ID: 990754439

View in Genome Browser
Species Human (GRCh38)
Location 5:59052746-59052768
Sequence TTCCCTAGAAGGTGGCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990754434_990754439 16 Left 990754434 5:59052707-59052729 CCTCAGTTTTCTTTTTTGTAAAA 0: 3
1: 54
2: 528
3: 3084
4: 10022
Right 990754439 5:59052746-59052768 TTCCCTAGAAGGTGGCCTCCAGG 0: 1
1: 0
2: 2
3: 10
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990754439 Original CRISPR TTCCCTAGAAGGTGGCCTCC AGG Intronic
900605429 1:3521599-3521621 TTGCCTGGGAGGTGGCCCCCAGG + Intronic
902258494 1:15206439-15206461 TTGCCCAGAAAGTGGCCCCCAGG + Intronic
902473960 1:16670728-16670750 TTCCCTGTAAGGTGGCATCTGGG + Intergenic
902484843 1:16736714-16736736 TTCCCTGTAAGGTGGCATCTGGG - Intergenic
903762150 1:25706359-25706381 TTCCCTAGAAGGTACCTCCCAGG - Intronic
904261616 1:29290945-29290967 TGGCCTAGAGGGTGGTCTCCAGG - Intronic
905393393 1:37652326-37652348 TTCCCTAGAAGGTGGTCGCTGGG + Intergenic
912554071 1:110503639-110503661 TTCCCCAAATGGGGGCCTCCTGG + Intergenic
914681834 1:149944179-149944201 TTCCCCAGACAGTGCCCTCCTGG - Exonic
915762592 1:158329984-158330006 TTCCCCAGAAGGTGGCAGCAGGG - Exonic
919830336 1:201536456-201536478 CCACCGAGAAGGTGGCCTCCAGG - Intergenic
920230221 1:204465308-204465330 TTCTCTTAAAGGTGGGCTCCCGG - Exonic
920831415 1:209469188-209469210 TTCCCTGGTATGTGGCCTCCAGG - Intergenic
922520837 1:226250671-226250693 CTCCCAAGAAGGTGGACTACAGG + Intronic
923618061 1:235554215-235554237 TTCCTTAGAAGGTGGCAGCAAGG - Intronic
1063944834 10:11165949-11165971 CTGCCTAGAAAGTGACCTCCCGG - Intronic
1067208738 10:44241417-44241439 TTCCCTGGAACTTGGGCTCCTGG - Intergenic
1067452236 10:46388899-46388921 CTCCTTAGAAGTTGGCCGCCAGG - Intronic
1067585001 10:47470856-47470878 CTCCTTAGAAGTTGGCCGCCAGG + Intronic
1067986456 10:51151921-51151943 TTCCTTAGCAAGTGGCTTCCAGG - Intronic
1069055051 10:63836165-63836187 TTCCCTAGAAGATTTGCTCCTGG - Intergenic
1072528247 10:96294059-96294081 TTCCCTTCAAGGTGGTATCCGGG + Intergenic
1072867801 10:99082619-99082641 TTCACTAGAACGTTGGCTCCAGG + Intronic
1080535172 11:33214524-33214546 CTGCCCAGAATGTGGCCTCCTGG - Intergenic
1081597667 11:44470288-44470310 TTCCCTAAACAGTGACCTCCTGG + Intergenic
1081814732 11:45932215-45932237 TTCCCTCGGAGGTGTCCCCCAGG + Intronic
1083730242 11:64648840-64648862 TGCCCAAGCTGGTGGCCTCCCGG - Exonic
1084180421 11:67443208-67443230 GTCCCTGGAAGTTGGGCTCCTGG - Intronic
1084519550 11:69655126-69655148 TGTCCTATAAGGCGGCCTCCAGG - Intronic
1087261959 11:96021888-96021910 TTGCCTTGAAGCTGGGCTCCAGG + Intronic
1088700603 11:112407914-112407936 TATCCAAGAAGCTGGCCTCCTGG - Intergenic
1088811191 11:113393806-113393828 TTCACTTGAGGGTTGCCTCCAGG + Intronic
1090363740 11:126189959-126189981 CTCCCTAGGAGGTGGGCACCTGG + Intergenic
1091559064 12:1596613-1596635 TTCTCTAGAAGTTGGCCATCTGG + Intronic
1095875419 12:47075553-47075575 TTCCCTAAAAGGACACCTCCTGG + Intergenic
1105318695 13:19294631-19294653 TTCCCGAGAAAGTTGCCTCTGGG + Intergenic
1105489375 13:20872859-20872881 TTCCCTAAAAGTTTTCCTCCAGG + Intronic
