ID: 990744346

View in Genome Browser
Species Human (GRCh38)
Location 5:58943455-58943477
Sequence GATCCAGATGGTGATCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990744341_990744346 29 Left 990744341 5:58943403-58943425 CCTAGTGTCATGGAGTAGGGTAT No data
Right 990744346 5:58943455-58943477 GATCCAGATGGTGATCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990744346 Original CRISPR GATCCAGATGGTGATCCTAC TGG Intergenic
No off target data available for this crispr