ID: 990766304

View in Genome Browser
Species Human (GRCh38)
Location 5:59187432-59187454
Sequence CAATAGAAACAGATTAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990766302_990766304 28 Left 990766302 5:59187381-59187403 CCTTCAATGATTAAGATAAAAAT 0: 1
1: 0
2: 3
3: 50
4: 586
Right 990766304 5:59187432-59187454 CAATAGAAACAGATTAACCTGGG 0: 1
1: 0
2: 2
3: 16
4: 236
990766300_990766304 30 Left 990766300 5:59187379-59187401 CCCCTTCAATGATTAAGATAAAA 0: 1
1: 0
2: 0
3: 35
4: 394
Right 990766304 5:59187432-59187454 CAATAGAAACAGATTAACCTGGG 0: 1
1: 0
2: 2
3: 16
4: 236
990766301_990766304 29 Left 990766301 5:59187380-59187402 CCCTTCAATGATTAAGATAAAAA 0: 1
1: 0
2: 1
3: 54
4: 594
Right 990766304 5:59187432-59187454 CAATAGAAACAGATTAACCTGGG 0: 1
1: 0
2: 2
3: 16
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990766304 Original CRISPR CAATAGAAACAGATTAACCT GGG Intronic
902308117 1:15559030-15559052 CAAGAGAATCAGTTGAACCTGGG - Intronic
903115002 1:21171879-21171901 AAATAGAAGTAGATTTACCTTGG - Intronic
903291977 1:22319748-22319770 CAAAAGAAACTGATGACCCTGGG + Intergenic
904547937 1:31291193-31291215 CAAGAGAAACACGTGAACCTGGG + Intronic
904908458 1:33915874-33915896 CTTTAGTATCAGATTAACCTGGG + Intronic
906061109 1:42949153-42949175 GAATAGAATCACTTTAACCTGGG + Intronic
906804020 1:48762301-48762323 AAAAAGAAACAGATTATCTTAGG - Intronic
907235547 1:53043129-53043151 CAAAAGAAACAGCCAAACCTGGG + Intronic
909990498 1:82217422-82217444 TAAAAGAAAAAAATTAACCTGGG + Intergenic
910470760 1:87550268-87550290 CAAGACAAACAGTTCAACCTGGG - Intergenic
911955479 1:104228490-104228512 GAATAGAATCATATCAACCTAGG - Intergenic
918193736 1:182201585-182201607 CAAAAGAATCACATGAACCTGGG + Intergenic
918866115 1:189902678-189902700 AACTAGAAACAGATTCAACTGGG - Intergenic
921173192 1:212566994-212567016 TCACATAAACAGATTAACCTAGG + Intronic
921819957 1:219605974-219605996 AAAAAGAAACAGATTCCCCTTGG + Intergenic
921952040 1:220940276-220940298 CCATAGACACAGATGAACCATGG - Intergenic
1063269646 10:4493596-4493618 CAACAGCATCAGAATAACCTGGG - Intergenic
1063693649 10:8311858-8311880 CATTAGAAACACATTAACCTTGG + Intergenic
1064812615 10:19217623-19217645 CAAGAGAATCAGTTGAACCTGGG - Intronic
1066323255 10:34327112-34327134 CAATAGAAACTGATTTATCATGG + Intronic
1066574694 10:36812536-36812558 CAAGAGAAACACTTGAACCTGGG + Intergenic
1067367665 10:45649523-45649545 CAATAGGAAAATATTAAACTTGG + Intronic
1068198671 10:53752915-53752937 AAAAAGAAACACATTATCCTGGG + Intergenic
1074792001 10:116898669-116898691 AAATAGAAACAGAATAAATTAGG + Intronic
1077864818 11:6213430-6213452 CAATAGAAAAAGATTAACTTTGG - Intronic
1078205240 11:9223445-9223467 CAAGAGAAACACTTGAACCTGGG + Intronic
