ID: 990767686

View in Genome Browser
Species Human (GRCh38)
Location 5:59205024-59205046
Sequence CCATTCTAACATAAGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990767681_990767686 12 Left 990767681 5:59204989-59205011 CCTGACAACTCTGCATTAAATGG 0: 1
1: 0
2: 3
3: 6
4: 102
Right 990767686 5:59205024-59205046 CCATTCTAACATAAGGAACTAGG 0: 1
1: 0
2: 0
3: 19
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990767686 Original CRISPR CCATTCTAACATAAGGAACT AGG Intronic
900037303 1:426165-426187 TCATTCTAACATGAGGAACAAGG - Intergenic
900058932 1:661906-661928 TCATTGTAACATGAGGAACAAGG - Intergenic
904135189 1:28306882-28306904 CCATTTTAAGATAAGGAAACTGG - Intergenic
904892408 1:33789203-33789225 CCATTCCAGGATAAGGAACAAGG + Intronic
908859997 1:68473555-68473577 CCCTTCTATCATAAGCAACTAGG - Intergenic
919057407 1:192588327-192588349 CCCTTCTTCCATAAGGAATTAGG - Intergenic
919361520 1:196601721-196601743 CAATTCTAAAAAAAGGAAGTAGG - Intronic
923371284 1:233316593-233316615 TCATACTGACATAATGAACTGGG + Intergenic
923750737 1:236744188-236744210 GCTTTCAAACAAAAGGAACTAGG + Intronic
924397292 1:243635354-243635376 ACTTTATAACTTAAGGAACTAGG + Intronic
1065469288 10:26060586-26060608 CAATTCTAATATATGGCACTTGG + Intronic
1068458020 10:57285228-57285250 CCATTCTTACATAAATAACATGG + Intergenic
1068633084 10:59318524-59318546 CTCCTCTAACATAAGGAATTTGG - Intronic
1069394295 10:67971713-67971735 TCTTTCTAAGATTAGGAACTAGG + Intronic
1069429985 10:68325667-68325689 ACATTGTAAAATAAGGAAGTAGG - Intronic
1070285440 10:75080091-75080113 ACTTTCAAACATAAGGAATTGGG + Intergenic
1070707448 10:78650860-78650882 CCATTCCAACACAAGGCATTGGG + Intergenic
1072659666 10:97356027-97356049 CCATTCTAGTTTAAGGCACTTGG - Intergenic
1075290709 10:121228307-121228329 CCATTCTAAAAGAAAGAAATAGG + Intergenic
1076964029 11:64088-64110 TCATTCTAACACGAGGAACAAGG - Intergenic
1079569661 11:21926984-21927006 CAAATATAACATAAGGAAATGGG + Intergenic
1081304848 11:41499699-41499721 TCATTCTAATACAAGGAAATGGG - Intergenic
1081434406 11:43011125-43011147 CCACTCTAACAAAAGCAGCTGGG + Intergenic
1081532698 11:43973897-43973919 TCATTATAACATGAGGAATTTGG + Intergenic
1085691135 11:78664627-78664649 CCTCTCTAACAGAAGGAGCTTGG + Intronic
1086486391 11:87307017-87307039 CCATTCAAAATAAAGGAACTTGG - Intronic
1087128523 11:94649573-94649595 CTATTCTAAAATAAATAACTCGG + Intergenic
1087306936 11:96499722-96499744 CCCTTCTAACAGGAGGAATTGGG + Intronic
1091230255 11:133983733-133983755 CCATTCTTACATAATGAAGGAGG - Intergenic
1092940276 12:13401517-13401539 CCATTGTAATGTAAGGAAATGGG - Intergenic
1093501665 12:19819548-19819570 TCATTTTAAGATAAGGAAATTGG - Intergenic
1093770117 12:23008345-23008367 GCATACTAACAGAAGGACCTTGG + Intergenic
1099044490 12:77698940-77698962 ACATTCTAACATGAAGCACTTGG - Intergenic
1100169133 12:91953176-91953198 CCTTTCTAAAATGAGGAAGTTGG - Intergenic
1100750084 12:97688931-97688953 TTATTGTAACTTAAGGAACTTGG + Intergenic
