ID: 990755380

View in Genome Browser
Species Human (GRCh38)
Location 5:59063590-59063612
Sequence TTTTGAGATGGGTCAGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990755375_990755380 17 Left 990755375 5:59063550-59063572 CCAACAGTCTAAGTGTTAATCAG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 990755380 5:59063590-59063612 TTTTGAGATGGGTCAGGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990755380 Original CRISPR TTTTGAGATGGGTCAGGGCC AGG Intronic
901108443 1:6776106-6776128 TCTTGAGATGGGGCTGGGCGTGG + Intergenic
901429612 1:9205204-9205226 AATTGAGATGGGTGGGGGCCAGG - Intergenic
902777660 1:18684925-18684947 TTTAGAAATGGGTCAGCTCCTGG + Intronic
905250999 1:36648287-36648309 CTTTGAGCTGGGTTAGGGCCTGG + Intergenic
907088082 1:51696977-51696999 TTTAGAGATGGGTGTGGGGCTGG - Intronic
908321112 1:62979865-62979887 TTATGAGATTGGTGAGGGTCAGG + Intergenic
910009812 1:82447746-82447768 TATTGAGATTGATCAGGACCAGG + Intergenic
910705839 1:90128827-90128849 TTTGGAGAAGTGTCAGTGCCAGG + Intergenic
911090240 1:94011910-94011932 GCTGGAGATGGCTCAGGGCCTGG - Intronic
914198953 1:145467413-145467435 TCTTGAGCTGGGTCAGTTCCTGG + Intergenic
914377656 1:147086368-147086390 TCTTGAGCTGGGTCAGTTCCTGG + Intergenic
914502787 1:148262274-148262296 TCTTGAGCTGGGTCAGTTCCTGG - Intergenic
914511516 1:148336385-148336407 TCTTGAGCTGGGTCAGTTCCTGG + Intergenic
914951422 1:152118341-152118363 AGTTGAGCTGAGTCAGGGCCTGG - Intergenic
916610629 1:166388039-166388061 TGGTGAGAGGGGTCACGGCCTGG + Intergenic
917649356 1:177061496-177061518 TTTTTCGATGGGTGAGAGCCTGG - Intronic
918287305 1:183069986-183070008 GTTTGAGATGGCACAGTGCCCGG + Intronic
919814086 1:201426755-201426777 TTCTGAGAGGGGGCAGGGCTGGG + Intronic
921053363 1:211526686-211526708 CTATGAGATGGGCCAGGGCTGGG + Intergenic
922027474 1:221764102-221764124 TTAAGAGATGGGACCGGGCCAGG - Intergenic
922200165 1:223394258-223394280 TCTTGAGACGGGTCAGCACCAGG - Exonic
923319701 1:232818952-232818974 TTTTGGGAAGGGTCAGGACGGGG - Intergenic
923954522 1:239000398-239000420 TTTTGGGTAGGGTCAGGGGCAGG + Intergenic
1066471036 10:35698445-35698467 TTTAAAGATGTTTCAGGGCCAGG - Intergenic
1069172605 10:65252790-65252812 TTTTGAGCTGTGTCATTGCCAGG - Intergenic
1070294181 10:75145111-75145133 TGTTGAGATGGTGCAGGGGCAGG + Intronic
1070414339 10:76175673-76175695 TTCTCTGATGAGTCAGGGCCAGG - Intronic
1070798002 10:79228412-79228434 TTTGGAGTTGGGGCAGGCCCAGG - Intronic
1072538023 10:96377981-96378003 CTGTGAGATGGGCCCGGGCCAGG - Intronic
1074680785 10:115904895-115904917 TTTTGATATTGCTCAGTGCCAGG + Intronic
1074718792 10:116247126-116247148 TTCTGAGATGGGGCAGGGGTCGG - Intronic
1076466042 10:130682211-130682233 ACTTGAGATGGGTCAGAGCATGG + Intergenic
1077429181 11:2507564-2507586 TTCTGACATGGGTCAGGGTTGGG + Intronic
