ID: 990736796

View in Genome Browser
Species Human (GRCh38)
Location 5:58873106-58873128
Sequence CTGTGGGAATGGGGAGGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990736786_990736796 29 Left 990736786 5:58873054-58873076 CCAAATGCCTATCTGTGAATCCA No data
Right 990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG No data
990736789_990736796 9 Left 990736789 5:58873074-58873096 CCAACAGGTGCATCAGAATCACG No data
Right 990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG No data
990736788_990736796 22 Left 990736788 5:58873061-58873083 CCTATCTGTGAATCCAACAGGTG No data
Right 990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990736796 Original CRISPR CTGTGGGAATGGGGAGGAAT AGG Intergenic
No off target data available for this crispr