ID: 990768564

View in Genome Browser
Species Human (GRCh38)
Location 5:59216426-59216448
Sequence TAGTAGGGATGGAAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 878
Summary {0: 1, 1: 0, 2: 0, 3: 49, 4: 828}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990768564_990768570 -4 Left 990768564 5:59216426-59216448 CCCACTTCCTTCCATCCCTACTA 0: 1
1: 0
2: 0
3: 49
4: 828
Right 990768570 5:59216445-59216467 ACTACCAATATTTTAAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990768564 Original CRISPR TAGTAGGGATGGAAGGAAGT GGG (reversed) Intronic
900816641 1:4852271-4852293 AAGTCAGGATGGAAGGAAGGAGG + Intergenic
901175585 1:7296467-7296489 TAGTGGGGATGGGAAGAAGTGGG + Intronic
901404146 1:9034688-9034710 TAGAAGGGAGGTAAGGAATTTGG - Intergenic
901884103 1:12210740-12210762 AAGTAGGGGTGGGGGGAAGTGGG - Intergenic
901895780 1:12310824-12310846 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
901895788 1:12310848-12310870 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
902066090 1:13689268-13689290 TGGCAGGGATTGAAGGAAGGGGG + Intergenic
902113398 1:14101511-14101533 GAGTAGGGATTGAAGGGAGAGGG + Intergenic
902553860 1:17235288-17235310 AAGGAGGGAAGGAAGGAAGGAGG + Intronic
902927137 1:19703470-19703492 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
904109288 1:28112827-28112849 ACTCAGGGATGGAAGGAAGTGGG - Intergenic
905323138 1:37131797-37131819 AAGTGGGGAAGGAAGGAAGGGGG - Intergenic
905961537 1:42046409-42046431 TGATGGGGATGGAAGGGAGTAGG + Intergenic
906177628 1:43789187-43789209 TAGAAAGGATGGATGGAAATGGG + Intronic
906264567 1:44418252-44418274 AAGGAGGGATGGGAGGAGGTTGG + Intronic
906707749 1:47907058-47907080 GCGTGGGGAGGGAAGGAAGTGGG + Intronic
906764770 1:48418750-48418772 AAGGAGGGAAGGAAGGAAGAAGG + Intronic
906764774 1:48418766-48418788 AAGAAGGGAAGGAAGGAAGAAGG + Intronic
906764779 1:48418782-48418804 AAGAAGGGAAGGAAGGAAGGAGG + Intronic
907437427 1:54458757-54458779 CAGGAGGGAGGGAAGGAAGGAGG + Intergenic
908714594 1:67055650-67055672 CAGCAGAGAGGGAAGGAAGTAGG - Intergenic
909016822 1:70389015-70389037 AAGGAGGGAAGGAAGGAAGGGGG - Intergenic
909177227 1:72376686-72376708 AAGAAGGGAAGGAAGGAAGGAGG - Intergenic
910521255 1:88124709-88124731 AAGTAAGGAAGGAAGGAAGGAGG + Intergenic
910726438 1:90344835-90344857 TAGTGACGATGGAGGGAAGTGGG - Intergenic
911636130 1:100238185-100238207 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
912372318 1:109183617-109183639 TAGGAAGGAAGGAAGGAAGGAGG - Intronic
912548698 1:110470100-110470122 AAGGAGGGAGGGAAGGAAGAAGG - Intergenic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
914024888 1:143903918-143903940 TGGGAGGGATGGAGGGAAGGAGG - Intergenic
914191912 1:145419221-145419243 AAGTAGGGAAGGAGAGAAGTAGG + Intergenic
914663317 1:149811638-149811660 TGGGAGGGATGGAGGGAAGGAGG - Intronic
914863562 1:151406391-151406413 TAGTGGGGAAGGAAGGAGGAGGG + Exonic
914935773 1:151978646-151978668 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
915004958 1:152627345-152627367 AGGGAGGGATGGAAGGAAGGAGG - Intergenic
915730226 1:158048205-158048227 TAAGAAGGATGGAAGGAAGAAGG + Intronic
915925701 1:160017599-160017621 TACTAGAGATGGTAAGAAGTGGG - Intergenic
916058232 1:161082477-161082499 AAATAGGGATGGAAGGAGGCAGG + Intronic
916146720 1:161746549-161746571 AAGGAAGGATGGAAGGAAGACGG - Intergenic
916329107 1:163594966-163594988 TCGTAGTGAGGGACGGAAGTTGG - Intergenic
916492630 1:165315349-165315371 GGGTAGAGATGAAAGGAAGTAGG - Intronic
917157364 1:172018980-172019002 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
917739709 1:177950866-177950888 AAGGAGGGAAGGAAGGAAGGAGG + Intronic
917878016 1:179304647-179304669 TAGGAGGAATGGAAGGAAAAAGG - Intronic
917896424 1:179492641-179492663 TAAGAGGGATGGAAGGGAGAAGG + Intronic
918096464 1:181339620-181339642 TAGTAGGGAGGCAAGGAAATAGG - Intergenic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918895373 1:190336855-190336877 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
918916681 1:190649711-190649733 GAGGAGGGAAGGAAGGAAGGAGG - Intergenic
919058890 1:192606127-192606149 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
919058905 1:192606171-192606193 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
919058910 1:192606187-192606209 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
919161142 1:193832946-193832968 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
919363442 1:196624978-196625000 TTGTTGGGATAGAAAGAAGTTGG + Intergenic
919392970 1:197010564-197010586 AAGGAGGGAAGGAAGGAAGCAGG + Intergenic
919688316 1:200505346-200505368 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
919883218 1:201914671-201914693 TAGAAGAGGTGGCAGGAAGTTGG - Intronic
920544538 1:206804489-206804511 TACTACAGATGGAAGGAATTAGG + Intronic
920984649 1:210875008-210875030 TTGAAGGGAAGGAAGGAAGGAGG + Intronic
921312322 1:213856481-213856503 GAGGAGGGAAGGAAGGAAGGAGG - Intergenic
921343608 1:214158872-214158894 AAGAAGGGAAGGAAGGAAGGAGG + Intergenic
922176000 1:223198072-223198094 AAGGAGGGAGGGAAGGAAGGAGG - Intergenic
922245659 1:223794990-223795012 CAGTAAGCACGGAAGGAAGTAGG - Intronic
922393845 1:225176092-225176114 AAGCAAGGAAGGAAGGAAGTTGG - Intronic
922517865 1:226222191-226222213 GAGAAGGGGTGGAAGGAAGATGG + Intergenic
922705528 1:227788348-227788370 TAGTGGGGCTGGGACGAAGTGGG + Intergenic
924301886 1:242648029-242648051 TAGTAGGTATGGACAGAAATGGG + Intergenic
1063065318 10:2602155-2602177 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1063065323 10:2602171-2602193 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1063065334 10:2602207-2602229 AAGCAGGGAAGGAAGGAAGGAGG - Intergenic
1063087166 10:2830434-2830456 TAGTAGGGCAGGAAGGATGGTGG + Intergenic
1063156334 10:3382352-3382374 AAGGAGGGAGGGAAGGAAGGAGG + Intergenic
1063198001 10:3760846-3760868 AAGTAGAGAGGGAAGGAAGGAGG - Intergenic
1063349115 10:5338127-5338149 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1063697994 10:8356405-8356427 AAGAAGGGATGTAAGGAAGAAGG - Intergenic
1064250816 10:13705146-13705168 TGGCGGGGAAGGAAGGAAGTCGG - Intronic
1064280989 10:13951309-13951331 TAGTAGGGAAGGAAGGAGAGAGG + Intronic
1064332856 10:14410031-14410053 GAGGAAGGAAGGAAGGAAGTGGG + Intronic
1064512061 10:16105832-16105854 TAGTAAGGAGGCAAGGAAATTGG - Intergenic
1064868820 10:19914025-19914047 AAGAAGGGAAGGAAGGAAGCAGG + Intronic
1064870687 10:19933765-19933787 AAGTATGGAAGGAAGGAAGCGGG + Intronic
1064870705 10:19933819-19933841 AAGGAGGGAAGGAAGGAAGGAGG + Intronic
1064987248 10:21223181-21223203 TAGCAGGGATGGGGGAAAGTGGG - Intergenic
1065324459 10:24538539-24538561 TAGGAGGGATGGAGGGAGGGAGG + Intronic
1065438343 10:25724424-25724446 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1065438348 10:25724440-25724462 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1065866899 10:29922219-29922241 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1066261382 10:33732955-33732977 AAGCAGGGAGGGATGGAAGTAGG + Intergenic
1066391203 10:34978591-34978613 TTGTAGGGATGGAGGGACATGGG + Intergenic
1066497884 10:35959901-35959923 TAGAAAGGAAGGAAGGAAGGAGG - Intergenic
1067914669 10:50384473-50384495 AAGCAGGGATGGAGGGAAGGAGG - Intronic
1068381066 10:56254732-56254754 TAGGAGGGATGCAGGGAAATAGG - Intergenic
1068625091 10:59236334-59236356 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1068752674 10:60613247-60613269 TAGTAGGAATGGGAGAAATTGGG + Intronic
1069785285 10:70983900-70983922 AAGCTGGGATGGACGGAAGTGGG + Intergenic
1069817565 10:71208280-71208302 TAAGAAGGATGGAAGGAAGAAGG + Intergenic
1069938317 10:71935056-71935078 TGGTGGGGAAGGATGGAAGTGGG - Intergenic
1070024184 10:72616163-72616185 TACTAGGCATGCAAAGAAGTAGG - Intronic
1070490249 10:76969279-76969301 AAGAAGGGAAGGAAGGAAGGAGG + Intronic
1070808291 10:79283804-79283826 CCGCAGGGAGGGAAGGAAGTAGG + Intronic
1071169759 10:82850213-82850235 TATTAGCACTGGAAGGAAGTTGG + Intronic
1071304539 10:84286833-84286855 GAGTAGGGGTGGGAGGAAGGTGG + Intergenic
1071563299 10:86659107-86659129 TAGCAGGAATGGGAGGCAGTGGG + Intronic