1078853682 11:15188394-15188416 AATTCAGAGGGGTCAGGGCCCGG + Intronic
1078909335 11:15716679-15716701 TTTGGAACTGGGGCAGGGCCAGG - Intergenic
1079122506 11:17695890-17695912 CTTAGAGAGGGGCCAGGGCCGGG + Intergenic
1081072749 11:38630892-38630914 TTTTGAGAGGGGTCCGGAACAGG + Intergenic
1081415862 11:42814849-42814871 TTATGACATTGGTCAGGGCAAGG + Intergenic
1083344434 11:61979484-61979506 TTGTGAGATGGGGCAGGGCAGGG - Intergenic
1083344687 11:61981046-61981068 TTGTGAGATGCGGCAGGGCAGGG - Intergenic
1084175031 11:67418574-67418596 TTTTGGGATGTGGCTGGGCCAGG - Intronic
1084397583 11:68923576-68923598 TTTTGAGATGTGTTAGGGTCTGG + Intronic
1087774501 11:102245055-102245077 GTTTCAGCTGGGACAGGGCCAGG - Intergenic
1087889102 11:103516745-103516767 TTCTGAGATGGGACCTGGCCGGG + Intergenic
1088675892 11:112192940-112192962 TTTTGACAGGGGTAAGGGTCAGG + Intronic
1091240330 11:134047718-134047740 GTGTGTGATGAGTCAGGGCCCGG - Intergenic
1092354032 12:7779681-7779703 TTTTTAGATGGTTAAGGGCCAGG + Intergenic
1096977850 12:55709683-55709705 TTTTGAGCTGGGTCGGGGGCGGG - Intronic
1098802453 12:74978960-74978982 TTTTGAGATGAGTAAGGCCATGG + Intergenic
1103779726 12:123390140-123390162 ATTTGAGAGGGGTCAGGCTCCGG + Intronic
1103851056 12:123934034-123934056 TTTTGAGATGGCTTAAGGACTGG + Intronic
1109019186 13:57063211-57063233 TTTTAAGAAGGGTCAGGTCAGGG + Intergenic
1109857623 13:68153810-68153832 TTTTGTAATGGGGCAGGGCATGG - Intergenic
1110329251 13:74252007-74252029 TGTTGGGATGGGTCTGGGACAGG + Intergenic
1112763967 13:102720909-102720931 TTTTAAGATGGGACTGGGACTGG + Intergenic
1118836085 14:69478927-69478949 TTTTGAGTGCGGACAGGGCCAGG + Intergenic
1121150701 14:91631366-91631388 TTTTGTGAAGATTCAGGGCCGGG + Intronic
1123922762 15:25082073-25082095 ATTTGAGATGGGGCTGGGCACGG + Intergenic
1124633583 15:31351070-31351092 TTCTGAGTTGGGCCAAGGCCTGG + Intronic
1125590090 15:40848949-40848971 TTTTGAAATGGGGTCGGGCCGGG + Intronic
1126752791 15:51894376-51894398 TTTTGAGATGGGACAGTGGCAGG - Intronic
1127790322 15:62392581-62392603 CTTTGTGATGGGACAGGGCACGG + Intronic
1128811087 15:70573270-70573292 TGTTGAGACTGGTCAGCGCCTGG - Intergenic
1129246553 15:74282459-74282481 TTTTGAGGTGTGACAGGGACTGG - Intronic
1129456749 15:75680151-75680173 GTCTAAGATGGGGCAGGGCCTGG + Intronic
1129787616 15:78320068-78320090 TTTCGAGATGGGGAAGGGACAGG + Intergenic
1130312765 15:82769547-82769569 TTTTGAGATGAGTCCCGCCCAGG - Intronic
1130542039 15:84827261-84827283 TATTGTAATGGGTCTGGGCCAGG + Intronic
1130644866 15:85715585-85715607 TTGTCAGATGGGTCAGTACCAGG + Intronic
1130644883 15:85715720-85715742 TTGTCAGATGGGTCAGTACCAGG + Intronic
1131161326 15:90106799-90106821 GTTTGACATGGGGCATGGCCGGG + Intergenic
1131975022 15:97935690-97935712 CTTTCAGATGGGTCAGTGCGGGG - Intergenic