1106347196 13:28890818-28890840 TGCCCTAGACCGAGGCCTCCAGG + Intronic
1108041289 13:46341389-46341411 TTCCCTAACAGGTGCCTTCCTGG + Intergenic
1112432205 13:99359858-99359880 TTCCCTGCATGGTGGCCTGCAGG + Intronic
1112972580 13:105278979-105279001 TTCCCCACAGGCTGGCCTCCCGG + Intergenic
1117817162 14:59610168-59610190 TTCTTGAGCAGGTGGCCTCCTGG - Intronic
1119960223 14:78847553-78847575 TTCCCTAGGAAGTGGCATACTGG - Intronic
1122401346 14:101469368-101469390 TTCCCTGTGAGGTGGCCGCCAGG + Intergenic
1124431457 15:29612293-29612315 TTTCCTTGAAGCTGGCCCCCAGG + Intergenic
1125556183 15:40587045-40587067 CTCCCTAGTAGGTGGACTACAGG - Intergenic
1128171791 15:65519826-65519848 TCCCCGAGGAGGTTGCCTCCAGG - Intergenic
1129510146 15:76115657-76115679 CACCCAAGAAGGTGGCCTCCCGG - Intronic
1132011099 15:98277280-98277302 TTCCCTACAAACTGTCCTCCTGG - Intergenic
1133284964 16:4686477-4686499 TCCCCCAGAAAGTGGCCTCCTGG + Intronic
1133985017 16:10661864-10661886 TATCCTAGAAGGTGACTTCCAGG + Intronic
1134016926 16:10895313-10895335 GCCCCTAGAAGGTGGCTACCTGG + Exonic
1135052685 16:19205244-19205266 TTCCCTGGTCAGTGGCCTCCTGG + Intronic
1136001061 16:27293113-27293135 TTCCCGAGTAGCTGGCCTACAGG + Intergenic
1136463073 16:30424073-30424095 GCCTCTAGAAGGTAGCCTCCTGG - Exonic
1139366281 16:66435436-66435458 TTCCCTACAAGGAAGCCTTCTGG - Intronic
1143009594 17:3858648-3858670 GTCCCTGGAGGGTGGCATCCTGG + Intergenic
1146621406 17:34401342-34401364 TGACCAAGAGGGTGGCCTCCAGG - Intergenic
1147342489 17:39762024-39762046 TTCCTCAGACCGTGGCCTCCTGG + Intergenic
1149790901 17:59476142-59476164 TTCTCTAGCAGGTGGTCTCAAGG - Intergenic
1153503415 18:5771134-5771156 TTTCCTGGAGGGTGGCATCCAGG - Intergenic
1157804594 18:50648816-50648838 TGCCCTGGGAGGTGGCCTCATGG + Intronic
1160087874 18:75796026-75796048 CTCCCTATAAGGTTGCCTCTAGG + Intergenic
1160508627 18:79441148-79441170 TTCCCTAGGACATGGCCTCAGGG - Intronic
1160998290 19:1895408-1895430 GACCCTGGAAGGAGGCCTCCCGG - Intergenic
1161152268 19:2716203-2716225 TGCCCGGGAAGGTGGCGTCCTGG - Exonic
1202706156 1_KI270713v1_random:25803-25825 TTCCCTGTAAGGTGGCATCTGGG + Intergenic
927043793 2:19256468-19256490 TGCCCTAGAAGCTGCCCTTCAGG + Intergenic
927284724 2:21344979-21345001 GTCCATACAAGCTGGCCTCCAGG - Intergenic
931443830 2:62310065-62310087 TTCCTTGGAGGGTGGGCTCCAGG + Intergenic
932280037 2:70482878-70482900 TGACCTAGAAGGGGGACTCCTGG - Intronic
932475828 2:72005235-72005257 TTCCCTAGACTGTGGCTGCCTGG + Intergenic
933994161 2:87655666-87655688 TTACCTGGAAGTTGGCCTCAGGG + Intergenic
934476672 2:94598356-94598378 TGCCCTTGGAGCTGGCCTCCTGG + Intronic
934520985 2:95020157-95020179 TTCTCTAGAAGGTGGATTCCTGG + Intergenic
935274676 2:101465857-101465879 TTCCCTTAAAGGTGGCCCCAAGG - Intronic
935334364 2:102001403-102001425 CTCCCTGCAACGTGGCCTCCAGG + Intronic
935563802 2:104585684-104585706 TTCCCTGGAATGTGCCCTCTTGG + Intergenic
936066461 2:109336190-109336212 GTGCCTAGAAGCTGGCCTGCAGG + Intronic
936299701 2:111295247-111295269 TTACCTGGAAGTTGGCCTCGGGG - Intergenic
937026307 2:118700470-118700492 TTCACCAGGATGTGGCCTCCTGG - Intergenic