1071583480 10:86795646-86795668 TAGTAGGGAGGGAGGGAATTAGG + Intronic
1071809110 10:89159091-89159113 AAGAAGGGAGGGAAGGAAGGAGG + Intergenic
1071896088 10:90068474-90068496 AAGGAGGGAGGGAAGGAAGGAGG - Intergenic
1072789083 10:98304386-98304408 TATTTGGGATGGGAGGATGTGGG + Intergenic
1073349627 10:102810474-102810496 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1073625343 10:105091074-105091096 CAGGAGGGAGGGAAGGAAGGAGG - Intronic
1073625382 10:105091188-105091210 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1073625387 10:105091204-105091226 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1073625392 10:105091220-105091242 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1073625397 10:105091236-105091258 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1073625402 10:105091252-105091274 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1073625415 10:105091300-105091322 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1073625438 10:105091379-105091401 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1073625467 10:105091474-105091496 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1073740550 10:106401166-106401188 TATTAGGGATGGGAGGTAGGGGG + Intergenic
1073768460 10:106709097-106709119 TGGGAGGGAGGGAAGGAGGTAGG - Intronic
1074002736 10:109388700-109388722 TAGGCAGGATGGAAGGAAGGAGG + Intergenic
1074207230 10:111293824-111293846 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1074879295 10:117641191-117641213 AAGGAAGGATGGAAGGAAGGGGG - Intergenic
1075182209 10:120221796-120221818 TATTAGGTTTGGAAGGAAATGGG + Intergenic
1075293319 10:121249922-121249944 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1075400480 10:122158014-122158036 TAGGAGGGAAGGAGGGAAGGAGG - Intronic
1076290545 10:129342470-129342492 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1077217470 11:1400938-1400960 CAGCAGGGATGGAAGGAAGGAGG - Intronic
1077317507 11:1925954-1925976 GCGTTGGGATGGCAGGAAGTGGG + Intronic
1077457966 11:2692291-2692313 CAATAGGGATGGAGGGAAGCAGG - Intronic
1077499947 11:2904797-2904819 GAGCAGGGCTGGAAGGAAGCAGG + Intronic
1077503151 11:2918247-2918269 TAGAGGGGCTGGAAGGAGGTGGG - Intronic
1077574978 11:3376106-3376128 GAGTTGGGATGGAAGGAAGCTGG - Intronic
1078148694 11:8740683-8740705 TAGTAGGGATGGAAGCATTTTGG - Intronic
1078383523 11:10866174-10866196 AAGGAAGGAAGGAAGGAAGTGGG - Intergenic
1078652738 11:13210748-13210770 TAGTAAGGATGGACTGAAGAGGG - Intergenic
1078923613 11:15854346-15854368 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1079615902 11:22492564-22492586 TAGAAGGGATTGGAGGAACTAGG - Intergenic
1079822480 11:25148249-25148271 AAGTTGGGAGGGAAGGAAGGAGG + Intergenic
1080156995 11:29122953-29122975 TAGTAGGAATTTAGGGAAGTGGG - Intergenic
1080389854 11:31834806-31834828 AAGGAGGTAGGGAAGGAAGTAGG - Intronic
1080389857 11:31834818-31834840 AAGAAGGGAGGGAAGGAGGTAGG - Intronic
1080548854 11:33350675-33350697 TAGAAAGGAAGGAAGGAAGGAGG + Intronic
1080556600 11:33422572-33422594 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1082880719 11:58034766-58034788 AAGGAGGGAGGGAAGGAAGAAGG - Intronic
1083956215 11:65984297-65984319 TAGTAGGGTGGGATGGGAGTGGG - Intergenic
1084470423 11:69356206-69356228 GAGTAGGGAGGGAAAGAAGGAGG + Intronic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1085154075 11:74277248-74277270 AAGGAAGGATGGAAGGAAGGAGG + Intronic
1085335319 11:75688761-75688783 TGGTAAGGAAGGAAGGAAGACGG - Intergenic
1085823603 11:79819207-79819229 CAGAAAGCATGGAAGGAAGTGGG - Intergenic
1086564414 11:88209235-88209257 TTGTACGAATGGATGGAAGTGGG + Intergenic
1086783883 11:90940842-90940864 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1087135126 11:94708694-94708716 TAGTTGGCATGGTAGGAAGGAGG + Intronic
1087678895 11:101195718-101195740 TAGTAGGAATGAAAGAAAGGAGG - Intergenic
1087857470 11:103109549-103109571 TGGAAGGGGTGGAGGGAAGTTGG - Intronic
1088438438 11:109841408-109841430 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1088438449 11:109841444-109841466 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1088438454 11:109841460-109841482 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1088438465 11:109841496-109841518 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1088802860 11:113322427-113322449 TAGTAAGGAAGGATGGATGTAGG + Intronic
1089100408 11:115958214-115958236 AAAGAGGGAAGGAAGGAAGTAGG - Intergenic
1089312021 11:117564669-117564691 TAGGAAGGAAGGAAGGAAGGAGG - Intronic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089531201 11:119130973-119130995 TAATTGGGGTGGAAGGAAGCTGG + Intronic
1089547620 11:119241842-119241864 GTGTAGAGATGGAAAGAAGTGGG + Intronic
1089887677 11:121844030-121844052 TAGGAGCCATGGAAGGATGTAGG - Intergenic
1090493524 11:127187864-127187886 AAGGAGGGAAGGAAGGAAGATGG + Intergenic
1090988693 11:131796399-131796421 TAGTAGGTGTTGAAGGAAGATGG + Intronic
1091084467 11:132707002-132707024 TTCTGGGGATGGAAGAAAGTTGG + Intronic
1091204503 11:133810418-133810440 GAGTGGGGAGGGAAGGAAATGGG + Intergenic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1091388896 12:113098-113120 CAGCATGGAGGGAAGGAAGTGGG - Intronic
1091568411 12:1663753-1663775 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1091568432 12:1663824-1663846 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1091976147 12:4827228-4827250 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1092092205 12:5812385-5812407 AAGAAGGGAAGGAAGGAAGGAGG + Intronic
1092281486 12:7101145-7101167 AAGAAGGGAAGGAAGGAAGGAGG - Intronic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1093838612 12:23868084-23868106 AAGAAGGGAGGGAAGGAAGGAGG - Intronic
1094343999 12:29446253-29446275 TTGTAGGGATGAAAGGAAGGAGG + Intronic
1094490514 12:30957800-30957822 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1094615081 12:32029248-32029270 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1094664923 12:32510194-32510216 TAGTGGGAATGGGAAGAAGTGGG + Intronic
1094699632 12:32856412-32856434 GAGTAGGGAGGGAAAGATGTGGG + Intronic
1094738754 12:33264473-33264495 AAGGAGGGAAGGAAGGAAGGGGG - Intergenic
1095236742 12:39805397-39805419 TAGAAGTGGTGTAAGGAAGTGGG + Intronic
1095417850 12:41995342-41995364 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1095552821 12:43463883-43463905 TAGTAGGGAGGGAAGCAATTAGG + Intronic
1095716547 12:45352313-45352335 GAGTGGGGAGGGAAAGAAGTGGG - Intronic
1096291127 12:50344262-50344284 TAGTAGGGGAGAGAGGAAGTGGG - Intronic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1097644597 12:62221195-62221217 AAGGAGGGAAGGAAGGAAGGGGG + Intronic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1097819386 12:64112899-64112921 TAGGAAGGATGAAAAGAAGTTGG + Intronic
1098867744 12:75782090-75782112 TGGCAGGGATGTAAAGAAGTTGG + Intergenic
1098945950 12:76589799-76589821 TAGGAGGGATGGTAGGCAGGAGG - Intergenic
1099447708 12:82771815-82771837 AAGTAGGTAGGAAAGGAAGTAGG + Intronic
1099872621 12:88368821-88368843 GACTAGGGAGGGAATGAAGTGGG - Intergenic
1099959205 12:89380472-89380494 TAGAAGGGAGAGAAGGAAGCAGG - Intergenic
1100286582 12:93172630-93172652 TTGGAGGGACAGAAGGAAGTGGG - Intergenic
1100396871 12:94193364-94193386 TAGTGGTGAGGGAAGGAAGTGGG + Intronic
1101331550 12:103761573-103761595 GAGTGGGGATGGCAGGAAGCAGG - Intronic
1101348184 12:103905339-103905361 AAGGAGGGAGGGAAGGAAGGAGG + Intergenic
1101348211 12:103905403-103905425 AAGGAGGGAGGGAAGGAAGGAGG + Intergenic
1101348259 12:103905533-103905555 AAGGAGGGAGGGAAGGAAGGAGG + Intergenic
1101577131 12:106007969-106007991 TAGAAAGGAAGGAAGGAAGGTGG - Intergenic
1102079205 12:110084486-110084508 AAGGAAGGATGGAAGGAAGGAGG + Intergenic
1102226230 12:111230172-111230194 AAGGAGGGAGGGAAGGAAGCAGG + Intronic
1102556470 12:113729952-113729974 TATTTGGGAGGGAAGAAAGTGGG - Intergenic
1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG + Intergenic
1102773745 12:115501143-115501165 TAGTAAGGATGGTGGGAAGCAGG + Intergenic