1078437552 11:11338058-11338080 CAAGAGAATCATTTTAACCTGGG - Intronic
1079119026 11:17665236-17665258 CAATAAAAAGAGATTAAAATTGG + Intergenic
1079214166 11:18491578-18491600 CAAAAGATACAGATTAAAATAGG - Intronic
1081004218 11:37714081-37714103 CAAAACACACACATTAACCTAGG + Intergenic
1081108518 11:39102323-39102345 CAATAAAAACAGATGGACCTAGG - Intergenic
1082557502 11:54580231-54580253 CAATAGAAAAAGCCTCACCTAGG - Intergenic
1083692305 11:64417344-64417366 CAAGAGAATCACTTTAACCTGGG - Intergenic
1083919133 11:65771540-65771562 CAATACAAGCAGAATAACCAAGG + Intergenic
1084999592 11:73018617-73018639 CATTAGAAACAGAGTAATGTAGG - Intronic
1085499670 11:77008273-77008295 CATTAAAAACAGAATAAACTGGG - Intronic
1087137540 11:94736010-94736032 CCATAGAAACAGATTATACAGGG - Intronic
1089713446 11:120335022-120335044 GAATAGAAGCAGATTAGCCAAGG - Intergenic
1095265482 12:40151897-40151919 CAATACAAACTGTTTAAGCTAGG + Intergenic
1095368632 12:41439518-41439540 GAATATAAACAGCTTAACCTAGG - Intronic
1098374250 12:69796583-69796605 CAATTAAAACAGGTTAACATTGG - Intronic
1100754927 12:97740840-97740862 CAATACAAGCAGAGGAACCTGGG + Intergenic
1100992225 12:100264075-100264097 CAATAAAAACAGAGTAAACCTGG + Intronic
1102960664 12:117091382-117091404 TAAGACAAACAGAATAACCTGGG - Intronic
1108995680 13:56731402-56731424 TCATAGAAACAGTTAAACCTTGG - Intergenic
1109745602 13:66619673-66619695 CTATGGAGTCAGATTAACCTAGG - Intronic
1111211068 13:85081064-85081086 CAATAGAAAACTAATAACCTGGG + Intergenic
1111223304 13:85235567-85235589 CAAAAGACACAGAATAACCAAGG + Intergenic
1116980797 14:51168036-51168058 CAATAGACTCAGATTAACACTGG + Intergenic
1117022613 14:51587054-51587076 CCATAGAAAAAGATGAACTTGGG - Intronic
1117905612 14:60582715-60582737 CCATAGTAACAGAGTAACCATGG + Intergenic
1118142673 14:63101799-63101821 CACTTGAAACAGATTAATCAGGG - Intronic
1119894781 14:78210820-78210842 CAATAAAATCAGATTTACCACGG - Intergenic
1121068750 14:90996171-90996193 CAAAAAAAACAAATTAGCCTGGG - Intronic
1122095304 14:99366256-99366278 AAATACAAAAAGATTAGCCTGGG - Intergenic
1123891052 15:24780061-24780083 CAGTAGAATCAGTTGAACCTGGG - Intergenic
1123983838 15:25626720-25626742 CAATAAAAACAGATTGGCCTGGG + Intergenic
1126781680 15:52144422-52144444 AACTAGAAACATATTACCCTAGG + Intronic
1129812566 15:78522784-78522806 CATTAGAATCAGTTGAACCTTGG + Intronic
1132315604 15:100888189-100888211 CAAGAGAATCATTTTAACCTGGG - Intronic
1132795156 16:1716964-1716986 CAGGAGAAACAGTTGAACCTGGG + Intronic
1133892577 16:9894662-9894684 AAATAAAAACAGCTTAACTTAGG - Intronic
1134814384 16:17193983-17194005 CAAGAGACACAGAGTGACCTGGG + Intronic