1100878108 12:98984699-98984721 CCATTAAAATATAAGGAAATAGG - Intronic
1104384700 12:128340056-128340078 CCATATTTACATAAGGCACTAGG + Intronic
1105315509 13:19257333-19257355 GCATTCTAAGAGATGGAACTTGG + Intergenic
1106173596 13:27309416-27309438 CCAGTCTGGCTTAAGGAACTGGG - Intergenic
1109636966 13:65133138-65133160 TCAGTCTAAGTTAAGGAACTAGG - Intergenic
1109756835 13:66772081-66772103 ACATTCTGGCATAAGGAATTTGG + Intronic
1110859781 13:80335360-80335382 CTTTTCTAACATAAGGAATTAGG + Intergenic
1112293174 13:98162994-98163016 TCATTCTACCATAAGGACATAGG + Intronic
1112881379 13:104109924-104109946 CCATTCCAAAATAGGGAAATTGG - Intergenic
1115006504 14:28491943-28491965 CCATTCCAACAGGAGGAAGTAGG + Intergenic
1117463255 14:55967750-55967772 CCATTCTTGAATAAAGAACTTGG + Intergenic
1118923365 14:70169861-70169883 GCTTTCTAACATGAGTAACTGGG - Intronic
1120380545 14:83773502-83773524 CCATTAAAACAAAAAGAACTGGG - Intergenic
1126357558 15:47812374-47812396 CCATTTTAATATGAGGAAATTGG + Intergenic
1127195152 15:56576337-56576359 CAATTCTAAGAGAAGTAACTCGG + Intergenic
1127559818 15:60124970-60124992 ACATTGCAACATAAAGAACTTGG + Intergenic
1130784137 15:87077113-87077135 CCATTCTAAGAGAGGGAAATAGG - Intergenic
1132444522 15:101901092-101901114 TCATTCTAACACGAGGAACAAGG + Intergenic
1132450184 15:101963064-101963086 CCAATTTTACATAAGGAAATGGG - Intergenic
1134177902 16:12023266-12023288 CCATTCCAAGTTAATGAACTAGG - Intronic
1135892720 16:26371994-26372016 CTCTTCAAAAATAAGGAACTAGG + Intergenic
1136532147 16:30876862-30876884 CTTTTCTACCATAAGGAACTTGG + Intronic
1139328614 16:66170580-66170602 ACTTTCTACCATAAGGAAATAGG + Intergenic
1140805825 16:78531351-78531373 CCATTCTAACCTAAGGAAAAGGG - Intronic
1142817475 17:2437982-2438004 CCATTCTGACATAAGCATTTGGG + Intronic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1147023441 17:37558897-37558919 CCATTCTAACATGAAGGATTTGG + Intronic
1151117771 17:71757274-71757296 CCTTTCTGAAATATGGAACTGGG - Intergenic
1153211794 18:2774798-2774820 CCATCCTAGCACAATGAACTAGG + Intronic
1153351683 18:4087806-4087828 CCATTTTAAAATAAAGAACTAGG - Intronic
1156649035 18:39202412-39202434 TCATTCAAACATGAGGAACAAGG - Intergenic
1157891465 18:51422069-51422091 GCATTCTAACATTAGGCACTAGG - Intergenic
1159479460 18:68969157-68969179 CCATGCTAACGTAATGAACTGGG + Intronic
1159585013 18:70275593-70275615 TCTCTTTAACATAAGGAACTAGG + Intergenic
1160640832 19:133720-133742 TCATTCTAACACGAGGAACAAGG - Intergenic
1166711940 19:44943367-44943389 CCATTTTAACATAAAGTACATGG - Intronic
1166793309 19:45410779-45410801 CAATTACAACATAATGAACTGGG - Intronic
925991868 2:9260698-9260720 CCATTCTACCATAGGGGAATGGG + Intronic
928693586 2:33825536-33825558 CCATTCTACCATAAAGACCCAGG - Intergenic
929096896 2:38271293-38271315 CCATTTTAAAATCAGGAACAAGG - Intergenic
936566411 2:113585553-113585575 CCAATTTTACATAAGGAAATGGG - Intergenic
936812864 2:116422968-116422990 ACATTCTAACCTCAGGACCTGGG - Intergenic