1102898765 12:116619891-116619913 TGGAAGGGAGGGAAGGAAGAAGG + Intergenic
1102991976 12:117322239-117322261 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1102992002 12:117322326-117322348 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1102992117 12:117322746-117322768 AAGGAAGGAGGGAAGGAAGTGGG - Intronic
1103511338 12:121476718-121476740 GAGGAGGGAGGGAAGGAAGGAGG - Intronic
1104172511 12:126295861-126295883 AAGGAGGGAGGGAAGGAAGGAGG + Intergenic
1104300614 12:127561832-127561854 GAGTGAAGATGGAAGGAAGTGGG + Intergenic
1104451631 12:128873827-128873849 AAGGAGGGAAGGAAGGAAGGGGG - Intronic
1105295073 13:19081619-19081641 AAGAAGGGAAGGAAGGAAGATGG - Intergenic
1105606598 13:21931046-21931068 TAGGAGGGAGGGAAGTAAGCGGG + Intergenic
1105796041 13:23853948-23853970 AAGCAGGGAGGGAAGGAAGAAGG + Intronic
1105843913 13:24278949-24278971 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1105967021 13:25394287-25394309 TAGCAGTGATGCAGGGAAGTTGG + Intronic
1107317542 13:39149995-39150017 AAGTAGAGAAGGAAAGAAGTCGG + Intergenic
1108584003 13:51852127-51852149 TAGCAGAGTTGGAAGGAAATAGG - Intergenic
1108703537 13:52964360-52964382 TGATAGGGTTGGAAGCAAGTGGG + Intergenic
1109512827 13:63402003-63402025 AAGGAGGGAAGGAAGGAAGAAGG - Intergenic
1109881473 13:68483729-68483751 TTGTAGAGATTTAAGGAAGTTGG + Intergenic
1109889617 13:68591633-68591655 TAGTAGGGATGCAGAGAAATAGG - Intergenic
1110229474 13:73153368-73153390 AAGGAGGGAGGGAGGGAAGTAGG - Intergenic
1110843984 13:80173169-80173191 AGGGAGGGAGGGAAGGAAGTAGG + Intergenic
1111066255 13:83096261-83096283 AAGAAGGGAGGGAAGGAAGGAGG + Intergenic
1111482019 13:88841999-88842021 TAGTAAGGATGGGAGGAAACAGG + Intergenic
1111792029 13:92869565-92869587 AAGGAGGGAGGGAAGGAAGAAGG + Intronic
1111855730 13:93634700-93634722 CAGTAGGAAAGGAAGGAAGAAGG + Intronic
1112346734 13:98596385-98596407 TAAGAGAGATGGATGGAAGTGGG - Intergenic
1112643166 13:101300284-101300306 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1112924530 13:104657481-104657503 AAGAAGGGAAGGAAGGAAGGAGG - Intergenic
1113139138 13:107127776-107127798 TAGAAGCCATGGAAGGAAATGGG + Intergenic
1114325745 14:21587100-21587122 TAGTATGGATGAAAGGAAAAAGG + Intergenic
1114327813 14:21607047-21607069 TCCTAGGGATGGAATGAAGGAGG + Intergenic
1114813259 14:25926323-25926345 GAGTAGAGTTGGAAGGCAGTTGG + Intergenic
1114909549 14:27173006-27173028 TAGTAGTAATGGAAGTCAGTAGG - Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115749323 14:36472848-36472870 TTGGAGGGAGGGAAGGAAGGGGG + Intergenic
1116751371 14:48889698-48889720 TTGTGTGGATGGAAGGCAGTAGG - Intergenic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1118337116 14:64863036-64863058 CAGTAGGAATGGAAGGGAGGTGG - Intronic
1119089286 14:71765752-71765774 AAGGAGGGAGGGAAGGAAGGAGG - Intergenic
1119089297 14:71765780-71765802 AAGGAGGGAGGGAAGGAAGGAGG - Intergenic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119857136 14:77909082-77909104 TGGGATGGAAGGAAGGAAGTGGG + Intronic
1119956653 14:78805491-78805513 GTGCAGGGATGGAAGGTAGTAGG - Intronic
1120042228 14:79767202-79767224 CAGTAGGGCTGGGAGGAAGAAGG - Intronic
1120393463 14:83938106-83938128 TAGTAGGGAAGAAAGGGAGAAGG + Intergenic
1120629484 14:86872602-86872624 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1120923094 14:89772743-89772765 AAGGAGGGAGGGAAGGAAGAAGG - Intergenic
1121394696 14:93610185-93610207 GAATTGGGATGGAAGGAAATGGG + Intronic
1121612824 14:95293197-95293219 AAGGAGGGAGGGAAGGAAGGGGG - Intronic
1121612839 14:95293237-95293259 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1121612858 14:95293289-95293311 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1121612886 14:95293365-95293387 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1121612892 14:95293381-95293403 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1121843621 14:97154867-97154889 AGGTGGGGCTGGAAGGAAGTGGG + Intergenic
1124132132 15:27000169-27000191 TAGTAGGCATGCAAAGAAGCTGG - Intronic
1124172392 15:27387885-27387907 AAGGAGGGAAGGAAGGAAGGAGG + Intronic
1124842240 15:33253362-33253384 TAGTAAGGATGCAAAGAAATTGG - Intergenic
1124990996 15:34673745-34673767 TAGTAGGGGTAGAAAGGAGTGGG - Intergenic
1124994455 15:34709355-34709377 AGGTAGGGAGAGAAGGAAGTGGG - Intergenic
1125841503 15:42805608-42805630 TAATAGAGATGGAGGGAAATGGG - Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126520731 15:49591393-49591415 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1127507415 15:59610458-59610480 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1127507421 15:59610474-59610496 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1127507449 15:59610558-59610580 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1128058469 15:64718324-64718346 GAGGAAGGACGGAAGGAAGTAGG + Intergenic
1128805940 15:70531376-70531398 AAGGAGGGAGGGAAGGAAGGAGG + Intergenic
1129384028 15:75185813-75185835 GAGAAGGTAGGGAAGGAAGTGGG + Intergenic
1129935856 15:79449803-79449825 TGGTAGGGATGGAGAGAAGGAGG - Intronic
1130561742 15:84964273-84964295 AAGGAAGGATGGAAGGAAGGAGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131233067 15:90673595-90673617 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1131288283 15:91081247-91081269 AAGGAAGGAAGGAAGGAAGTAGG - Intergenic
1131305445 15:91239073-91239095 TAGCAGGGATGGAAGAAAGGGGG + Intronic
1131346761 15:91656493-91656515 TACTAAGGAAGGAAGGAAGGAGG - Intergenic
1131714995 15:95099328-95099350 CAGTAGTGATGAAAGTAAGTAGG + Intergenic
1131744716 15:95434825-95434847 AAGGATGGATGGAAGGAAGGGGG - Intergenic
1131791466 15:95970224-95970246 GAGGAGGGAGGGAAGGAAGGGGG + Intergenic
1131793322 15:95988363-95988385 AAGGAGGGAAGGAAGGAAGAAGG + Intergenic
1132159314 15:99523065-99523087 AAGCAGGGATGGAAAGAGGTGGG + Intergenic
1132209787 15:100011385-100011407 CAGAAGGGAGGGAAGGAAGGAGG + Intronic
1132248489 15:100316019-100316041 TAGGAAGGATGGAAGGAATATGG + Intronic
1132435936 15:101802780-101802802 AAGGAAGGAAGGAAGGAAGTGGG - Intergenic
1133647148 16:7775132-7775154 AAGGAGGGAGGGAAGGAAGTAGG + Intergenic
1133663059 16:7937530-7937552 CAGTAAGTAAGGAAGGAAGTGGG - Intergenic
1133699041 16:8291947-8291969 TAGAAGGTATGGAGGGGAGTGGG + Intergenic
1134109162 16:11503921-11503943 TAGGAAGGAAGGAAGGAAGCAGG - Intronic
1134219230 16:12340477-12340499 TAGTAAGGATGGATGGATGTGGG + Intronic
1134394964 16:13854247-13854269 GAGGAGGGAGGGAAGGAAGGAGG + Intergenic
1134411089 16:14003700-14003722 TGGCAGGGAGGGAAGGAAGAAGG - Intergenic
1134833134 16:17339831-17339853 AAGGAGGGAAGGAAGGAAGAAGG - Intronic
1134905618 16:17977306-17977328 TAATTGGGATGGCAGGAAGGGGG - Intergenic
1135480815 16:22818971-22818993 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1135480874 16:22819156-22819178 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1135583195 16:23645561-23645583 TATCAGCAATGGAAGGAAGTAGG - Intronic
1135735417 16:24927569-24927591 TAGTAGGGATGCAAGCAGGCAGG + Intronic
1135779688 16:25289546-25289568 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1136588952 16:31205593-31205615 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1137753755 16:50885651-50885673 CAGTAGGGCTGGAATGCAGTAGG - Intergenic
1137877918 16:52014891-52014913 TAGGAGGGAGGGAAGGAAGGAGG - Intronic
1138195831 16:55051503-55051525 AAGAAAGGAGGGAAGGAAGTGGG + Intergenic
1138647658 16:58436880-58436902 AAGGAGGGATGGATGGAAGAGGG - Intergenic
1138991642 16:62397270-62397292 AAGCAGGGAGGGAAGGAAGCAGG + Intergenic
1139173681 16:64662383-64662405 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1139173690 16:64662411-64662433 AAGGAGGGAGGGAAGGAAGAAGG - Intergenic
1139173703 16:64662451-64662473 AAGGAGGGAGGGAAGGAAGGAGG - Intergenic
1139173717 16:64662491-64662513 AAGGAGGGAGGGAAGGAAGGAGG - Intergenic
1139173761 16:64662627-64662649 AAGGAGGGAGGGAAGGAAGGAGG - Intergenic
1139173778 16:64662675-64662697 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1139173802 16:64662755-64662777 AAGGAGGGAGGGAAGGAAGGAGG - Intergenic