1133394348 16:5434019-5434041 TTTTGAGTTGGGGTAGGGGCGGG + Intergenic
1137514101 16:49127595-49127617 GTGTGAGATGGGGCAGGGCAGGG + Intergenic
1137632572 16:49957225-49957247 TTTGGAGATGGGTGAGAGTCCGG - Intergenic
1138571321 16:57875303-57875325 TTATGAGAAGATTCAGGGCCAGG - Intergenic
1139486163 16:67257677-67257699 TTCTGAGAAGGGACAGAGCCAGG + Intronic
1142932334 17:3297514-3297536 ATATGAGATGGGGCAGGACCAGG - Intergenic
1143870223 17:9952686-9952708 TTTTGAAAAGTGTCTGGGCCGGG - Intronic
1144143789 17:12377281-12377303 ATTTGAGATGGGAATGGGCCTGG - Intergenic
1145998143 17:29116106-29116128 TTTTCAGATGGCTCAGCTCCGGG + Intronic
1149492024 17:57091893-57091915 TCTTGAAATGGGTCTGGGCAAGG - Intronic
1151285488 17:73107994-73108016 TCTTGAGATGGGGCCGGGCGTGG + Intergenic
1151732383 17:75919200-75919222 TTTTAAGACTGCTCAGGGCCGGG - Intronic
1151784270 17:76267522-76267544 TTTTGAGAAAGGCCAGGGCAGGG + Intronic
1152938883 17:83155294-83155316 GTCTGAGCTGGGGCAGGGCCAGG - Intergenic
1153120852 18:1725034-1725056 AATTGAGATGGGTCAGAGCTAGG + Intergenic
1154009206 18:10560912-10560934 TTTTGTCACGGCTCAGGGCCAGG - Intergenic
1154974483 18:21443719-21443741 ATTTGATATGGGACGGGGCCTGG - Intronic
1156455681 18:37292397-37292419 ATGTGAGATGGCTCAGGGCAAGG + Intronic
1158968879 18:62647817-62647839 TTAAGAGATGGAACAGGGCCAGG + Intergenic
1159036815 18:63285545-63285567 ATATGAGATGGGTCACTGCCGGG + Intronic
1160553439 18:79711002-79711024 TATTGGGATGGGGCAGAGCCTGG - Intronic
1162081154 19:8218619-8218641 TCTTGAGATGGGGAAGGGACAGG + Intronic
1162371706 19:10283863-10283885 TTTTGAGATGGGTGTGGCCCCGG + Intronic
1163989567 19:20985817-20985839 TCTTGAGATGGGACAAGGGCTGG + Intergenic
1165202336 19:34155282-34155304 GTGTGAGATGGGTGAGGGTCAGG - Intergenic
1165825698 19:38704648-38704670 TTTTGAGTTGGGTCAGGAGAAGG + Intronic
1165849117 19:38838928-38838950 TGTTGAGGTGGGTAATGGCCCGG + Exonic
1167414892 19:49364813-49364835 GTGGGAGATGGTTCAGGGCCAGG + Intronic
1168692255 19:58384306-58384328 GTTTGGGATGCGGCAGGGCCAGG + Intergenic
926369290 2:12163901-12163923 TTCTGAGATCGGTCGGGGACAGG - Intergenic
926627134 2:15101571-15101593 CTTTGAGTTGGGGCAGGGGCAGG + Intergenic
932012766 2:67994655-67994677 TTCTGAGATGGGGCAGGCCCTGG - Intergenic
933863901 2:86498703-86498725 TTCTGAGATGGTTCAGTGGCTGG + Intergenic
934713991 2:96532743-96532765 GTTTGGGCTGGGTGAGGGCCAGG - Intergenic
937159692 2:119748230-119748252 TTTTGAGATGGCTCACCGCATGG - Intergenic
937450373 2:121997523-121997545 TTTTGAGATGTGACAGGTCATGG + Intergenic
943295678 2:186135165-186135187 TTAGGAGTTGGGTCTGGGCCTGG + Intergenic
943855858 2:192789280-192789302 CTTTGAAATGGGCTAGGGCCAGG + Intergenic
944440661 2:199740277-199740299 TTTTGAGATGGAGCAGGGCCTGG + Intergenic
944827612 2:203501306-203501328 TTATCAGATGGGGCAGTGCCTGG + Intronic