1135280312 16:21148667-21148689 CTGTAGAAACAAATTAAACTAGG + Intronic
1135477518 16:22789896-22789918 AAATAGAAAAAAATTAACCCGGG + Intergenic
1136472687 16:30492341-30492363 CAAGAGAATCAGTTGAACCTGGG - Intronic
1138136086 16:54523903-54523925 AAATCGAAACAAATTAATCTAGG - Intergenic
1138835031 16:60423808-60423830 CAATCTAAACACCTTAACCTAGG + Intergenic
1138837074 16:60450415-60450437 TAATAAAAACAGCTCAACCTTGG - Intergenic
1141089394 16:81119913-81119935 CAATAGAATCACTTGAACCTGGG - Intergenic
1142821176 17:2468670-2468692 CAAGAGTTCCAGATTAACCTGGG + Intronic
1143630130 17:8134213-8134235 CTATAGAAATAAATTAAGCTTGG + Intergenic
1144181663 17:12757787-12757809 CAATACAAACAGATCAGGCTAGG - Intronic
1145068911 17:19786411-19786433 GAATAAAAACAGGTTAAACTAGG + Intronic
1147704096 17:42414194-42414216 GAATGAAAACAGATTAATCTGGG - Intronic
1153833176 18:8940925-8940947 CCATAGAAACAGTTTTCCCTGGG + Intergenic
1155617158 18:27735518-27735540 CAACAGAAACATATTAATCATGG - Intergenic
1156085910 18:33402316-33402338 CAAGAAAAACAGATAAATCTTGG + Intronic
1156797282 18:41061731-41061753 ACATAGAAAAACATTAACCTTGG - Intergenic
1156846059 18:41666285-41666307 CAAGAAAAAGAGATTAATCTGGG - Intergenic
1158039815 18:53079383-53079405 ATATAGAAACAGATGACCCTTGG + Intronic
1158299059 18:56032204-56032226 CCATAGATACACATTTACCTAGG - Intergenic
1161587328 19:5112765-5112787 CAGAAGAGACAGATTCACCTTGG - Intronic
1164563184 19:29308153-29308175 CAAGAGAATCAGTTGAACCTGGG - Intergenic
1165188824 19:34045002-34045024 CAAAAGAATCATATGAACCTGGG + Intergenic
1165727035 19:38120111-38120133 CAAGAGATACTTATTAACCTTGG + Intronic
1166537958 19:43587235-43587257 CAAGAGAATCAGTTGAACCTGGG + Exonic
1166935837 19:46332031-46332053 CACTAGAATCAGACTGACCTGGG + Intronic
1167999934 19:53437223-53437245 CAAAAGAAACACTTGAACCTGGG + Intronic
925542658 2:4982712-4982734 AAATAGAAATAGAATAACCAGGG + Intergenic
927128714 2:20038516-20038538 CAAGAGAATCACATGAACCTGGG - Intronic
928687609 2:33765006-33765028 CACTGGAGACAGATTCACCTTGG + Intergenic
931140319 2:59450812-59450834 CTATACTAACAAATTAACCTTGG - Intergenic
931781501 2:65582666-65582688 CAATGGATACATATTAATCTGGG + Intergenic
932782167 2:74566568-74566590 CAAGAGAAACAGACAAAGCTAGG + Intronic
934707675 2:96496154-96496176 CAATTGAAACTGATTATGCTTGG + Intergenic
935464740 2:103382901-103382923 CAATAGAGATAGATTACCATTGG + Intergenic
935482667 2:103612764-103612786 TAAGAGGAACAAATTAACCTTGG - Intergenic
935942189 2:108251839-108251861 CAATGGAAAAAAATTAACATAGG + Intronic
937991750 2:127666357-127666379 CAAGAAAAACAGATGAATCTTGG + Intronic
938052546 2:128188111-128188133 CATGAGAAACACATGAACCTGGG - Intronic
939488446 2:142846928-142846950 CAAGAGATACAGAGTAACTTAGG + Intergenic
