-10518092 CTCCTAACATGGAGAATGGAGGG + Intronic
971048710 4:22835472-22835494 AACAAGACAGAGAGAGTGGAGGG + Intergenic
971507492 4:27382037-27382059 CTTCCAACAGAGAGACTGGCAGG + Intergenic
973549379 4:52017233-52017255 ATCCAATGAGAGGGAGTGGATGG + Exonic
974164700 4:58186176-58186198 CCCCAAACAGAGGGACTGGCTGG - Intergenic
976049203 4:80991190-80991212 CTTCAAAGAGAGAGACTGGGTGG + Intergenic
976374051 4:84324347-84324369 CTGCAAACAGAGAGAGAGAGAGG - Intergenic
977247238 4:94647191-94647213 CAGCTAAAAGAGAGAGTGGAAGG + Intronic
977317880 4:95473985-95474007 CTCCACACAGAGAAAATTGAAGG - Intronic
978467222 4:109021326-109021348 CCCCAAACAGAGGGACTGGCTGG + Intronic
979023160 4:115528670-115528692 TCCCAAACAGATAGAGTAGATGG + Intergenic
979609515 4:122674338-122674360 CTTCAAACAAGGAGAATGGATGG + Intergenic
980626121 4:135376860-135376882 ATTCAAATAGAGAGAGAGGAAGG - Intergenic
981960379 4:150530527-150530549 ATCCCAACTGAGAGAGTTGAGGG - Intronic
982694404 4:158582838-158582860 CTTGCACCAGAGAGAGTGGAGGG - Intronic
983519061 4:168687979-168688001 GTCCAGACACAGAAAGTGGAAGG - Intronic
984941550 4:184936475-184936497 CTCCATACAGAGACAGAGGGAGG - Intergenic
985022299 4:185704699-185704721 CTCAAAACATGGAGAGTTGAGGG - Intronic
985258189 4:188090429-188090451 CACCAAACAGAGAAAGAAGAGGG + Intergenic
985838739 5:2289978-2290000 GTCCCAGCAGACAGAGTGGAAGG + Intergenic
987014202 5:13800778-13800800 CACCAATCAAAGAGATTGGAAGG - Intronic
987302360 5:16607858-16607880 ATAAAAACAGTGAGAGTGGAGGG - Intronic
988202307 5:28083679-28083701 CACCAAACAGCCAGAGTGAAAGG + Intergenic
989309521 5:39998421-39998443 CTCCGGAGTGAGAGAGTGGAAGG - Intergenic
989759319 5:44993510-44993532 CTCCAGACAGAGGGATTGGAAGG + Intergenic
990735473 5:58856255-58856277 CTCCAAACAGAGAGAGTGGAGGG + Exonic
994044658 5:95294421-95294443 CTGCAAACACTGAGAGTGGTGGG - Intergenic
995741716 5:115362959-115362981 CTCCAAACTGATGGGGTGGAAGG - Intergenic
997739375 5:136240201-136240223 CTCTAAACAGAGAGTTTGGGAGG - Intronic
998489036 5:142529859-142529881 GTCCAGACACAAAGAGTGGAAGG + Intergenic
1000203277 5:159032886-159032908 CCCCACACAGAGAGAAGGGAGGG + Intronic
1000393785 5:160751486-160751508 CCCCCAACAGAGAAAGTGAAAGG - Intronic
1001846321 5:174924584-174924606 ATCCAAAAAGAGAGTGTGGGTGG + Intergenic
1004070888 6:12296355-12296377 CTCCGGAGAGAGAGAGAGGAAGG + Exonic
1005099026 6:22149251-22149273 CTCCACAAAGAGACAGTGGGAGG + Intergenic
1007151420 6:39696121-39696143 TTCCAAAAAGGGGGAGTGGAGGG + Intronic
1008557899 6:52692991-52693013 CTTCAGGCAGAGAGAGTGGCTGG + Intergenic
1008645114 6:53505827-53505849 CTCCAAACTCAGACATTGGATGG - Exonic
1010004959 6:70985700-70985722 ATCCAAAAAGAGAGTGTTGATGG - Intergenic
1011867649 6:91850933-91850955 ATGCAGTCAGAGAGAGTGGAAGG - Intergenic
1012391626 6:98747477-98747499 CCTTAGACAGAGAGAGTGGAGGG + Intergenic
1013491135 6:110646979-110647001 CTCCCCACAGAGACAGAGGAGGG + Intronic
1015509784 6:134026887-134026909 TTCCAAAGAGAGAGAGAGAAGGG - Intronic
1015588510 6:134800652-134800674 CTGCATACAGAGAGAAAGGATGG - Intergenic
1016789050 6:148047881-148047903 GTGCAACCAGAGAAAGTGGAAGG + Intergenic
1018431266 6:163724573-163724595 CTCCAAATGGAGAGTGAGGATGG + Intergenic
1019757350 7:2782396-2782418 TTCCAAACACAGAGAGTTGATGG - Intronic
1020871553 7:13636610-13636632 CAGGAAACAGAGAGAGTGAAGGG - Intergenic
