ID: 990762843

View in Genome Browser
Species Human (GRCh38)
Location 5:59149636-59149658
Sequence CTGGTTCTCCGTGGTTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990762836_990762843 6 Left 990762836 5:59149607-59149629 CCTTAAGATTTTAGTGTTGGTTC 0: 1
1: 0
2: 1
3: 22
4: 235
Right 990762843 5:59149636-59149658 CTGGTTCTCCGTGGTTATATGGG 0: 1
1: 0
2: 0
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990762843 Original CRISPR CTGGTTCTCCGTGGTTATAT GGG Intronic
908430371 1:64050752-64050774 GTGTTTCTCCGTGGTTTTCTAGG + Intronic
913678756 1:121168267-121168289 CTGGTTCTCATAGGTTCTATTGG - Exonic
914030588 1:143955913-143955935 CTGGTTCTCATAGGTTCTATTGG - Exonic
914158860 1:145112049-145112071 CTGGTTCTCATAGGTTCTATTGG + Exonic
919504764 1:198385207-198385229 CAGGTTCAACTTGGTTATATGGG + Intergenic
920466054 1:206186803-206186825 CTGGTTCTCATAGGTTCTATTGG - Exonic
924729550 1:246698810-246698832 GTGGTTCTCTGTGCCTATATTGG + Intergenic
1068541705 10:58302062-58302084 CTGGTCCTCAGGGATTATATAGG - Intergenic
1073961337 10:108933018-108933040 CTAGTTATCAGTGTTTATATTGG + Intergenic
1075536693 10:123277545-123277567 CTGGTTCTGCGGGGTTTTATTGG + Intergenic
1083181080 11:60986017-60986039 CAGTTTCTCCATGGTTAAATGGG - Intronic
1086859786 11:91911834-91911856 CTGGTTTTCCATTCTTATATAGG + Intergenic
1089064248 11:115650433-115650455 CAATTTCTCCCTGGTTATATGGG + Intergenic
1090160277 11:124485604-124485626 ATGCTTCTCTGTGCTTATATTGG - Intergenic
1093758894 12:22882857-22882879 CTGGGTCTCCGTAGTAGTATGGG + Intergenic
1094207375 12:27854646-27854668 CTGGTTCTGTGGGGTTATTTTGG + Intergenic
1096628715 12:52911716-52911738 CTTGTTCTCCATCGTTATACTGG - Intronic
1100239373 12:92695906-92695928 CTGGTTCTTCTTGGTGATTTAGG - Intergenic
1101205018 12:102478104-102478126 CTGGTTCTCTGTGGGTGTACTGG - Intronic
1108051842 13:46452146-46452168 GTGTTTCTCCATGGGTATATAGG + Intergenic
1110689976 13:78421604-78421626 CTGGATATATGTGGTTATATAGG - Intergenic
1116923762 14:50611105-50611127 CTGGATCTCAGTGGTCATCTTGG + Intronic
1130474771 15:84254856-84254878 CTGGTTTTCCGTGGTTTTCATGG + Intergenic
1130482187 15:84368912-84368934 CTGGTTTTCCGTGGTTTTCATGG + Intergenic
1133467569 16:6042416-6042438 AAGGTTCTCCGTGATTATACTGG + Intronic
1139127712 16:64100025-64100047 CTTGTTCTCCGTGGATACATAGG + Intergenic
1142669175 17:1479610-1479632 CTGGTTCTCGGTGGTGACCTGGG + Exonic
1145095265 17:20019876-20019898 CTTCTTTTCCGTGGTTTTATTGG + Intronic
1148844323 17:50519891-50519913 CTGTTTCTCTGTGGTTCTCTGGG + Intronic
1152192301 17:78896278-78896300 CTGTTTCTCCTTGGTCATCTTGG - Intronic
1154255504 18:12777816-12777838 GTGGGTCTCCGGGGTTTTATGGG - Intergenic
1155920295 18:31596817-31596839 CTTGTTCTCCGTATTTATCTGGG - Intronic
1163134098 19:15296849-15296871 CTGTTTCTCCCTGGTTCTCTAGG + Intronic