942019104 2:171849065-171849087 TTCCCTAGTAGCTGGACTACAGG - Intronic
943235450 2:185312924-185312946 TTCCCCAGAATTTGGCCTTCAGG - Intergenic
944398887 2:199302735-199302757 TTCCCTGGAAGATGTCCTTCAGG + Intronic
946161742 2:217839863-217839885 TGGCCCAGCAGGTGGCCTCCCGG - Intronic
948464495 2:238145731-238145753 TCCCCCTGAAGGAGGCCTCCTGG + Exonic
948541261 2:238692840-238692862 TTCCATAGACGGTGGTCTCTGGG - Intergenic
948612219 2:239177080-239177102 TTCCCTCGAAGGTGGACACTTGG + Intronic
1168983203 20:2025387-2025409 TTCCCCAGAAGTAGGGCTCCTGG + Intergenic
1169787244 20:9372147-9372169 GTGCCTGGAAGTTGGCCTCCTGG + Intronic
1171993196 20:31712678-31712700 TTCCCTAGAGACTGGCCTCCTGG - Intronic
1172891934 20:38271644-38271666 CTCACCAGAAGGTGGGCTCCTGG - Intronic
1179124767 21:38581054-38581076 TTCCCAAGAAGATGAACTCCAGG + Intronic
1180096562 21:45557993-45558015 TCCCCAAATAGGTGGCCTCCTGG - Intergenic
1181801351 22:25349561-25349583 TTCCCTGGAAAGAGTCCTCCTGG + Intergenic
1182811337 22:33119416-33119438 TTCCCTATAAAGTGGCATCTGGG + Intergenic
1183118982 22:35714839-35714861 CTCCACTGAAGGTGGCCTCCTGG + Intergenic
1183303647 22:37070638-37070660 ATCCCCAGACTGTGGCCTCCAGG - Exonic
1183754764 22:39750034-39750056 TTCTCTAAAAGCTGGCCTTCCGG - Intronic
1185201647 22:49509734-49509756 TTCCCCAGAATGTGGCTTTCAGG + Intronic
1185336316 22:50272209-50272231 TCTCCTGGAAGATGGCCTCCAGG - Intergenic
951866137 3:27310420-27310442 TACACTAGAAAGTGGCTTCCCGG + Intronic
953137040 3:40190184-40190206 TTCCCGAGAAGTTGGGCACCAGG + Exonic
953938722 3:47071091-47071113 TTCCCAAGTAGCTGGCCTACAGG + Intronic
954380477 3:50216378-50216400 TTCCCAAGGAGTTGGCCTCAGGG + Intronic
954433274 3:50482685-50482707 CTCCTTAGACTGTGGCCTCCAGG + Intronic
955088351 3:55724823-55724845 TTCCCAAGATGTTGGCCACCAGG - Intronic
964623004 3:158734019-158734041 TTGCCTAGAAGGTGTGCTCCAGG - Intronic
966185370 3:177222087-177222109 TTCCCAAGAAGGTGGCATTTAGG - Intergenic
966321856 3:178710083-178710105 ATCCCTGGCAGGTAGCCTCCAGG + Intronic
967015435 3:185477489-185477511 TTCCCTATAAGGTGGCTGCCAGG - Intronic
969710715 4:8841403-8841425 GTCCCCAGACTGTGGCCTCCAGG - Intergenic
969828281 4:9775421-9775443 TTCCCTGGAAGCAGACCTCCTGG - Intronic
976225111 4:82789759-82789781 TTCCCTGGAATGTGGGCTCGTGG + Intronic
977775564 4:100915426-100915448 TTCCCAAGAAGCTGGACTACAGG + Intergenic
980669286 4:135983203-135983225 TTCACTAGAAAGTTGCCTGCAGG + Intergenic
980669411 4:135984828-135984850 TTCACTAGAAAGTTGCCTGCAGG + Intergenic
984366378 4:178804650-178804672 ATGCCTAGAAAGTTGCCTCCAGG - Intergenic
985795956 5:1962263-1962285 TTTCCTAGAAGGCGCCCACCTGG + Intergenic
986006682 5:3674078-3674100 TACCGGAGAAGGTGGCATCCAGG - Intergenic
990754439 5:59052746-59052768 TTCCCTAGAAGGTGGCCTCCAGG + Intronic
991200726 5:63988338-63988360 TTCCACAGAAGTTGGCTTCCTGG + Intergenic
993103760 5:83574492-83574514 TTCCCTAGAATTTGGCTTTCAGG + Intronic
994109059 5:95980356-95980378 TTCACTAGAAGATGGCCTCCAGG - Intergenic
995040080 5:107577677-107577699 TTCTCTAGAAGCAGGCCTTCTGG - Intronic