1139173808 16:64662771-64662793 AAGGAGGGAGGGAAGGAAGGAGG - Intergenic
1139439532 16:66958963-66958985 GAGGAAGGAAGGAAGGAAGTGGG + Intergenic
1140379103 16:74470342-74470364 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1140379122 16:74470398-74470420 TAGGATGGATGGATGGAAGGAGG - Intronic
1140914591 16:79482885-79482907 AGGTAGGGAGGGAAGGAAGGAGG - Intergenic
1140997215 16:80272602-80272624 AAGTAGGGAAAGAAGGAAGGAGG + Intergenic
1141354253 16:83328886-83328908 TAGCAGGGATAAAAGGAAGGTGG + Intronic
1141427112 16:83951801-83951823 AAGGAGGGATGGAAGGAGGGAGG - Intronic
1141427147 16:83951911-83951933 AAGTAGGGAGGGAAGGAGGGAGG - Intronic
1141427176 16:83951983-83952005 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1141427188 16:83952019-83952041 AAGTAGGGAGGGAAGGAGGGAGG - Intronic
1141732919 16:85834336-85834358 AAGGAGGGAGGGAAGGAAGGAGG + Intergenic
1203144062 16_KI270728v1_random:1788023-1788045 AAGAAGGGATGGAAAGAGGTTGG + Intergenic
1142591719 17:1009204-1009226 TAGTGGGGATGGACAGCAGTGGG - Intronic
1142654973 17:1385640-1385662 GAGGAGGGAAGGAAGGAAGACGG + Intronic
1142702169 17:1669607-1669629 TAGTAGGGATGGAAGCCAGATGG - Intronic
1143294821 17:5863169-5863191 AAGGAGGGAAGGAAGGAAGGGGG - Intronic
1143669821 17:8388992-8389014 AAGGAAGGAAGGAAGGAAGTTGG - Intergenic
1144027125 17:11287230-11287252 AAGAAGGGAAGGAAGGAAGGAGG + Intronic
1144489994 17:15700212-15700234 CAGGAGGGAAGGCAGGAAGTGGG + Exonic
1144910967 17:18681747-18681769 CAGGAGGGAAGGCAGGAAGTGGG - Exonic
1145194391 17:20876504-20876526 TAGAAGGGCTGGAGGGAATTAGG + Intronic
1145262753 17:21364634-21364656 AACCAGGGATGGATGGAAGTGGG - Intergenic
1145297647 17:21604559-21604581 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1146051584 17:29558287-29558309 AAGGAAGGATGGAAGGAAGGAGG - Intergenic
1146086333 17:29833714-29833736 AAGTAGGGAGGGAGGGAAGGAGG - Intronic
1146545508 17:33734538-33734560 TAGTAGTGAGTGAAGGAAGAGGG - Intronic
1146634047 17:34491081-34491103 GAGGAAGGAGGGAAGGAAGTAGG + Intergenic
1146728571 17:35174979-35175001 AAGGAGGGAGGGAAGGAAGGAGG + Intronic
1147511869 17:41076855-41076877 AAGAAGGGAAGGAAGGAAGAAGG + Intergenic
1147511879 17:41076900-41076922 AAGAAGGGAAGGAAGGAAGAAGG + Intergenic
1147511883 17:41076916-41076938 AAGAAGGGAAGGAAGGAAGAAGG + Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1149036204 17:52136769-52136791 TGTTATGGATGGAAGGAAGGAGG + Intronic
1150506822 17:65707315-65707337 TACTAGAGATGGAGAGAAGTGGG - Intronic
1150645712 17:66976389-66976411 ATGGAGGGATGGAAAGAAGTTGG - Intronic
1151275035 17:73027915-73027937 TTGTTGGGGTGAAAGGAAGTGGG - Intronic
1151512709 17:74571059-74571081 CAGTGGGGAGGGAAGAAAGTGGG - Intergenic
1151656915 17:75500520-75500542 TAGCAGGGGTGGGAGGCAGTGGG - Exonic
1151999859 17:77638462-77638484 TAGGAGAGACGGAAAGAAGTGGG + Intergenic
1152047935 17:77950722-77950744 TATGATGGATGGAAGGAAGGAGG + Intergenic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1153030771 18:711421-711443 CAGTAGGGAGGGAAGGAAATGGG - Intronic
1153253751 18:3149964-3149986 TAGAAAGGAGGGCAGGAAGTTGG + Intronic
1153648631 18:7218932-7218954 TCTCAGGGATGCAAGGAAGTGGG - Intergenic
1153998434 18:10462626-10462648 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1154155181 18:11938836-11938858 TGTTTGGGATGGAAGGCAGTAGG - Intergenic
1155630595 18:27887702-27887724 AAGAAGGGATGGAAGGAAGGAGG - Intergenic
1155968538 18:32058758-32058780 TAGTGGGGATTGGGGGAAGTGGG - Intronic
1156003900 18:32417729-32417751 TAGTGGGGGTGGGAGGAAGGTGG + Intronic
1156924164 18:42556652-42556674 TAGGCGGGAGGGAAGGAAGGAGG + Intergenic
1156965094 18:43081897-43081919 TAGTCAGGAAGGAAGGAAGAAGG - Intronic
1157147323 18:45177174-45177196 GAGTAGGAATGGCAGGAAGTGGG - Intergenic
1157474548 18:48012893-48012915 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1158005058 18:52662647-52662669 AACAAGGGATGGAAGGAAGGAGG + Intronic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158836813 18:61339482-61339504 TGGGAAGGCTGGAAGGAAGTTGG - Intronic
1158998666 18:62950557-62950579 TAGAATGGATGGAAGAAAGTGGG + Intronic
1159225031 18:65522924-65522946 AAGGAGGGAGGGAAGGAAGGAGG + Intergenic
1159422670 18:68243339-68243361 AAGTTAGGATTGAAGGAAGTAGG - Intergenic
1160266633 18:77344251-77344273 GAGACGGGATGGAAAGAAGTGGG - Intergenic
1161141573 19:2651220-2651242 AAGGAAGGAAGGAAGGAAGTCGG - Intronic
1161259983 19:3332491-3332513 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1161259996 19:3332531-3332553 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1161260025 19:3332619-3332641 AAGTAGGGAAGGAAGGATGGAGG - Intergenic
1161260045 19:3332688-3332710 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1161260050 19:3332704-3332726 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1161260070 19:3332765-3332787 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1161260075 19:3332781-3332803 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1161789279 19:6349370-6349392 AAGGAGGGAGGGAAGGAAGGAGG + Intergenic
1161920040 19:7259172-7259194 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1161994235 19:7702661-7702683 TAGGAGGGAAGGAGGGAAGCGGG + Intergenic
1162451547 19:10758266-10758288 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1162451553 19:10758282-10758304 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1162451564 19:10758310-10758332 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1162451574 19:10758338-10758360 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1162451580 19:10758354-10758376 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1162451599 19:10758406-10758428 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1162451612 19:10758438-10758460 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1162451618 19:10758454-10758476 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1162451624 19:10758470-10758492 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1162788561 19:13051376-13051398 TACTAGGGATGGAAGGGAAGAGG + Intronic
1163093282 19:15036116-15036138 AAGGAGGGAAGGAAGGAAGAGGG + Intergenic
1163103318 19:15110006-15110028 TCGTAGGGCCGGAAGGAGGTGGG - Exonic
1163286252 19:16350057-16350079 TAGCAGGGAAGGAAGGAAACAGG + Intergenic
1163763568 19:19150117-19150139 AAGGAGGGATGGAAGGAAGGAGG + Intronic
1164726075 19:30466710-30466732 TAGGAAGGAAGGAAGGAAGGAGG + Intronic
1164744266 19:30599467-30599489 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1164744271 19:30599483-30599505 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1164925703 19:32128393-32128415 GAGGAGGGAGGGAAGGAAGGGGG + Intergenic
1165151270 19:33761837-33761859 AAGAAAGGAAGGAAGGAAGTGGG + Intronic
1166141236 19:40806531-40806553 TGGCAGGGATGGAGGGAGGTAGG - Intronic
1166337709 19:42118361-42118383 GAGTAGGGGTGGATGGAGGTGGG + Intronic
1166887540 19:45971399-45971421 CAGGAAGGAGGGAAGGAAGTCGG + Intronic
1167046008 19:47049081-47049103 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1167133521 19:47602951-47602973 GAGAAGGGAAGGAAGGAAGGAGG + Intergenic
1167206474 19:48105862-48105884 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1167222916 19:48214741-48214763 TAGCAGGAATGAAAGGAAGGAGG - Intronic
1167283631 19:48586330-48586352 CAGGAAGGGTGGAAGGAAGTTGG + Intronic
1167393597 19:49212577-49212599 AAGGAAGGAAGGAAGGAAGTAGG - Intergenic
1167751233 19:51381391-51381413 TATCAGGGAAGAAAGGAAGTTGG + Intronic
1168109172 19:54181972-54181994 AAGGAGGGAGGGAAGGAAGGAGG + Intronic
1168109189 19:54182016-54182038 AAGGAGGGAGGGAAGGAAGGAGG + Intronic
1168109193 19:54182032-54182054 AAGGAGGGAAGGAAGGAAGAAGG + Intronic
1168114096 19:54211363-54211385 GAGTAGGGATGGGAGCCAGTAGG + Intronic
925458857 2:4042827-4042849 CAGCAGAGATGTAAGGAAGTTGG - Intergenic
925461897 2:4070379-4070401 GAGTAGGGATGCCAGGAAGCTGG + Intergenic
925644170 2:6019235-6019257 TTGTAGGGAAGTAAGGAATTAGG + Intergenic
925791043 2:7488627-7488649 AAGGAGGGAGGGAAGGAAGGAGG + Intergenic
925791087 2:7488778-7488800 AAGGAGGGAGGGAAGGAAGGAGG + Intergenic