926946967 2:18198900-18198922 CTGGTTCACCGTGGATAGAATGG + Intronic
945104718 2:206299372-206299394 CTGGCCCTCTGTGGTTATTTTGG - Intronic
948867992 2:240784986-240785008 CACCTTCTCCGTGGTGATATTGG + Exonic
1173944230 20:46937591-46937613 CTGTTTCTCCTTGGTTTTCTGGG + Intronic
1185000165 22:48240607-48240629 GTGATTTTCCGTAGTTATATAGG + Intergenic
953758656 3:45669160-45669182 CTGGCTCTCTGAGGTTATTTTGG + Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
965112534 3:164446355-164446377 CTGGTTATCTGTGTTTATGTGGG + Intergenic
968666424 4:1824750-1824772 CTGGAGCTCCGTGGGGATATGGG - Intronic
971323389 4:25623561-25623583 CTGGTTCTCTTTGGGTATCTGGG - Intergenic
971771679 4:30905375-30905397 CTGGAACTCCATGGTTCTATAGG + Intronic
981410543 4:144425238-144425260 CTGTTTCTCTGTGTTCATATAGG - Intergenic
985079652 4:186251943-186251965 CTTGTTCTCCTTGGTTAGAAGGG + Intronic
988259800 5:28871122-28871144 GTGGTTCTCAGTGGTTAGAGTGG - Intergenic
990762843 5:59149636-59149658 CTGGTTCTCCGTGGTTATATGGG + Intronic
994975629 5:106800844-106800866 CTGCTTCTCCCTGATTATTTGGG + Intergenic
1001128123 5:169039181-169039203 CTGTTTCTTTGTGGTTATCTTGG - Intronic
1005268668 6:24140162-24140184 CTGCTTCTCCGAGGTTACAAAGG - Intronic
1008581484 6:52912170-52912192 GTGGTTTTCTGTGGTTATTTAGG + Intergenic
1013625933 6:111936982-111937004 CTAGTTCTCTGTAGTTATAGTGG + Intergenic
1014796796 6:125734409-125734431 CTGTTTCTCTGTGGTTTTCTAGG + Intergenic
1016298535 6:142602647-142602669 CTGGTTTTATGTGGTTATCTTGG - Intergenic
1019615773 7:1959841-1959863 CTGGTTCTCCGTGCAGATCTGGG - Intronic
1020405556 7:7829800-7829822 CTGGATCTCCTTGGTCACATAGG + Intronic
1022379931 7:29850519-29850541 CTGGTTCTTTGTGGTTACACAGG + Intronic
1023042245 7:36181915-36181937 CTGGTTTTCACTGGTGATATTGG - Intronic
1038580647 8:28746416-28746438 TTGGTTCTCTGGGGTGATATAGG + Intronic
1042340293 8:67671780-67671802 CTGGTTCTCCAAAGTTATTTTGG - Intronic
1046709240 8:117490974-117490996 CTGCTTCTCTGTTGGTATATAGG - Intergenic
1047781480 8:128115139-128115161 CTGATTCTCCGTGGCTCTTTTGG + Intergenic
1049813142 8:144585295-144585317 CAGGTTCTCTGTGGTGATTTGGG - Intronic
1053346399 9:37381642-37381664 CTGGTTCTCCTTGTTTCTAGGGG - Intergenic
1056392508 9:86152847-86152869 CTGGGTCTCCTTGATTATAGAGG + Intergenic
1056791459 9:89627853-89627875 CTGGTTCTCAGTTGTGACATTGG + Intergenic
1187833335 X:23405225-23405247 CTGGTTTTCCCTGGGTATTTAGG + Intergenic
1196167848 X:112555198-112555220 CTGTTTCTAGTTGGTTATATTGG - Intergenic
1196934728 X:120718374-120718396 CTTGTTCTGAGTGGTTACATGGG + Intergenic
1198439264 X:136646140-136646162 CTTGTTCTCCATGGTTTCATTGG - Intergenic
1202376214 Y:24240024-24240046 CTGGTTTTCCGTGGTTTTCATGG - Intergenic
1202494566 Y:25430094-25430116 CTGGTTTTCCGTGGTTTTCATGG + Intergenic