938704344 2:133908451-133908473 TCATTCTTTCCTAAGGAACTGGG - Intergenic
945375109 2:209070864-209070886 CAATTATATGATAAGGAACTAGG + Intergenic
946565932 2:220965940-220965962 TCATTCTATCATGTGGAACTTGG - Intergenic
1174561613 20:51434552-51434574 CCATTCTAACAGAGGGGATTAGG - Intronic
1181109073 22:20590951-20590973 CCATTCTAAGAGAAGCAGCTTGG + Intergenic
950336453 3:12197768-12197790 CCATTCTAAGGTGAGGAAATGGG + Intergenic
952845543 3:37685087-37685109 CCATTTTAACATAAAGAACAAGG - Intronic
953270725 3:41441123-41441145 CAAATCAAAAATAAGGAACTAGG - Intronic
956484798 3:69711006-69711028 CCAAACTAACATAAGGAAGGTGG - Intergenic
956532109 3:70232056-70232078 TTATTCTGACATAATGAACTGGG + Intergenic
960185567 3:114633899-114633921 CATGTCAAACATAAGGAACTAGG + Intronic
960818737 3:121703746-121703768 CCATTCACACATAAAGAAATAGG + Intronic
961009747 3:123427647-123427669 CCAAGCTCACACAAGGAACTGGG - Intronic
961074932 3:123973490-123973512 CCCTTCTAAAATAAGGAGGTGGG - Intronic
962577129 3:136764815-136764837 CCATTCTTTCATAAGTAGCTGGG - Intergenic
964990031 3:162799403-162799425 CCATCCTGACATAACTAACTAGG + Intergenic
965825317 3:172723653-172723675 CCCTTCTAACAAAAGGCACAGGG - Intergenic
965879854 3:173375650-173375672 CCATTGTGACATCAGGGACTAGG - Intergenic
971637484 4:29080370-29080392 CCATTCTCAGGGAAGGAACTAGG - Intergenic
975602427 4:76116328-76116350 CCATTCTAACATAATAAAATTGG + Intronic
976647789 4:87403175-87403197 CCCTTCTAACAGAAGGCACAGGG + Intergenic
977335130 4:95688199-95688221 AAATTATAACAGAAGGAACTTGG - Intergenic
979113999 4:116797675-116797697 ACATTCTGACATAAGGAATGAGG - Intergenic
981179045 4:141716932-141716954 CCATTCTAAAATGGGGAAATAGG - Intronic
981952818 4:150430804-150430826 CCATTCCAAAGTAATGAACTGGG + Intronic
983806951 4:172005658-172005680 AAATTCTAAAATAAGGAACATGG + Intronic
984938444 4:184910134-184910156 CCCTTCTAACAGAAGGCACAGGG + Intergenic
985142482 4:186856649-186856671 CCATTTTTACTTAAGGAACTTGG - Intergenic
986821938 5:11476966-11476988 CCACTTTAACATAAAAAACTGGG + Intronic
990040620 5:51374910-51374932 CTATTCTATCAGAATGAACTGGG + Intergenic
990767686 5:59205024-59205046 CCATTCTAACATAAGGAACTAGG + Intronic
997697172 5:135870800-135870822 CTCTTTTAACATAAGGAAATGGG + Intronic
998427439 5:142040772-142040794 CCATTCTAGCCTTAGAAACTAGG + Intergenic
998784950 5:145699163-145699185 CCAGTCTTCCAAAAGGAACTAGG - Intronic
999367208 5:151030944-151030966 CCATTGTAAAAGAGGGAACTGGG + Intronic
1000037318 5:157459495-157459517 CCATTAAAATATAAGGTACTTGG + Intronic
1000345351 5:160309765-160309787 ACATTATAACCAAAGGAACTTGG + Intronic
1001609448 5:172988434-172988456 CCATTTTAAAATGAGGAAATGGG - Intronic
1001714971 5:173807891-173807913 CCATTCTAAAGTGAGGAGCTTGG - Intergenic
1002736518 5:181392701-181392723 TCATTCTAACATGAGGAACAAGG + Intergenic
1002748179 6:82123-82145 TCATTCTAACACGAGGAACAAGG - Intergenic
1005246638 6:23893230-23893252 CCATCCCAACATAAGAATCTAGG - Intergenic
1007192058 6:40027790-40027812 CCATTTTAAAATAAGGAAATAGG - Intergenic
