ID: 990742953

View in Genome Browser
Species Human (GRCh38)
Location 5:58930884-58930906
Sequence ATTTGACAGAAGATGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990742949_990742953 -7 Left 990742949 5:58930868-58930890 CCACACATCTTAGCCTATTTGAC No data
Right 990742953 5:58930884-58930906 ATTTGACAGAAGATGGTGGATGG No data
990742947_990742953 10 Left 990742947 5:58930851-58930873 CCTTCACTGTCCACTCTCCACAC No data
Right 990742953 5:58930884-58930906 ATTTGACAGAAGATGGTGGATGG No data
990742948_990742953 0 Left 990742948 5:58930861-58930883 CCACTCTCCACACATCTTAGCCT No data
Right 990742953 5:58930884-58930906 ATTTGACAGAAGATGGTGGATGG No data
990742946_990742953 27 Left 990742946 5:58930834-58930856 CCTCAAGTTTACTTCTTCCTTCA No data
Right 990742953 5:58930884-58930906 ATTTGACAGAAGATGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990742953 Original CRISPR ATTTGACAGAAGATGGTGGA TGG Intergenic
No off target data available for this crispr