925791193 2:7489142-7489164 AAGGAGGGAGGGAAGGAAGGAGG + Intergenic
926244581 2:11113522-11113544 AAGGAGGGAGGGAAGGAAGAAGG - Intergenic
926244593 2:11113558-11113580 AAGGAGGGAGGGAAGGAAGGAGG - Intergenic
926244599 2:11113574-11113596 AAGGAGGGAGGGAAGGAAGGAGG - Intergenic
926244616 2:11113622-11113644 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
926244621 2:11113638-11113660 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
926244626 2:11113654-11113676 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
926398169 2:12467360-12467382 GAGGAAGGAAGGAAGGAAGTGGG - Intergenic
926464735 2:13174458-13174480 TAGTTGGGAGGGAAAGAGGTGGG - Intergenic
927338352 2:21951653-21951675 AAGAAAGGATGGAAGGAAGGAGG + Intergenic
927515805 2:23671007-23671029 TAGGAGGGAAGGGAGGAGGTGGG - Intronic
927562974 2:24086492-24086514 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
927867043 2:26595821-26595843 TAGTAGTGATGGGAGGGAGGTGG + Intronic
927875913 2:26655151-26655173 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
927875918 2:26655167-26655189 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
927875932 2:26655215-26655237 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
927875937 2:26655231-26655253 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
927875942 2:26655247-26655269 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
927875947 2:26655263-26655285 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
928301290 2:30127443-30127465 AAGGAGGGAGGGAAGGAAGGAGG + Intergenic
928704530 2:33933524-33933546 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
928898116 2:36288189-36288211 TAGTAGTGATGGAAGAGAGTTGG - Intergenic
929505186 2:42522767-42522789 AAGGAGGGAGGGAAGGAAGAAGG + Intronic
929592206 2:43154700-43154722 GAGTGGGGATGGATGGAGGTTGG + Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
931121665 2:59226508-59226530 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
931121670 2:59226524-59226546 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
931121675 2:59226540-59226562 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
932337942 2:70941711-70941733 AAGCAGGGAGGGAAGGAAGAAGG + Exonic
932602175 2:73135319-73135341 AAGGAGGGAAGGAAGGAAGGAGG + Intronic
932734387 2:74244402-74244424 AAGGAGGGAGGGAAGGAAGGGGG - Intronic
933360869 2:81282517-81282539 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
933362717 2:81308408-81308430 AAGGAAGGATGGAAGGAAGGAGG - Intergenic
933679097 2:85083247-85083269 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
934760995 2:96857151-96857173 TAGGAGGGGCGGAGGGAAGTAGG + Intronic
935909736 2:107882332-107882354 TATTTGGGTTGGAAGGAAGAGGG - Intronic
935943987 2:108269684-108269706 TGGTAGGGTTTGAAGGAAGTTGG - Intergenic
936060858 2:109294900-109294922 AAGCAGGGAGGGAAGGAAGTGGG + Intronic
936169023 2:110151654-110151676 TATTAGCAATCGAAGGAAGTGGG - Intronic
936558780 2:113518577-113518599 TAGTGGGCATGGAAGGGAGGGGG + Intergenic
936768874 2:115887587-115887609 AAGGAAGGATGGAAGGAAGAAGG - Intergenic
937818176 2:126276313-126276335 AAGGAGGGAGGGAAGGAAGGAGG + Intergenic
937818187 2:126276345-126276367 AAGGAGGGAGGGAAGGAAGGAGG + Intergenic
937818198 2:126276377-126276399 AAGGAGGGAGGGAAGGAAGGAGG + Intergenic
937821599 2:126316681-126316703 TTGTGGGGAAGGAAGGAAGGAGG - Intergenic
938761041 2:134426202-134426224 AAGGAAGGAAGGAAGGAAGTCGG - Intronic
940235118 2:151502934-151502956 GAGTAAGGAAGGAAGGAAATGGG + Intronic
940397025 2:153201405-153201427 TGGCAGGGAGGGAAGGAATTAGG - Intergenic
940460901 2:153961226-153961248 TAGCAGGGAAGAAAGGAATTTGG + Intronic
940632129 2:156253268-156253290 TATTTGTGATAGAAGGAAGTTGG + Intergenic
941114323 2:161454277-161454299 TGGGAGGGATGGAGGGAAGAAGG - Intronic
942135971 2:172925931-172925953 GAGGAGGGAGGGAAGGAAGGAGG + Intronic
942217712 2:173738398-173738420 AAGGAAGGAAGGAAGGAAGTGGG + Intergenic
942409909 2:175698002-175698024 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
943055492 2:182972893-182972915 GAGTAGGGAAGGTAGGAAGTGGG + Intronic
943729094 2:191282807-191282829 AAGTAGGGAAGGAAGGAGGAGGG + Intronic
945020309 2:205564404-205564426 TATTTTGGCTGGAAGGAAGTGGG - Intronic
945205675 2:207329346-207329368 TGGTAGGGGTGGAAGTAAGATGG + Intergenic
945494200 2:210490050-210490072 AAGAAAGGATGGAAGGAAGAAGG + Intronic
946530406 2:220564276-220564298 GAGGAGCGATGGAAGGAAGGAGG - Intergenic
946766208 2:223043396-223043418 AATTATGGATGGCAGGAAGTGGG - Intergenic
947377464 2:229511160-229511182 AAAAAGGGATGGAATGAAGTGGG - Intronic
948211992 2:236201119-236201141 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
948282726 2:236760321-236760343 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
948434933 2:237946609-237946631 AAGGAGGGAAGGAAGGAAGAAGG + Intergenic
1169382891 20:5124144-5124166 TAGGAAGGATTCAAGGAAGTAGG + Intronic
1170331204 20:15212880-15212902 TAGTAGGTCTGGAATGGAGTAGG - Intronic
1171152811 20:22842657-22842679 TAGTAGGGCTGGGAGCAAGGTGG + Intergenic
1171327301 20:24305774-24305796 AAGAAGGGAAGGAAGGAAGGAGG - Intergenic
1171562925 20:26144159-26144181 TAGAAGGGCTGGAGGGAATTAGG + Intergenic
1171862402 20:30412933-30412955 AAGTAGGGAGGGAGGGAGGTAGG + Intergenic
1172220112 20:33268107-33268129 TATAAGGGAGGGAAGGAAGCAGG - Intergenic
1172321970 20:34002338-34002360 GATTAGGGATGGAAGGCTGTTGG - Intronic
1172839519 20:37893844-37893866 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1173201678 20:40959569-40959591 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1173215315 20:41076308-41076330 TAGTAGGGGAGGAAGGAACGTGG + Intronic
1173364033 20:42369081-42369103 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1173982678 20:47236944-47236966 GAGTAGGGATGGGAGCGAGTTGG - Intronic
1174140848 20:48412615-48412637 AGGAAGGGAGGGAAGGAAGTAGG - Intergenic
1174262499 20:49306805-49306827 TAGTGAGGAAGGAAGAAAGTGGG + Intergenic
1175197293 20:57253084-57253106 AAGTGGGGATGGAAGGGGGTGGG - Intronic
1175293654 20:57894577-57894599 GAGGAGGGAAGGAAGGAAGAGGG + Intergenic
1176221396 20:63970751-63970773 GAGAAGGGAGGGAAGGAAGAAGG - Intronic
1177510757 21:22084475-22084497 AAGTAGTGATTGAAGGAAGTTGG + Intergenic
1177592918 21:23195577-23195599 GAGGAGGGATGGAATGAGGTGGG + Intergenic
1177863774 21:26488237-26488259 AAGGAAGGAAGGAAGGAAGTAGG - Intronic
1177893685 21:26836784-26836806 TGGTAGGAAAGAAAGGAAGTTGG + Exonic
1178024281 21:28447925-28447947 AAGTAGAGAAGGAAGAAAGTTGG + Intergenic
1178926452 21:36779296-36779318 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1180413442 22:12637617-12637639 AAAGAGGGAAGGAAGGAAGTAGG + Intergenic
1182201351 22:28573832-28573854 TAGTGGGGGTGGGGGGAAGTGGG - Intronic
1182234803 22:28866779-28866801 TAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1182395603 22:30033780-30033802 TAGTTGGGTTGGGAGGAAGGGGG + Intergenic
1182770435 22:32791895-32791917 AAGAAGGGATGGAAGAAAGGAGG - Intronic
1183131720 22:35843473-35843495 TAGTATGGAGGAAAGGAAGCTGG - Intronic
1183586171 22:38754540-38754562 TAGTAGGAAAAGCAGGAAGTTGG + Intronic
1183698825 22:39438240-39438262 GAGAAGGGAGGGAAGGAAGGAGG - Intergenic
1183728334 22:39602001-39602023 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1184103370 22:42353400-42353422 GAGTAGGGAAGGAAGGAGGGAGG + Intergenic
1185019385 22:48365384-48365406 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
950175659 3:10872390-10872412 AAATGGGGATGGAAGGAAGACGG - Intronic
950196288 3:11011354-11011376 TAAGTGGGATGGGAGGAAGTGGG - Intronic
951357007 3:21679690-21679712 AGGAAGGGATGGAAGGAAGGAGG + Intronic
952038283 3:29230774-29230796 AAGGATGGATGGAAGGAAGGAGG - Intergenic
952417442 3:33102197-33102219 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
952974202 3:38680330-38680352 AAGGAGAGAAGGAAGGAAGTAGG - Intergenic
953191377 3:40691082-40691104 GAGCGGGGATGGAAGGAGGTGGG - Intergenic
953439248 3:42904096-42904118 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
953680280 3:45033897-45033919 GGGAAGGGATGGAAGGAAGCAGG + Intronic