939534837 2:143415262-143415284 CAATAGAAATAGATTATCATAGG + Intronic
939906591 2:147923530-147923552 TAATAGAAACCCTTTAACCTGGG - Intronic
940314633 2:152314946-152314968 CAATAGAATCACTTGAACCTGGG - Intergenic
944725068 2:202462803-202462825 CAAGAGAATCACATGAACCTGGG - Intronic
944822244 2:203442562-203442584 CTCTGGAAACACATTAACCTCGG - Exonic
945303206 2:208233750-208233772 CAAGAGAAACACTTGAACCTGGG - Intergenic
945338954 2:208628444-208628466 CCTTAGAAACAGCTTAAACTGGG - Intronic
946550772 2:220799918-220799940 CAGGAGAAACAGTTGAACCTGGG - Intergenic
947522083 2:230854571-230854593 CAATAGAAAGAGACAAATCTTGG - Intergenic
1170293132 20:14793544-14793566 CAATTGAAAAAGGTTAACATAGG + Intronic
1170479535 20:16752439-16752461 AAATAGAAACAAATAAACATTGG - Intronic
1171302101 20:24072102-24072124 CAAAATAAACAGATGAATCTTGG - Intergenic
1173025566 20:39304552-39304574 TAATAAAAAAAGATTATCCTGGG + Intergenic
1174072109 20:47906460-47906482 CAATAGAACCAGAATAGACTAGG + Intergenic
1174221763 20:48961342-48961364 CAAAACACACAGATTAGCCTAGG + Intronic
1174474087 20:50783591-50783613 CAAAAAAAACAGATGATCCTGGG - Intergenic
1174953967 20:55075227-55075249 CACAAGAAACAGGTTAACATTGG + Intergenic
1177014756 21:15772618-15772640 CAAAAGAAACAGAATAACTTTGG - Intronic
1178469334 21:32877694-32877716 GCATAGAAAAAAATTAACCTTGG + Intergenic
1179091825 21:38272812-38272834 AAATAAAAATATATTAACCTTGG + Intronic
1179416805 21:41204611-41204633 AAATTGCAACATATTAACCTTGG - Intronic
1180069440 21:45428993-45429015 CAAAAGAATCAGTTGAACCTGGG - Intronic
1180147934 21:45931609-45931631 CATAAGAAACAGACTCACCTGGG + Intronic
1182901547 22:33902645-33902667 AATTAGTAACAGATTCACCTAGG - Intronic
949174691 3:1045708-1045730 CAATTGAGACATCTTAACCTAGG - Intergenic
949633192 3:5951840-5951862 CAATGGCTACACATTAACCTGGG - Intergenic
951689097 3:25376692-25376714 CATTAGAAACAGGTAGACCTGGG - Intronic
952185752 3:30966560-30966582 CTGTAGAAATAGATTAACCCTGG + Intergenic
953112864 3:39960232-39960254 CACTATAAACAGACTAAACTAGG - Intronic
957527480 3:81395792-81395814 AAATAGAATCAGATTAATCCGGG + Intergenic
958925743 3:100155368-100155390 CAATAGGAACAGAGTAAGCCAGG - Intronic
959569725 3:107870011-107870033 CAATAGAAAGTGATCAAGCTAGG - Intergenic
960535629 3:118811827-118811849 AAATATAAGCAGTTTAACCTGGG - Intergenic
961210648 3:125122815-125122837 AAATAGAAACAGAACAACCCAGG + Intronic
963743812 3:149106075-149106097 CTATAGTATTAGATTAACCTTGG - Intergenic
963862555 3:150325716-150325738 CTATAGAGACAGATTTACCAAGG + Intergenic
963880309 3:150521012-150521034 AAATAGAAACAATTTAGCCTAGG + Intergenic