948874153 2:240818485-240818507 GTGTGGGATGGGCCAGGGCCAGG - Intronic
948990660 2:241552266-241552288 TTCTGAGTTGGATCAGAGCCTGG - Intergenic
1169194564 20:3676210-3676232 TTTTGAGCTGGGGAAGGGACAGG - Intronic
1169752733 20:9011298-9011320 TTATGAGATCAGGCAGGGCCTGG + Intergenic
1170136152 20:13075685-13075707 TTTGGAGATGGGGCAGAGACTGG + Intronic
1170266999 20:14478218-14478240 TCTTGAGTTGGGGCAAGGCCTGG + Intronic
1172571978 20:35977678-35977700 TTTTGGGATGGGTTGGGGGCAGG - Intronic
1172947983 20:38703306-38703328 TTATGACATGGGTCAGATCCTGG - Intergenic
1173134578 20:40427972-40427994 TTTAGGGATGGGTCTGGGCATGG + Intergenic
1177874880 21:26619800-26619822 TCTTGAGATGGGCAAGGGCCAGG - Intergenic
1178294623 21:31398853-31398875 GTTTGAGAAGAGTCAGAGCCTGG - Intronic
1179521466 21:41948325-41948347 TTGTGAGCTGGGGCAGAGCCAGG - Intronic
1181484891 22:23224418-23224440 CTTTGAGATGGCTCAGAGCAAGG - Intronic
1181781506 22:25196913-25196935 TTGTAAGATGGGGCAGGGCGTGG + Exonic
1182631144 22:31686399-31686421 TTTAAAGATGAGTCAGGGCTGGG - Intronic
1182845614 22:33428606-33428628 TTTTAAGATAGGACAAGGCCAGG - Intronic
1182897289 22:33869276-33869298 TGTTGTTTTGGGTCAGGGCCTGG - Intronic
1183019508 22:35015920-35015942 GTTAGAGCTGGGTCAGAGCCTGG + Intergenic
1183715562 22:39531429-39531451 TTTTGACATGTGTCAGGACGTGG - Intronic
1184638236 22:45853128-45853150 TTTTGCGAGGGGGCAGGGCAGGG - Intergenic
1184766830 22:46576718-46576740 TCTAGAGATGGGTCAGGGACTGG - Intronic
949510606 3:4763746-4763768 TTATGAGATGAGACAGGGCCAGG - Intronic
952003408 3:28811231-28811253 TTCTGATATGGGAGAGGGCCAGG - Intergenic
952572258 3:34731696-34731718 TCTTGGGATGGGGCAGGGGCGGG + Intergenic
955475417 3:59331103-59331125 TTGTTAGATGGGTCAGGGGAGGG - Intergenic
955851721 3:63227151-63227173 TTTTGGGAGGGGCTAGGGCCGGG + Intergenic
956271354 3:67450774-67450796 TTCTGGGATGGGCCAAGGCCTGG - Intronic
962343898 3:134606145-134606167 TTGTGAGATGGAACAGGACCAGG - Intronic
966875396 3:184318898-184318920 TTTTTAGTTGAGACAGGGCCAGG - Intronic
967691431 3:192478356-192478378 TTTGGAGTTGGGCCAGGGGCTGG - Intronic
967887352 3:194342186-194342208 TCTTCAGATGGGTCAGAGGCTGG + Exonic
969268216 4:6080056-6080078 TGCTGAGCTGGGTCAGGGTCAGG - Intronic
969993943 4:11292561-11292583 TTCAGAGATGGGACAAGGCCCGG - Intergenic
971847847 4:31943924-31943946 ATTTGAAATTGGTAAGGGCCAGG - Intergenic
972880462 4:43416744-43416766 ATTTGAGAGGGGTCAGGGGCAGG - Intergenic
974518884 4:62955183-62955205 TTTAGAGATGGGTCTTGCCCAGG + Intergenic
979199359 4:117958406-117958428 TTTTCAGATGGTTCAGTCCCCGG - Intergenic
979838172 4:125400819-125400841 TTTTGAGATGAGACAGAGTCGGG + Intronic
982105566 4:152009074-152009096 ATTTGAGATGGTTCTGGGCAAGG - Intergenic
982201936 4:152970056-152970078 TTTCGAGGTAGGTCAGGGTCAGG + Intronic