1022700142 7:32752706-32752728 CTCTAAAAACAGAGATTGGATGG + Intergenic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1024147563 7:46532881-46532903 CTCCAGAAAGAGAGTGTGGAGGG - Intergenic
1024617554 7:51128492-51128514 CACCAAACACAGAGCGGGGAGGG + Intronic
1024653704 7:51431299-51431321 CTCAAATCAGAGAGACAGGATGG - Intergenic
1026120432 7:67532126-67532148 TTCCAAAGGGAGAAAGTGGAAGG + Intergenic
1027946824 7:84757867-84757889 CTCCAAAGAGAGAAAATGAATGG + Intergenic
1028263631 7:88695299-88695321 CTCACAACAGAGAAAGTAGAAGG - Intergenic
1028713573 7:93938653-93938675 CTGCAACCAAAGAGAGAGGAAGG - Intergenic
1030431099 7:109450219-109450241 CTCCAAACACTGAGTATGGAAGG - Intergenic
1033471823 7:141656936-141656958 CTGGAAACAGAGAGAGAGCACGG + Exonic
1033627433 7:143123980-143124002 CTCCAAACAGAGGGACTGGCTGG - Intergenic
1033822643 7:145152680-145152702 CTCAAAAAAGAAAGACTGGAGGG - Intergenic
1034044043 7:147908635-147908657 CTCCAAACACAGAGAAGGGCTGG + Intronic
1034845783 7:154443148-154443170 ATCCAGACAGAGGGAGTGGCAGG - Intronic
1035178964 7:157075655-157075677 CTCCAAGCAGAGAGAGGGAAAGG - Intergenic
1036906025 8:12709120-12709142 CTCCAAAGAGAGAGAGGTGCAGG - Intergenic
1037129554 8:15391008-15391030 CTCCAAAAAGAGGGAGGGAAGGG + Intergenic
1039215797 8:35269320-35269342 CCCCAGACAGAGAGACAGGAAGG - Intronic
1039781297 8:40788950-40788972 CTACAGAAAGAGAGAGAGGAAGG + Intronic
1040484014 8:47853398-47853420 GACCAAACAGAGAGAGTGATTGG + Intronic
1042810992 8:72824779-72824801 CTGGGAAGAGAGAGAGTGGATGG + Intronic
1045560554 8:103257803-103257825 TTCCTAACAGAGAGAGTTTAAGG - Intergenic
1045726758 8:105182957-105182979 ATCAAAAGAGAGAGAGTGGGAGG - Intronic
1048551263 8:135435779-135435801 CTCAAAACAGAGGAAGTTGATGG - Intergenic
1050162252 9:2731005-2731027 CCACCAACAGTGAGAGTGGAGGG - Intronic
1051244904 9:15100222-15100244 CTAAAGCCAGAGAGAGTGGATGG - Intergenic
1055961578 9:81825635-81825657 CAGCAAGCTGAGAGAGTGGAAGG + Intergenic
1056720453 9:89066829-89066851 CTCCAAGGAGAGAGAGATGAGGG + Intronic
1056938868 9:90938041-90938063 CTCCACACCCTGAGAGTGGAAGG - Intergenic
1057184806 9:93051243-93051265 ATCCAAACACAGGGAGTGGCTGG - Intergenic
1058994013 9:110281941-110281963 CACCAAATAGAGAGAGTGGCAGG + Intergenic
1060418847 9:123453037-123453059 CTCCTAAAAGAGGCAGTGGAGGG + Intronic
1060576243 9:124697541-124697563 TTCCAAGCATAGAGAATGGATGG + Intronic
1186915057 X:14209875-14209897 ATCCAGAAAGAGAGAGTTGATGG + Intergenic
1190018727 X:46852204-46852226 CTCGAAAGAGAGAGAGAGAAAGG + Intronic
1191611144 X:63114805-63114827 CTCCAAGCATAGAGAGATGAAGG + Intergenic
1193928545 X:87522282-87522304 CGCTCAACAGAGAGAGTGGTAGG + Intronic
1194874990 X:99175699-99175721 ATCCAAATAGTGAGAGAGGAAGG + Intergenic
1195492046 X:105481912-105481934 CTCTGAAGAGAGGGAGTGGATGG - Intronic
1195641425 X:107179411-107179433 CTCCAAAAGGAGAGAGTTGGGGG - Intronic
1195987944 X:110651731-110651753 CAACATACAGAGAGAGTGTAAGG + Intergenic
1196799652 X:119531207-119531229 CTCAAAACAGAGAGAAAGGGAGG - Intergenic
1197445661 X:126551056-126551078 CTCCAAGCAGAGAGAGTGAGTGG - Exonic
1197523521 X:127530053-127530075 CTCCATACAGACAGAGATGAGGG + Intergenic
1198218951 X:134582088-134582110 CTCCAAACAGGGAATGGGGAGGG + Intronic
1198417443 X:136434835-136434857 CTCCAAATAGGGTGAGTGGAGGG - Intergenic
1199455800 X:148027259-148027281 CTCCAAGCACACAGAGTGCATGG - Intergenic
1199886627 X:152027326-152027348 CTCAGAACAGAGATAGAGGAGGG + Intergenic
1200393175 X:155964891-155964913 CCCCAAACAGAGGGACTGGCTGG - Intergenic