965339107 3:167464104-167464126 CAAGAGAATCAGTTGAACCTGGG - Intronic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
968567493 4:1321848-1321870 CAAAAAAAACAGAGTAACCCAGG - Intronic
969335657 4:6508282-6508304 CAATAGAAACAGCTGAAGCTGGG + Intronic
971329070 4:25667417-25667439 CAAGAGAATCACTTTAACCTGGG + Intronic
971425921 4:26515301-26515323 CAGTGGAAATAAATTAACCTGGG - Intergenic
971523360 4:27584024-27584046 CAATAGAAACATTTTAAGTTAGG + Intergenic
971697128 4:29920491-29920513 AAACAGAAACAAATAAACCTAGG + Intergenic
971949513 4:33326884-33326906 AAATAGAAACAAATTTGCCTTGG + Intergenic
972538992 4:40022710-40022732 CATTAGAATCAGTTGAACCTGGG + Intergenic
974611391 4:64222803-64222825 CAATAAAAACAGAATAAAATGGG - Intergenic
975477085 4:74835665-74835687 CAATTGAAACAGATTCACAGAGG + Intergenic
975772443 4:77741316-77741338 CAATAAAAACAGATTGGCTTTGG + Intronic
978828022 4:113048038-113048060 CAATAGCAACACATTTACATAGG + Intronic
979119246 4:116873728-116873750 CAATACACACAAATTATCCTAGG + Intergenic
979768214 4:124489246-124489268 CAATAGAATCAGCATCACCTGGG - Intergenic
980205319 4:129711977-129711999 CAAGAGAAACAGAATATACTTGG + Intergenic
981515860 4:145609046-145609068 CAGAAGAATCACATTAACCTGGG - Intergenic
982194932 4:152902042-152902064 GAATAGAAGCAGATTAAAATAGG + Intronic
983688573 4:170439634-170439656 CATTAGAAACAGCCTCACCTGGG + Intergenic
986274599 5:6262690-6262712 CAATAAAAACATAAAAACCTTGG + Intergenic
986768674 5:10951365-10951387 CAATAGAAAGAGATAAGTCTTGG - Intergenic
987224297 5:15823590-15823612 CAGTTGAGTCAGATTAACCTGGG - Intronic
988050846 5:26029506-26029528 CAAGAGAATCATTTTAACCTGGG - Intergenic
989539532 5:42602814-42602836 CAATATAAACAGATGTACATTGG - Intronic
990453576 5:55961029-55961051 CAATAGAATCACTTGAACCTGGG - Intronic
990766304 5:59187432-59187454 CAATAGAAACAGATTAACCTGGG + Intronic
991431988 5:66557987-66558009 TAATAGAAACTGATGAACTTAGG + Intergenic
993087634 5:83382899-83382921 CAATAGAATCACTTGAACCTGGG + Intergenic
994331134 5:98507987-98508009 CAATAGGAACAAAACAACCTTGG - Intergenic
995076284 5:107988298-107988320 CTGCAGAAACAGATTAATCTGGG + Intronic
995617905 5:113987205-113987227 AAATAGGAAAAGATTAACTTGGG - Intergenic
996386647 5:122915831-122915853 CAAAAGAAACAGATTACCTGAGG - Intronic
996671962 5:126128461-126128483 CAATAGAAAAAGTGTAACTTTGG - Intergenic
996692345 5:126353895-126353917 CAATTAAAACAGAATCACCTGGG + Intergenic
999505297 5:152188411-152188433 CAATAGAAAATGATCAACATGGG + Intergenic
1000392013 5:160732185-160732207 AAAAAGAACCAGATTAACCTTGG + Intronic
1000765364 5:165282885-165282907 AAATAGTAACATATTTACCTAGG - Intergenic
1000993529 5:167935447-167935469 CAATAGCAACGGCTTAACCTGGG - Intronic
1002963067 6:1935658-1935680 CAATATTAACTCATTAACCTAGG + Intronic