982304653 4:153917878-153917900 TTTTCAGAGGGGTCAGCACCAGG + Intergenic
983088095 4:163472243-163472265 TTTTGAGATTGGCCAGGCCAAGG - Exonic
985384195 4:189428264-189428286 TTTTCAGATGCTTCAGGGCAAGG + Intergenic
988170828 5:27653093-27653115 TTTTGGGAAGGGCCAGGGGCAGG + Intergenic
988647397 5:33109184-33109206 ATTTGGGAGGGGTCAGGGGCAGG + Intergenic
989111063 5:37906981-37907003 TTTTGAGCAGGGTCAGGGGTTGG + Intergenic
990755380 5:59063590-59063612 TTTTGAGATGGGTCAGGGCCAGG + Intronic
990974247 5:61543822-61543844 GGTTGAGATGGGTCATGGCCAGG - Exonic
991959084 5:72023672-72023694 TCTTGAGATAGGTCAGGCCAAGG - Intergenic
994871470 5:105355122-105355144 TCTTGAGATGGGTCAGACCATGG + Intergenic
995050330 5:107696285-107696307 CTCTGGGATTGGTCAGGGCCAGG - Intergenic
995768107 5:115640523-115640545 CTTCTAGTTGGGTCAGGGCCTGG + Intergenic
995934841 5:117498076-117498098 TTTTTCACTGGGTCAGGGCCAGG + Intergenic
998526073 5:142844516-142844538 ATTTCAGAGGGTTCAGGGCCAGG + Intronic
999370781 5:151053944-151053966 CTTTGAGCTGGGCCAGGACCAGG + Intronic
1001859246 5:175038841-175038863 TTTGGATGAGGGTCAGGGCCAGG + Intergenic
1002086208 5:176777153-176777175 TATTTGGATGGGGCAGGGCCTGG - Intergenic
1003638956 6:7860474-7860496 TTTTATGATAGGTCAGTGCCAGG - Intronic
1007314472 6:40975032-40975054 TCTTGATTTGGCTCAGGGCCTGG + Intergenic
1007523795 6:42473400-42473422 TTTTGAGATGGCGTCGGGCCGGG + Intergenic
1008794637 6:55287692-55287714 TTTTGCTATTGCTCAGGGCCTGG - Intergenic
1008896336 6:56560539-56560561 TGTTGTGGTGGGTGAGGGCCTGG + Intronic
1010539946 6:77080701-77080723 TTATGAGATTGGTCTGGGCAAGG + Intergenic
1015549988 6:134402161-134402183 ATTTGTGATGGGTCTGGGCAGGG + Intergenic
1015602748 6:134926494-134926516 TTTTAAGAAGGGTCCTGGCCAGG - Intronic
1020049705 7:5073236-5073258 TTTTGGGATGGGCCCGTGCCTGG + Intergenic
1021996015 7:26178967-26178989 GTCTGAGAAGGGTCAGGGCATGG - Intronic
1023242949 7:38168454-38168476 TTGTAAGATGGCTCTGGGCCAGG - Intergenic
1023496603 7:40804551-40804573 TTCTGAGAAGGGTAATGGCCCGG - Intronic
1023857851 7:44196031-44196053 TTTTGTGATGTGTCAGTGCTGGG + Intronic
1024357241 7:48426618-48426640 CTTGGAGAGGGGCCAGGGCCAGG + Intronic
1026290926 7:69005369-69005391 TTTTGAGATGTCTCTGGGGCTGG - Intergenic
1026689313 7:72538422-72538444 ATTTGAGAGTGATCAGGGCCGGG + Intergenic
1027290553 7:76705139-76705161 TTTTGGGAAGGGTCAGGACAAGG + Intergenic
1028483494 7:91333610-91333632 GTTTCATATGGGTCAGGGACTGG - Intergenic
1029269084 7:99365758-99365780 GTTTCAGGTGGGGCAGGGCCAGG + Intronic
1029986031 7:104924126-104924148 TGTTGAGAAGGGTCTGGGCGTGG - Intergenic
1034333485 7:150304675-150304697 TTTTGAGATGGGGCAGTGCATGG - Intronic
1034409562 7:150932888-150932910 TTTTGAAATGGGGCTGGGCACGG + Intergenic
1034664558 7:152805215-152805237 TTTTGAGATGGGGCAGTGCATGG + Intronic