1011730727 6:90260689-90260711 CCAAACTAACATAAAGAATTTGG - Intronic
1015472695 6:133623816-133623838 CCACTCTAACACATAGAACTAGG + Intergenic
1016718230 6:147259625-147259647 CAATACTAACATTAGGCACTCGG - Intronic
1018493753 6:164326150-164326172 CCATTCTAATATGAAGTACTAGG + Intergenic
1019241616 6:170668230-170668252 TCATTCTAACATGAGGAACAAGG + Intergenic
1019321492 7:417436-417458 CCATTCTAAGATGAGGAAACAGG + Intergenic
1024368104 7:48546619-48546641 CCATTTTAATATATGCAACTGGG + Intronic
1024818503 7:53299322-53299344 ACATTCAAACATAAGGAAGAAGG + Intergenic
1026163045 7:67887729-67887751 ACTCTCTAACATAAGCAACTAGG - Intergenic
1027390569 7:77699438-77699460 CCATTCTAACAGAACGTATTTGG + Intronic
1028001698 7:85506152-85506174 ACATTGTAACATAAGTAATTTGG + Intergenic
1030251946 7:107456161-107456183 CGGTTCTAACATAAGAAACAAGG + Intronic
1034066565 7:148142538-148142560 CCATTCTAAAATAAGGTTCGAGG - Intronic
1035080949 7:156215500-156215522 CAATTCCAAGAAAAGGAACTGGG - Intergenic
1035506500 8:139866-139888 TCATTCTAACATGAGGAACAAGG - Intergenic
1037811958 8:22091830-22091852 ACTTTCTAAAACAAGGAACTAGG + Intronic
1038480602 8:27899226-27899248 CCATTCTGACATAATCAACCTGG - Intronic
1039286745 8:36049941-36049963 CCAAGCTAACATAATGAATTAGG - Intergenic
1041188667 8:55329701-55329723 GCCTTATAACATATGGAACTTGG - Intronic
1041685731 8:60642829-60642851 CCATTTTAATATAAACAACTTGG - Intergenic
1042338559 8:67654785-67654807 TCATTCTAACATACGTAAATTGG + Intronic
1042907633 8:73788577-73788599 GAAATCTACCATAAGGAACTTGG - Intronic
1043337931 8:79200163-79200185 TAATTCTGACATAAGGCACTTGG - Intergenic
1043445031 8:80311020-80311042 CCATTTTAAGATAAAGAACAAGG - Intergenic
1047208745 8:122823548-122823570 CCATTCTAACATGAGCACCCAGG + Intronic
1052486652 9:29110076-29110098 CAATTCTCACTTAAAGAACTAGG + Intergenic
1058038167 9:100275654-100275676 CCATCCTAACATAATAAACTGGG - Intronic
1058119653 9:101124616-101124638 CCCTTCTAACAGAAGGCACAGGG + Intronic
1203601808 Un_KI270748v1:17464-17486 TCATTCTAACATGAGGAACAAGG + Intergenic
1186969086 X:14820319-14820341 CAACTGTAACATAAGGAAGTAGG - Intergenic
1187029570 X:15471706-15471728 CCCTTCTAACAGAAGGATCTGGG - Intronic
1188398258 X:29712771-29712793 GCATTCTGACATAAGTAACTGGG + Intronic
1188639275 X:32478793-32478815 CCATTCTCACAAAGGGCACTTGG + Intronic
1193267500 X:79489293-79489315 CCATTCTACCATAAAGACATAGG - Intergenic
1194270262 X:91805441-91805463 CTATTCTAACATTAGAACCTTGG - Intronic
1195133434 X:101877835-101877857 CCATTCTAACGGAAGGAAAAAGG - Intergenic
1195994361 X:110716893-110716915 CCATTTCATGATAAGGAACTGGG - Intronic
1198283549 X:135167895-135167917 CCATTCTAACATGCGTGACTCGG - Intronic
1198344486 X:135746418-135746440 CCCTTCTAACAGAAGGCACAGGG - Intergenic
1199661732 X:150057642-150057664 CTATTCCAAATTAAGGAACTTGG - Intergenic
1200587499 Y:5026885-5026907 CTATTCTAACATTAGAACCTTGG - Intronic
1202147374 Y:21813416-21813438 CTATACTAAAATAAGGAACCTGG - Intergenic