1003223468 6:4182879-4182901 TTATGGAAAAAGATTAACCTGGG - Intergenic
1004678189 6:17864911-17864933 CTATAGAAAGAGATTTGCCTTGG - Intronic
1005412674 6:25566838-25566860 CAGTAGTAGCAGATTAATCTGGG + Intronic
1007804850 6:44434722-44434744 CAAAATAAACACATTATCCTTGG - Intronic
1008694427 6:54017346-54017368 TAATAGATAAAGATTATCCTAGG - Intronic
1010195769 6:73238971-73238993 CATGAGAAACAGTTGAACCTGGG - Intronic
1010489887 6:76462756-76462778 CAATAGAAATGGATTAGCCATGG - Intergenic
1011024988 6:82858431-82858453 CAATAGCAAGAGATCCACCTGGG - Intergenic
1011508724 6:88076870-88076892 CTATAAAAAGAGATTAAACTTGG - Intergenic
1014795114 6:125715853-125715875 CAATAGAAACTAATTAAACTAGG + Intergenic
1015010744 6:128344231-128344253 CATAAGAAACATATTCACCTTGG - Intronic
1016728749 6:147405886-147405908 CAATAGAACCAGATTATAATGGG + Intergenic
1016852430 6:148634773-148634795 AAATGGAAGCAGATCAACCTGGG + Intergenic
1018112913 6:160553492-160553514 AAATAAAAACAGATCAACCTAGG - Intronic
1020411941 7:7902181-7902203 CAATAGGAACAGAAAAACTTTGG + Intronic
1020660664 7:10977514-10977536 AAATAGAAACAAATCAACATTGG + Intronic
1020719217 7:11720446-11720468 CAGTAGAAAGAGATTAAGCATGG - Intronic
1020910412 7:14122683-14122705 AAATGGAAAGAGATTAACATAGG - Intergenic
1024852585 7:53738010-53738032 CAAGAGAAACAGAGATACCTTGG + Intergenic
1025831028 7:65049877-65049899 CATAAGAAACAGATTAGGCTGGG - Intergenic
1026164392 7:67897116-67897138 CAAGAGAAACACATGAACCCAGG - Intergenic
1027361014 7:77409965-77409987 CAATAAAATCAGAATATCCTGGG - Intronic
1027628273 7:80571118-80571140 CAAAAGAAACAGAATAGGCTGGG - Intronic
1030054892 7:105575399-105575421 CAAGAGAATCAGTTGAACCTGGG - Intronic
1030548515 7:110929397-110929419 CAATAGAAACTCATTATCCTTGG + Intronic
1030570725 7:111219786-111219808 CAATAGAAACAGGTTAACAAAGG - Intronic
1032389302 7:131545451-131545473 CAGTATAAACAGGTTATCCTGGG - Intronic
1032398729 7:131609055-131609077 CAAGAGAATCATTTTAACCTGGG - Intergenic
1033390417 7:140922892-140922914 CAAGGGAAACAGAATAAACTAGG + Intronic
1034066343 7:148140514-148140536 CAAGAGAATCACATGAACCTGGG - Intronic
1035933205 8:3807343-3807365 TAATAGAAAGTGATTAATCTGGG + Intronic
1036909161 8:12738774-12738796 CAACAGAAACAGGTTAAGATAGG + Intronic
1037269353 8:17109142-17109164 AAATAAAAACAGATTAAGGTAGG - Intronic
1037421457 8:18707727-18707749 CATTAGAAACATAGTAAGCTAGG + Intronic
1038311143 8:26447318-26447340 CAAGAGAATCAGTTGAACCTGGG - Intronic
1042444487 8:68868338-68868360 CAATAGAAAAAGACTACCTTGGG + Intergenic
1042651852 8:71051737-71051759 TAATAGAAACAGCTTAAACCAGG + Intergenic
1042844894 8:73159943-73159965 GAAGAGAAACAGATAAACCCTGG + Intergenic