954359981 3:50116609-50116631 TAGTAGGGCAGGAAGGGTGTGGG - Intronic
955021565 3:55126635-55126657 TAGTGGGGAAGGGAGGAAGAAGG + Intergenic
955931580 3:64062782-64062804 TAGGAGAGAGGAAAGGAAGTGGG + Intergenic
956201507 3:66710921-66710943 AGGAAGGGATGGAAGGAAGGAGG - Intergenic
956538968 3:70312867-70312889 TGGCAGGGATGGAAGAAACTTGG - Intergenic
957720323 3:83987184-83987206 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
958117118 3:89234787-89234809 GAGGAGGGAAGGAAGGAAGGAGG - Intronic
958117162 3:89234964-89234986 GAGGAGGGAAGGAAGGAAGGAGG - Intronic
958154712 3:89742061-89742083 TAAAAGGGAAGGAAGGATGTAGG + Intergenic
958164641 3:89864262-89864284 TAGTAGGTTTGGAAAGAAGTAGG - Intergenic
959027586 3:101258099-101258121 TAATAGGAAAAGAAGGAAGTAGG - Intronic
959893887 3:111585500-111585522 TAATAGGGATGAAGGGAAGCTGG + Intronic
959917501 3:111832453-111832475 GAATGGGGATGGAAGGATGTGGG - Intronic
960004449 3:112767620-112767642 CAGGAGGGAGGGAGGGAAGTTGG - Intronic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
961090588 3:124107789-124107811 CATTAGGTATGGAAGGAGGTAGG + Intronic
961159185 3:124707446-124707468 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
961266497 3:125647310-125647332 TAGTCTGGATGGTAGGAAGCTGG + Intergenic
961369603 3:126421507-126421529 AAGCAGGGATGGAGAGAAGTGGG + Intronic
961640325 3:128360887-128360909 TGGGAGGGATGGAAGGTGGTGGG - Intronic
961672039 3:128540216-128540238 CAGTAGGAATGGAAAGAATTGGG + Intergenic
962015392 3:131434274-131434296 AAGGATGGATGGAAGGAAGAAGG + Intergenic
962690683 3:137895100-137895122 AAGGATGGATGGAAGGATGTTGG + Intergenic
963087446 3:141451271-141451293 TAGTGGGGATGGTAAGAAATGGG + Intergenic
963405396 3:144856678-144856700 GAGAAGGGAAGGAAGGAAGGAGG - Intergenic
963526876 3:146426198-146426220 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
963974077 3:151461047-151461069 TGGGAGGGAAGGAAGGAAGGCGG + Intergenic
964040179 3:152252180-152252202 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
964040184 3:152252196-152252218 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
964373642 3:156028322-156028344 TAGGAGGGAGGGAAGGGAGGTGG + Intergenic
964394524 3:156231547-156231569 TAGGAAGGAAGGAAGGAAGGAGG - Intronic
964532025 3:157679125-157679147 TAGTAAGCTTGGTAGGAAGTAGG + Intergenic
964820793 3:160766877-160766899 TTCTAGGAATGGAAGAAAGTAGG - Intronic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
966097394 3:176220609-176220631 TGAAAGGGAGGGAAGGAAGTGGG + Intergenic
966140487 3:176751657-176751679 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
966633702 3:182108238-182108260 TAGGAGGGATGGAAGAAGGAAGG + Intergenic
966679347 3:182624866-182624888 TAGTGTGGAAGGTAGGAAGTAGG + Intergenic
967356440 3:188577313-188577335 TATTAGGCATGGAAGTAACTAGG - Intronic
967446912 3:189577818-189577840 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
967711520 3:192713576-192713598 TAGTAAAGATGGGAGGATGTTGG - Intronic
969173427 4:5381876-5381898 AAGGAGGGAGGGAAGGAAGGAGG + Intronic
969315603 4:6379942-6379964 TAGGAGGGAGGGGAGGAAGCCGG - Intronic
971034164 4:22675115-22675137 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
971153168 4:24055429-24055451 TAGGAGGGGTGGAAGGAAGGAGG + Intergenic
971420224 4:26467738-26467760 TAGGAAGGAAGGAAGGAAGAAGG + Intergenic
971849089 4:31960228-31960250 AAAGAGGGAAGGAAGGAAGTGGG - Intergenic
972132244 4:35852191-35852213 AAGGAGAGATGGAAGGAAGGAGG + Intergenic
972164595 4:36266925-36266947 TAGAGGGGATGGAAATAAGTAGG + Intergenic
972488013 4:39560739-39560761 TAGTTGGGGTGGAAGGGGGTAGG - Intronic
972594399 4:40517109-40517131 AAGGAGGGAAGGAAGGAAGGTGG - Intronic
972766889 4:42159466-42159488 CAGTGACGATGGAAGGAAGTGGG + Intergenic
973304729 4:48633145-48633167 TCTTTGGGCTGGAAGGAAGTGGG - Intronic
973738968 4:53901547-53901569 TAAGAGGGAAGGAAGGAAGAAGG + Intronic
974191770 4:58513755-58513777 TACTGGGGATGGAAGGAAAGAGG - Intergenic
974198674 4:58610975-58610997 TAATATGGATAGAAGGAAGCTGG + Intergenic
974282499 4:59816162-59816184 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
974469881 4:62304802-62304824 TAGGAGGGAAGGAAAGAAGGAGG + Intergenic
975289715 4:72663437-72663459 AAGAAGAGAGGGAAGGAAGTAGG - Intergenic
976533604 4:86185268-86185290 TATTATGGAGGCAAGGAAGTTGG + Intronic
976979766 4:91212881-91212903 GAGTAGGGAGAGAAGGAGGTGGG - Intronic
977816016 4:101415152-101415174 AAGGAAGGAAGGAAGGAAGTAGG + Intronic
977998311 4:103523656-103523678 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
978071733 4:104480902-104480924 AAGAAAGGATGGAAGGAAGGAGG - Intronic
978079800 4:104578358-104578380 TAGTAGGGTTAGAATGAACTAGG + Intergenic
978261100 4:106760421-106760443 CAGTAAGGATGGAAAGAAGATGG + Intergenic
979563756 4:122130696-122130718 TAGATGGGATGGTAGGAAGGGGG + Intergenic
979698529 4:123640897-123640919 AAGGAGGGAGGGAAGGAAGGAGG + Intergenic
979698563 4:123640993-123641015 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
979766490 4:124470470-124470492 AAGGAAGGATGGAAGGAAGGGGG - Intergenic
981529818 4:145741463-145741485 TAGTAGGGATGGTATGAAGATGG + Intronic
981624710 4:146742573-146742595 AGGGAGGGAAGGAAGGAAGTGGG - Intronic
981668901 4:147262530-147262552 TGGTAGGGATGGGATGAACTAGG - Intergenic
982373272 4:154657745-154657767 TAGAAAGGATGGTATGAAGTTGG + Intronic
982437087 4:155392188-155392210 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
982445803 4:155489498-155489520 TAGTAGGAAGGGAAGAAAGTGGG + Intergenic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983109566 4:163732041-163732063 TACTAGGTATGCAAAGAAGTAGG + Intronic
983262881 4:165475798-165475820 TCGGAGGGGTGGAAGGAACTCGG - Intronic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984085502 4:175305811-175305833 TAGAAGAAATGGAAAGAAGTAGG + Intergenic
984497028 4:180511473-180511495 GAGGAGGGAAGGAAGGAAGGAGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985349071 4:189038398-189038420 AAGTAGGGAAGGACTGAAGTAGG - Intergenic
985648576 5:1096794-1096816 AAGGAGGGAGGGAAGGAAGGAGG + Intronic
985709264 5:1419152-1419174 TAGTATGGATGGATGGATGATGG - Intronic
986118215 5:4801779-4801801 CAGAAGAGATTGAAGGAAGTTGG - Intergenic
986178691 5:5373668-5373690 TAATAGGGAGGGAAGGAGGCTGG - Intergenic
986294012 5:6422579-6422601 AAGGAGGGAAGGAAGGAAGAGGG + Intergenic
986414278 5:7512456-7512478 TTGTAGGGATGGAAAGAATGAGG + Intronic
987384144 5:17313203-17313225 AGGTAGGGATGGGAGGAAGTAGG - Intergenic
987872594 5:23640281-23640303 TTGGAGGGAGGGAAGGAAGGAGG - Intergenic
989077176 5:37576054-37576076 TAGGAAGGAAGGAAGGAAGTTGG - Intronic
989122877 5:38021669-38021691 AAGGAGGGAAGGAAGGAAGAAGG - Intergenic
989122881 5:38021685-38021707 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
989277988 5:39610917-39610939 AAGGAGGGAGGGAAGGAAGGAGG - Intergenic
989354515 5:40528420-40528442 TAGTAGAGGAGGAAGGAAGATGG - Intergenic
989413954 5:41152022-41152044 AAGGAAGGATGGAAGGAAGAAGG + Intronic
989970980 5:50523663-50523685 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
990183097 5:53184554-53184576 AAGGAGGGATTCAAGGAAGTAGG - Intergenic
990768564 5:59216426-59216448 TAGTAGGGATGGAAGGAAGTGGG - Intronic
990852912 5:60227520-60227542 TAGAAGGGAGGGAAGGGAGGAGG + Intronic
990852923 5:60227553-60227575 TAGAAGGGAGGGAAGGGAGGAGG + Intronic
990958082 5:61363873-61363895 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
992257384 5:74934514-74934536 TAGGAGGGAAGGAAGGAGGCAGG + Intergenic
992746509 5:79825930-79825952 AAGAAGGGAAGGAAGGAAGGAGG + Intergenic
993439385 5:87936956-87936978 GAGAAAGGAAGGAAGGAAGTAGG - Intergenic
993844914 5:92929567-92929589 TGGTAGAGATAGAAAGAAGTGGG + Intergenic
994469585 5:100186141-100186163 TAGTAGGGATGTAAAGAGGTAGG + Intergenic
994731042 5:103490660-103490682 GAGGAGGGAGGGAAGGAAGGAGG - Intergenic
994965762 5:106668925-106668947 AAGGAAGGATGGAAGGAAGGAGG + Intergenic
995324555 5:110875444-110875466 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
995359195 5:111274710-111274732 TAGCAAGGATGTAAGGAAATGGG - Intronic