1035985896 8:4431551-4431573 TTTTGAAATGGGGCCGGGGCTGG - Intronic
1036212735 8:6855295-6855317 TTGTGAGATGGAGCATGGCCCGG - Intergenic
1037291022 8:17349541-17349563 TTGTGTGATGTGTCAGGGTCAGG - Intronic
1040677400 8:49766766-49766788 ATTTGAGAGGGGTCAGGGTTTGG + Intergenic
1041693609 8:60714119-60714141 TTCCGGGATGGGTCAGCGCCCGG + Intronic
1041865380 8:62567284-62567306 TTCTTAGACTGGTCAGGGCCGGG + Intronic
1042131532 8:65591492-65591514 TTTTAAGATATGTCAGGGCCAGG + Intergenic
1044830038 8:96238320-96238342 ATTTGTAATTGGTCAGGGCCAGG - Intergenic
1045713538 8:105014831-105014853 TTTAGAGATCCGTCAGTGCCTGG + Intronic
1046851116 8:118973972-118973994 TCCTGAAATGGGACAGGGCCAGG - Intergenic
1048107396 8:131426889-131426911 ATTTGAGAGGGGCCAGGGGCAGG - Intergenic
1049413013 8:142481809-142481831 CTATGACATGGGTTAGGGCCTGG - Intronic
1051418038 9:16863201-16863223 TATTGAGATGGGGCAGGGCGTGG - Intronic
1051506887 9:17837439-17837461 TTTAGAGATGGATCAGGGTTAGG + Intergenic
1052036127 9:23683113-23683135 TTTTGAGATGAGTCACATCCAGG + Intergenic
1052803793 9:32994337-32994359 ACTTGAGATGGATCAGGGCAGGG - Intronic
1052900894 9:33794161-33794183 TGTTGAGATCGGACATGGCCAGG - Intronic
1053123985 9:35564787-35564809 TCTGGGGCTGGGTCAGGGCCAGG + Intergenic
1053244563 9:36523889-36523911 TTAAGAAATGGGTTAGGGCCAGG - Intergenic
1055417867 9:76103734-76103756 CTTTGATCTGGCTCAGGGCCTGG + Intronic
1056132858 9:83602777-83602799 TTTAGAGATGGGCCAGCACCAGG + Intergenic
1056306676 9:85297699-85297721 TTTTGAGATGGCTCAGAGATAGG + Intergenic
1056591772 9:87970369-87970391 TTTCGAGCTGGGTAGGGGCCAGG - Intronic
1057190387 9:93083984-93084006 GCTGGAGATGGGACAGGGCCAGG + Intronic
1057241655 9:93416896-93416918 AGGAGAGATGGGTCAGGGCCCGG + Intergenic
1060103709 9:120860785-120860807 TTTTCAGATGGGCTAGGGCAAGG + Intronic
1060149563 9:121279578-121279600 TGTTGAGGAGGGTGAGGGCCTGG + Intronic
1061196230 9:129108575-129108597 CTTTGAGATGGGGCAGGGGTGGG + Intronic
1062500810 9:136851253-136851275 TTGCGAGAGGAGTCAGGGCCTGG + Intronic
1185726104 X:2423115-2423137 TTTTTAAATGAGCCAGGGCCAGG + Intronic
1186840994 X:13484564-13484586 TGCTGAGATGGGTCAGGACGTGG - Intergenic
1190286784 X:48966745-48966767 CCTTGAGGTGGGTCGGGGCCTGG - Exonic
1190329385 X:49226376-49226398 TTCTGGGCTGGGTCAGGGGCTGG + Intronic
1190330588 X:49233006-49233028 TTTGGATAGGGGTCAGAGCCAGG + Intronic
1190741507 X:53291845-53291867 TTGGGAGATGGGGCAGGGCCTGG - Intronic
1196720502 X:118849258-118849280 TGTTGAGATGTCTCAGGGCTTGG - Intergenic
1198278547 X:135120097-135120119 TTTGGGGATGAGGCAGGGCCAGG - Intergenic
1198292414 X:135252419-135252441 TTTGGGGATGAGGCAGGGCCAGG + Intronic
1198400243 X:136261896-136261918 TTTTGAGTTGGGACAGGATCAGG - Intergenic
1198587373 X:138137449-138137471 TTATGAGATGCCTCAGAGCCAGG - Intergenic