1043025449 8:75061739-75061761 CAATAAAAACACATGAACATAGG + Intergenic
1043639992 8:82440108-82440130 CAATAGATACAAATTAAAATTGG - Intergenic
1048135004 8:131739941-131739963 CAAAAGAAACACATCAACCGAGG + Intergenic
1048802078 8:138203456-138203478 CAATAGAGACAGCTCAACCTGGG - Intronic
1048941279 8:139402901-139402923 CAATAGAATCACCTTCACCTGGG + Intergenic
1049314067 8:141950228-141950250 CAATAGAAACAGATCTCCATGGG + Intergenic
1050291355 9:4158669-4158691 CAATAAAAACATATTAACCAAGG + Intronic
1050571615 9:6945706-6945728 CAATAGTAACTGATTGAGCTTGG + Intronic
1051909898 9:22141405-22141427 CACTAGAAACATATTCTCCTTGG - Intergenic
1052174881 9:25447043-25447065 AAATAGAAACAGAATAAAATTGG - Intergenic
1052298116 9:26921481-26921503 AAATTGAAACAGATTAAGATGGG - Intronic
1053054495 9:34986539-34986561 CAGTAGAAACAGAGAATCCTGGG - Intergenic
1053099945 9:35363383-35363405 CAAAAGGAACACATTATCCTGGG + Intronic
1055355665 9:75434677-75434699 CACAAGAAACAGACTAATCTTGG - Intergenic
1056384512 9:86084542-86084564 CAAAATTAAGAGATTAACCTTGG - Intronic
1056565614 9:87770340-87770362 CAAGAGAATCACATGAACCTGGG - Intergenic
1057110148 9:92462068-92462090 CAAGAGAATCAGTTGAACCTGGG - Intronic
1058296389 9:103313295-103313317 CAAGAGAATCACTTTAACCTGGG - Intergenic
1058991690 9:110259736-110259758 GAAAAGGAACAAATTAACCTGGG + Intergenic
1060698037 9:125726215-125726237 AAATAGAAAAAGACTAAACTGGG - Intergenic
1186273173 X:7911971-7911993 CAAAAGAAACATATTAATATAGG + Intronic
1187642186 X:21305347-21305369 CAAGAGAGACAGATAAATCTGGG - Intergenic
1190142756 X:47862428-47862450 CAAGAGAATCACATGAACCTGGG + Intronic
1192581372 X:72285212-72285234 CAAAAGAATCAGTTGAACCTGGG - Intronic
1192779357 X:74278445-74278467 CAGGAGAATCAGATGAACCTGGG - Intergenic
1193187731 X:78532848-78532870 AAAAAGAAACAGTTTAACATGGG + Intergenic
1193235411 X:79100696-79100718 CAATAGGAAGAGATTTACATAGG - Intergenic
1193750775 X:85340495-85340517 CACTTGAAACTGTTTAACCTGGG - Intronic
1194246806 X:91523692-91523714 CAATAGAAACAAATCACCCTTGG - Intergenic
1198517385 X:137423558-137423580 CAATATAAAAAGATTTGCCTGGG + Intergenic
1198915612 X:141668181-141668203 AAATAGAAACAGATTGTACTAGG - Intronic
1199036725 X:143059768-143059790 CAATGGAAAGATTTTAACCTTGG + Intergenic
1200565766 Y:4764965-4764987 CAATAGAAACAAATCACCCTTGG - Intergenic
1200899437 Y:8413643-8413665 CAAGAGAATCACTTTAACCTGGG + Intergenic
1202282720 Y:23207218-23207240 CAGGAGAATCAGTTTAACCTGGG - Intergenic
1202283171 Y:23211301-23211323 CAGGAGAATCAGTTTAACCTGGG + Intergenic
1202434394 Y:24821603-24821625 CAGGAGAATCAGTTTAACCTGGG - Intergenic
1202434845 Y:24825687-24825709 CAGGAGAATCAGTTTAACCTGGG + Intergenic