995404063 5:111774222-111774244 AAGAAGGGAGGGAAGGAAGAAGG + Intronic
996030431 5:118698887-118698909 TAGCAAGGATGGAAGGAGGGAGG - Intergenic
996339204 5:122417663-122417685 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
998063880 5:139140687-139140709 TACAAGGGATGGTAGGAAGCTGG + Intronic
998243157 5:140469094-140469116 GAGAAGGGAGGGAAGGAAGGAGG - Intronic
998638966 5:143987647-143987669 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
998717487 5:144902122-144902144 TAGGAGAGAGGGAAAGAAGTAGG + Intergenic
998821885 5:146064565-146064587 AAGGAGGGAAGGAAGGAAGGGGG + Intronic
999452468 5:151688643-151688665 TTGAAGGACTGGAAGGAAGTTGG - Intergenic
999470308 5:151849335-151849357 AAGGAAGGATGGAAGGAAGGGGG - Intronic
1000939863 5:167347640-167347662 AAGGAAGGATGGAAGGAAGAAGG - Intronic
1001545951 5:172570704-172570726 AGGGAGGGATGGAAGGAAGGAGG + Intergenic
1001749473 5:174117943-174117965 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1001749485 5:174117983-174118005 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1001749497 5:174118023-174118045 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1001773645 5:174313030-174313052 GAGGAGGCATGGAAGGAAGAAGG + Intergenic
1001802813 5:174558643-174558665 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1001802818 5:174558659-174558681 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1001802860 5:174558814-174558836 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1002186694 5:177458015-177458037 TGGGAGGGATGGGAGGGAGTGGG - Intronic
1002377009 5:178796056-178796078 AAGGAGGGAGGGAGGGAAGTGGG + Intergenic
1002471164 5:179437026-179437048 TATTAAGGATGGAAGGATGCAGG - Intergenic
1002647827 5:180669909-180669931 TTGTGGGGATGGAATGAGGTTGG - Intergenic
1003403392 6:5809323-5809345 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1003804840 6:9715469-9715491 TGGTAGGGATGGCAGGAAGGAGG + Intronic
1004114291 6:12750533-12750555 AAGGAGGGAAGGAAGGAAGGGGG + Intronic
1004582716 6:16969999-16970021 AAGGAGGGAGGGAAGGAAGGAGG + Intergenic
1005631058 6:27708423-27708445 AAGTAGGGAGGGAGGGAGGTAGG - Intergenic
1005883392 6:30076232-30076254 TAATAGGTAAGGAAGGAAGATGG - Intergenic
1006784899 6:36659928-36659950 GAGGAAGGATGGAAGGAAGAAGG + Intergenic
1006810645 6:36818285-36818307 AAGTATGGATGGAAGAAAATGGG - Intronic
1007528346 6:42516860-42516882 TACTAGGTATGCAAAGAAGTAGG + Intergenic
1007797692 6:44363663-44363685 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1007797700 6:44363687-44363709 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1007899729 6:45399788-45399810 AAGGAGGGAAGGAAGGAAGGAGG + Intronic
1007899796 6:45400116-45400138 GAGGAGGGAGGGAAGGAAGGAGG + Intronic
1008623114 6:53291367-53291389 AGGTAGGGGAGGAAGGAAGTGGG - Intronic
1008863198 6:56176670-56176692 AAGGAGGGAGGGAAGGAAGGAGG + Intronic
1010806775 6:80246490-80246512 TAGTAGCAATGGCAGGAAGGGGG - Intronic
1011406719 6:87022916-87022938 AAGAAAGGAAGGAAGGAAGTGGG + Intergenic
1012604066 6:101134867-101134889 TAGTAGGAATGGTAGGAATAAGG - Intergenic
1013413473 6:109903169-109903191 TTGTAGGGATTAAAGGAACTGGG + Intergenic
1013954027 6:115819600-115819622 TCATAGGGAGGGACGGAAGTGGG - Intergenic
1015383926 6:132600834-132600856 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1015383977 6:132600998-132601020 AAGGAGGGAAGGAAGGAAGGGGG + Intergenic
1015912233 6:138180480-138180502 TAGTAGGGAGAAAAGGAAGAAGG - Intronic
1016017403 6:139200176-139200198 TAGAAGAGAGGGAAGGAAGGTGG - Intergenic
1016402353 6:143694162-143694184 GAGTGGGGAGGGAAGGAAGGAGG + Intronic
1016975805 6:149806440-149806462 TAGTAAGGATAGAGAGAAGTGGG + Intronic
1018086659 6:160306869-160306891 AAGAAAGGATGGAAGGAAGGCGG + Intergenic
1018265637 6:162021837-162021859 AAGTAGGGAGGGAAAGAAGGGGG - Intronic
1018781923 6:167076110-167076132 GAGTAAGGAAGGAAGGAAGGAGG - Intergenic
1018953535 6:168393538-168393560 CAGAAGGGATGGGTGGAAGTGGG + Intergenic
1019937723 7:4267286-4267308 AAGAAGGGAGGGAAGGAAGGAGG - Exonic
1020128955 7:5548920-5548942 AAGGAGGGAGGGAAGGAAGGAGG + Intronic
1020128961 7:5548936-5548958 AAGGAGGGAGGGAAGGAAGGAGG + Intronic
1020128967 7:5548952-5548974 AAGGAGGGAGGGAAGGAAGGAGG + Intronic
1020128986 7:5549001-5549023 AAGGAGGGAGGGAAGGAAGGAGG + Intronic
1020955331 7:14733807-14733829 AAGGAGGGAAGGAAGGAAGGAGG + Intronic
1021112458 7:16710683-16710705 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1021329940 7:19324012-19324034 TAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1021403727 7:20239651-20239673 TAGAAGGAATAGAAGGAGGTGGG - Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021946286 7:25731002-25731024 CAGTAGAGATGGAAAAAAGTGGG - Intergenic
1022384549 7:29889097-29889119 TGGTTGGGATGGAGGGAAGCAGG - Intronic
1022529439 7:31057770-31057792 TAGGAGGGAGAGGAGGAAGTAGG + Intronic
1023056926 7:36298268-36298290 CAACAGGGCTGGAAGGAAGTTGG + Intronic
1023241159 7:38149116-38149138 AAGGAAGGATGGAAGGAAGAAGG + Intergenic
1023736074 7:43237123-43237145 AAGGAAGGAAGGAAGGAAGTAGG + Intronic
1023848157 7:44134845-44134867 AAGAAGGGAAGGAAGGAAGGAGG - Intergenic
1024393700 7:48843043-48843065 TAGAGGGGAGGGGAGGAAGTAGG + Intergenic
1024401548 7:48929372-48929394 TAGAGGGGAAGGGAGGAAGTAGG - Intergenic
1025606667 7:63044517-63044539 TAGTAGGGATGCAGGGAAGGGGG - Intergenic
1026019161 7:66694683-66694705 CAGTAGGGAGAGAATGAAGTCGG + Intronic
1026261448 7:68759019-68759041 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1026320206 7:69261433-69261455 TTGGAGGGATGGGAGCAAGTGGG - Intergenic
1026541256 7:71281944-71281966 TAGTAGGGATGAGAGGGAATCGG - Intronic
1026792386 7:73342663-73342685 TGGGAGGGATGGAAGTAAGCTGG - Intronic
1026927377 7:74203998-74204020 AAGGAGGGAGGGAAGGAAGGAGG + Intronic
1026927480 7:74204288-74204310 AAGGAGGGAAGGAAGGAAGGAGG + Intronic
1026927515 7:74204386-74204408 AGGGAGGGAGGGAAGGAAGTAGG + Intronic
1027047166 7:74998688-74998710 TGGTGGGGGTGAAAGGAAGTTGG + Intronic
1027201080 7:76064264-76064286 TAGTGGGGGTGGGAGGCAGTGGG + Intronic
1027571291 7:79870516-79870538 TAGGAGGGAAGAAATGAAGTCGG + Intergenic
1029178657 7:98683679-98683701 AAGGAAGGATGGAAGGAAGAAGG - Intergenic
1029257105 7:99277150-99277172 CAGTAGGGAAGGAAGGAGGGAGG + Intergenic
1029350694 7:100011090-100011112 TGGAAGGGAGGGAAGGAAGGAGG - Intergenic
1029385830 7:100242943-100242965 TGGTAGGGGTGAAAGGAAGTTGG - Intronic
1029618116 7:101672633-101672655 AAGAAGGGAAGGAAGGAAGAAGG - Intergenic
1030058894 7:105607401-105607423 ACGTAGGGATGGAAGGAATCGGG + Exonic
1030152325 7:106419926-106419948 TGGTGGTGATGGAATGAAGTGGG - Intergenic
1030507490 7:110443356-110443378 TAGGAGGGATGGCTGGAAGGTGG - Intergenic
1030690998 7:112533317-112533339 AACTAGGAAAGGAAGGAAGTGGG - Intergenic
1030990927 7:116298978-116299000 TGATAGGGCTGGAGGGAAGTGGG + Intronic
1031438250 7:121759935-121759957 TGGGAGGGAAGGAAGGAAGGAGG + Intergenic
1031483358 7:122303535-122303557 AAGGAGGGAGGGAAGGAAGGAGG + Intronic
1031795101 7:126163649-126163671 GAGTAGGGAGGGAAGAAAGTGGG - Intergenic
1031868642 7:127068094-127068116 TACGAGGGATGGAAGGAATGGGG - Intronic
1031874494 7:127123064-127123086 TAGCAGGGATGGAAGGCTGGAGG - Intronic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032172587 7:129597729-129597751 TAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1032402620 7:131634447-131634469 AAGGAGGGAAGGAAGGAAGAAGG - Intergenic
1034523490 7:151639230-151639252 TAGCAGGGATGGAGACAAGTGGG - Intronic
1034574006 7:151981590-151981612 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1035143337 7:156786269-156786291 AAGGAGGGAAGGAAGGAAGGAGG + Intronic
1035962889 8:4157440-4157462 AAGGAGGGAGGGAAGGAGGTAGG - Intronic
1036699828 8:11005394-11005416 TGGAAGGGCTGGAGGGAAGTGGG + Intronic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1038070593 8:24008521-24008543 TAGGGAGGTTGGAAGGAAGTAGG - Intergenic
1038256751 8:25957478-25957500 CAGTGGGGATGGGAGGCAGTGGG - Intronic
1038476950 8:27875255-27875277 TAGAAGGGAAGAAAGGAAGGAGG - Intronic