997282135 5:132656107-132656129 TGCCCTGGAGGGTGGTCTCCAGG - Intergenic
997863852 5:137443786-137443808 TTCTCTCTAAGCTGGCCTCCAGG + Intronic
1001889960 5:175330536-175330558 ATCCCCAGAAGGTGGCCTTTGGG - Intergenic
1002188759 5:177468206-177468228 TACCCTAGAAGGGGGCTTGCAGG - Exonic
1010758806 6:79698639-79698661 GTCTCTAGATGGTGGCCTGCAGG + Intronic
1011027153 6:82881489-82881511 TCCCCTTGAAGGTGGTATCCAGG - Intergenic
1013771213 6:113630109-113630131 TTCCCTAGAGGATGGTCCCCTGG - Intergenic
1018081894 6:160266320-160266342 TTCCCTTGAGGGTGGCTTTCAGG - Intronic
1019110711 6:169710322-169710344 TTCCCTGGAAAGAGTCCTCCTGG + Exonic
1021539035 7:21736511-21736533 TTGCCTTGAATGTGGGCTCCTGG + Intronic
1021699920 7:23308155-23308177 TACCCTAGATGATGCCCTCCTGG + Intronic
1023575704 7:41624019-41624041 TTCCCCAGAAGGTTGCCTTTTGG + Intergenic
1023767152 7:43522411-43522433 TTCCCAAGACAGTTGCCTCCTGG + Intronic
1024632623 7:51262197-51262219 TTCTCGAGGATGTGGCCTCCTGG - Intronic
1028491105 7:91413353-91413375 TTCCCTAGAATCTGGCTTTCAGG + Intergenic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1031665373 7:124476799-124476821 TACCCTGGAAGGTGCCATCCTGG + Intergenic
1032320816 7:130885068-130885090 TTCCCTAGCAGGTCGCATCAGGG - Intergenic
1036695201 8:10969770-10969792 TTCCATATACTGTGGCCTCCTGG - Intronic
1037200929 8:16251165-16251187 GTCCCTAAAAGGTGCCTTCCCGG + Intronic
1037401290 8:18497535-18497557 TTCCCTAGGAGGTGTGATCCCGG - Intergenic
1038193868 8:25348501-25348523 CTCCCTAGAAGGTGGGCTCCTGG - Intronic
1038695918 8:29806094-29806116 TTACCTAGATGGTGGCATTCAGG - Intergenic
1039392954 8:37196531-37196553 TTTCCCAGAAGGAGGCCTCTTGG - Intergenic
1052736166 9:32344769-32344791 TTCCTGAGCAGGGGGCCTCCAGG - Intergenic
1052853358 9:33391549-33391571 TGCCCTTGGAGCTGGCCTCCTGG - Intronic
1053681390 9:40487721-40487743 TGCCCTTGGAGCTGGCCTCCTGG - Intergenic
1053931379 9:43116051-43116073 TGCCCTTGGAGCTGGCCTCCTGG - Intergenic
1054282323 9:63137213-63137235 TGCCCTTGGAGCTGGCCTCCTGG + Intergenic
1054294479 9:63323237-63323259 TGCCCTTGGAGCTGGCCTCCTGG - Intergenic
1054392500 9:64627725-64627747 TGCCCTTGGAGCTGGCCTCCTGG - Intergenic
1054427148 9:65132934-65132956 TGCCCTTGGAGCTGGCCTCCTGG - Intergenic
1054503227 9:65888605-65888627 TGCCCTTGGAGCTGGCCTCCTGG + Intronic
1055753760 9:79535031-79535053 TTCCCTAGAACATGGCCACATGG - Intergenic
1055927944 9:81530066-81530088 CGCCCTGGAAGCTGGCCTCCAGG - Intergenic
1058327349 9:103715323-103715345 TGCCCTAGAAGGCAGCCTCCTGG + Intergenic
1058474445 9:105317568-105317590 TTCACTAGAAGATGGGCTCCTGG - Intronic
1061746767 9:132745806-132745828 ATCCGTACAAGGTGGCCACCAGG + Intronic
1062409987 9:136418734-136418756 TCACCTGGAAGGTGGCCTCATGG - Intronic
1190331232 X:49236593-49236615 CTCCCTAGATGTTGGCATCCTGG - Intronic
1191605511 X:63057911-63057933 TTCCCTCGAAGCTGCCCGCCTGG - Intergenic
1194083552 X:89498629-89498651 TTCCCTAAAGGGTGAGCTCCAGG - Intergenic
1198272178 X:135065328-135065350 GTCCCTATAAGGTGGCATCTGGG - Intergenic
1200330666 X:155293193-155293215 TTCCCTGGAAAGAGTCCTCCTGG - Intronic