1038531509 8:28321548-28321570 AAGTAAGGATGGAAGGAAGAAGG - Intronic
1038891910 8:31734891-31734913 TAATAGGGATGGCTGGAAGCAGG - Intronic
1038956636 8:32475113-32475135 TAGAAGGGATGGCAGTAAGCTGG - Intronic
1039657920 8:39430424-39430446 GAGGAGGGATGTCAGGAAGTGGG - Intergenic
1039803547 8:40980434-40980456 CAGGAGGGAAGGAAGGAACTAGG - Intergenic
1040062408 8:43115222-43115244 TAGAAGGGATGGAAGGGATGAGG - Intronic
1040672928 8:49713947-49713969 TGGAAGGGAAGGAAGGAAGCTGG - Intergenic
1040880400 8:52198923-52198945 TGGTGGGGCTGGAAGGAGGTGGG - Intronic
1042230024 8:66545711-66545733 GAGGAGGGATGGAGGGAAGGAGG + Intergenic
1042245028 8:66701367-66701389 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1042889353 8:73590085-73590107 AAGTAGGGGGAGAAGGAAGTAGG + Intronic
1043045062 8:75312781-75312803 GAGAAGGAATGGAAGGAAGGAGG + Intergenic
1043196350 8:77297149-77297171 TAGTAGAGGTGGAAAGAAGCAGG - Intergenic
1043719218 8:83524839-83524861 AAGGAGGGAAGGAAGGAAGGTGG + Intergenic
1043974515 8:86569857-86569879 TAGTAGGGAAAGAAAGAAGTAGG + Intronic
1044357051 8:91234824-91234846 AAGGAAGGAAGGAAGGAAGTAGG - Intronic
1044443559 8:92247760-92247782 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1045370623 8:101518753-101518775 TAGCAGAGATGGAAAGAACTTGG - Intronic
1045412095 8:101929570-101929592 AAGGAGGGAGGGAAGGAAGGAGG + Intronic
1045412112 8:101929618-101929640 AAGGAGGGAGGGAAGGAAGGAGG + Intronic
1045659006 8:104416866-104416888 TAGTAGGGATTGTAGGGCGTGGG - Intronic
1045696016 8:104809660-104809682 TAGTGGGGATGGTAAGAAGATGG - Intronic
1045755127 8:105533753-105533775 AAGAAGGGAGGGAAGGAGGTAGG - Intronic
1045755173 8:105533900-105533922 AAGAAGGGAGGGAAGGAGGTAGG - Intronic
1045921620 8:107536867-107536889 TAGTTGTGATGGAAGCTAGTTGG + Intergenic
1046005399 8:108475589-108475611 TAGTAGTGATGGGATGTAGTAGG + Intronic
1046526756 8:115390625-115390647 TAACAGGGCTGGGAGGAAGTGGG - Intergenic
1046732998 8:117745919-117745941 TAGTAGGACTGGGAGGGAGTGGG - Intergenic
1047595993 8:126378407-126378429 TAGTAGGGAAGGAAGGAAAGAGG - Intergenic
1047868657 8:129057845-129057867 GAATAGGGATGGCAGGAAGAAGG + Intergenic
1048550784 8:135432162-135432184 GAGCAGGGATGGCAGGAAGGAGG - Intergenic
1049046756 8:140158333-140158355 TATTAGGGAAAGAAGGAAGCAGG + Intronic
1049120905 8:140736371-140736393 CAGCAGGGAGGGAAGGAGGTGGG + Intronic
1049356694 8:142192693-142192715 CAGGAGGGAGGGAAGGAAGAGGG + Intergenic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1049894070 9:97604-97626 TAGTGGGCATGGAAGGGAGGGGG - Intergenic
1049948546 9:622106-622128 TATAAGGGATGGAAGGAAAAGGG + Intronic
1050369912 9:4910144-4910166 TAGGAGAGAAGGAAGGAAGAAGG + Intergenic
1050429335 9:5546195-5546217 AAGTAGGGATGCCAGGAATTGGG - Intronic
1050992494 9:12171471-12171493 TAGTAGGGATAGAAATTAGTAGG + Intergenic
1051370942 9:16358503-16358525 TGGTAGGGATGGTGGGAAGTGGG + Intergenic
1051493544 9:17693992-17694014 TATTAGGCATGGAAGAAAGTAGG - Intronic
1051681471 9:19611784-19611806 TACTAGGGATGGGAAGAAGAAGG + Intronic
1051712613 9:19947393-19947415 AAGAAGGGAAGGAAGGAAGGAGG + Intergenic
1052301143 9:26953981-26954003 GAGTAGGGAAGGGAGCAAGTGGG - Intronic
1052342053 9:27373562-27373584 CAGTTGAGATGGAAGAAAGTGGG - Intronic
1053143421 9:35696227-35696249 TAGGAGTGATGGTAGGAGGTTGG + Intergenic
1053540626 9:38970102-38970124 AAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1053735296 9:41097688-41097710 TAGTGGGCATGGAAGGGAGGGGG - Intergenic
1054625513 9:67393804-67393826 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1054693083 9:68333709-68333731 TAGTGGGCATGGAAGGGAGGGGG + Intronic
1055822067 9:80277880-80277902 TAGAAGGGAAGGAGGGAAGGAGG - Intergenic
1056107617 9:83362819-83362841 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1056107623 9:83362835-83362857 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1056107629 9:83362851-83362873 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1056107635 9:83362867-83362889 AAGGAGGGAGGGAAGGAAGGAGG - Intronic
1056523156 9:87418750-87418772 AAGGAGGGAGGGAAGGAAGGAGG - Intergenic
1056673396 9:88651347-88651369 GAGCAGAGATGGAAAGAAGTGGG + Intergenic
1058136576 9:101314297-101314319 TATTGGGGAGGGAAGGAAGAGGG - Intronic
1058565239 9:106277087-106277109 TAGGAAGGAAGGAAGGAAGAAGG - Intergenic
1058981534 9:110175093-110175115 TAGTAGTGATGGATGGAAACAGG - Intergenic
1058989388 9:110240444-110240466 CAGTAAGGAAGGTAGGAAGTTGG - Intergenic
1059364780 9:113778196-113778218 TTTTAGGGATGGGAGGAATTTGG - Intergenic
1059541778 9:115137432-115137454 TTGCAGGGATGGAGGGAATTGGG + Intergenic
1059554820 9:115269375-115269397 TAGTTGGGTTGGGAGGCAGTGGG - Intronic
1059562864 9:115352032-115352054 AAGAAGGGAGGGAAGGAAGGAGG + Intronic
1059608549 9:115864916-115864938 AAGGAAGGAAGGAAGGAAGTAGG + Intergenic
1060081246 9:120648383-120648405 AAGAAGGGTTGAAAGGAAGTAGG - Intronic
1061344443 9:130011029-130011051 CAGCAGAGATGGAAGGAAGGTGG + Intronic
1061403435 9:130381039-130381061 TGGTAGGGTTGGAGGTAAGTGGG - Intronic
1061584145 9:131555299-131555321 TGGTAGGGAGGGCAGGAAGGTGG + Intergenic
1061743934 9:132726215-132726237 AAGGAGGGAAGGAAGGAAGGAGG - Intronic
1061962950 9:133997802-133997824 TGGGAGGGATGGATGGAAGGAGG - Intergenic
1062050611 9:134444667-134444689 GAGGAGGGAAGGAAGGAGGTAGG - Intergenic
1062097954 9:134712402-134712424 GAGTAGGGAAGGAAGGAACAGGG - Intronic
1062449200 9:136608428-136608450 GAGGAGGGAGGGAAGGAAGGAGG + Intergenic
1202802111 9_KI270720v1_random:9561-9583 AAGGAGGGAAGGAAGGAAGTAGG - Intergenic
1203626136 Un_KI270750v1:25127-25149 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1185834165 X:3329422-3329444 AAGGAGGGAAGGAAGGAAGGAGG + Intronic
1185873740 X:3685305-3685327 AAGGAGGGAAGGAAGAAAGTAGG - Intronic
1185972610 X:4681919-4681941 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1186070007 X:5808999-5809021 GAGGAGGGAAGGAAGGAAGGAGG - Intergenic
1186376413 X:9006799-9006821 GAGGTGGGATGGAGGGAAGTGGG - Intergenic
1186490815 X:9970586-9970608 AAGAAGGGAGGGAGGGAAGTAGG - Intergenic
1187149448 X:16668615-16668637 AAGGAGGGAAGGAAGGAAGAAGG + Intronic
1187480220 X:19648425-19648447 AAGGAGGGAAGGAAGGAAGGAGG + Intronic
1187911237 X:24113043-24113065 TGGAAGGGAGGGAAGGAAGGAGG - Intergenic
1188322232 X:28753893-28753915 TGGCAGGGAGGGAAGGAAGGAGG + Intronic
1188390181 X:29610285-29610307 TTGTTGAGATGGTAGGAAGTGGG + Intronic
1189675510 X:43456893-43456915 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1190047525 X:47124640-47124662 AAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1190231778 X:48587791-48587813 TAGTGGGGGTGGGAGGAGGTGGG - Intergenic
1190382716 X:49855203-49855225 AAGGAGAGAAGGAAGGAAGTAGG + Intergenic
1191975674 X:66868678-66868700 TAGGAGGGAGGGAGGAAAGTGGG - Intergenic
1192571461 X:72209604-72209626 TAGTAGAGATGGAAAGAAGGTGG - Intronic
1192683350 X:73277652-73277674 TAGGAAGGATGGAAAGAAGAGGG + Intergenic
1192704932 X:73519325-73519347 TAGTATGGACATAAGGAAGTTGG - Intergenic
1193239102 X:79144901-79144923 AAGGAGGGAAGGAAGGAAGAAGG - Intergenic
1193843345 X:86437414-86437436 TAGGAGGAATGGATAGAAGTTGG - Intronic
1194227734 X:91282026-91282048 TAGTGGGGGTGGGAGGAGGTGGG - Intergenic
1195000592 X:100639614-100639636 TGGTAGGGATGGAGGGAGGCTGG - Intronic
1195084366 X:101400366-101400388 TAGTGAAGATGGAAGGAAGTGGG + Intronic
1196348408 X:114696325-114696347 AAGTAGAGGTGGAAGGAAGAAGG - Intronic
1196468667 X:115999367-115999389 GAGTAGAGATGGAAGGGGGTAGG - Intergenic
1197883783 X:131196661-131196683 TATAAGGCATGGAAGGAAGAAGG - Intergenic
1198077104 X:133204379-133204401 CAGAAGGGATGGAAGGAACGTGG + Intergenic
1198481799 X:137047969-137047991 TGGTAGGGATGGTAGGAATAGGG + Intergenic
1198629435 X:138618380-138618402 GAGTGGGGATAGAAAGAAGTAGG - Intergenic
1198752560 X:139950216-139950238 AAGGAAGGATGGAAGGAAGGAGG - Intergenic
1198770009 X:140120463-140120485 GAGTAGTGTTGGGAGGAAGTGGG - Intergenic
1200132342 X:153857646-153857668 AAGGAAGGAAGGAAGGAAGTTGG + Intergenic
1201692096 Y:16778650-16778672 AAGTAGGAAAGAAAGGAAGTAGG + Intergenic