ID: 990769735

View in Genome Browser
Species Human (GRCh38)
Location 5:59229700-59229722
Sequence TTACCTCAGATGCAGATCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990769735_990769738 15 Left 990769735 5:59229700-59229722 CCTCAGATCTGCATCTGAGGTAA 0: 1
1: 0
2: 0
3: 11
4: 153
Right 990769738 5:59229738-59229760 GAATAAGAAAAGAAACTGGATGG 0: 1
1: 0
2: 15
3: 118
4: 1132
990769735_990769737 11 Left 990769735 5:59229700-59229722 CCTCAGATCTGCATCTGAGGTAA 0: 1
1: 0
2: 0
3: 11
4: 153
Right 990769737 5:59229734-59229756 GAAAGAATAAGAAAAGAAACTGG No data
990769735_990769739 16 Left 990769735 5:59229700-59229722 CCTCAGATCTGCATCTGAGGTAA 0: 1
1: 0
2: 0
3: 11
4: 153
Right 990769739 5:59229739-59229761 AATAAGAAAAGAAACTGGATGGG 0: 1
1: 0
2: 6
3: 114
4: 1263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990769735 Original CRISPR TTACCTCAGATGCAGATCTG AGG (reversed) Intronic
900423066 1:2564073-2564095 GTAGGTCAGATGTAGATCTGGGG - Intronic
900706527 1:4083825-4083847 TTTCCTCAGAAGCATATGTGTGG - Intergenic
903956758 1:27031466-27031488 TGACCTTGGCTGCAGATCTGAGG + Intergenic
904693595 1:32313780-32313802 TCACCTCACATGCACATCTTTGG - Intronic
906812823 1:48846674-48846696 TTATCTCACATGCAGATATAAGG + Intronic
907803313 1:57793314-57793336 TTACCTCAGATGGATGGCTGGGG + Intronic
908036430 1:60059350-60059372 TGACCTCAGCTGCTGCTCTGGGG + Intronic
908674209 1:66583998-66584020 TTACCTCAAATGCATTTCTTGGG - Intronic
912596199 1:110879265-110879287 TTACCTCAGAGGTTGTTCTGAGG - Intronic
916227262 1:162501007-162501029 GTACCTCAGCTGTTGATCTGTGG + Exonic
916435678 1:164775699-164775721 TGTCCCCAGATGCAGAGCTGAGG + Intronic
916584369 1:166137595-166137617 TTTCCTCACCTGCAGATCAGAGG + Intronic
917170015 1:172161761-172161783 TTACCTCAGAAGATGAACTGTGG - Intronic
917671337 1:177276256-177276278 CTACATCACATGCAGCTCTGAGG + Exonic
918349531 1:183639772-183639794 TAACCTGAGATGCACAGCTGTGG + Intronic
922241044 1:223755716-223755738 TGACCCCAGAGGCAGAACTGGGG + Intronic
923276878 1:232404153-232404175 TTGACTCAGATGAAGAACTGGGG - Exonic
1063197500 10:3757409-3757431 TTTGCCCAGGTGCAGATCTGTGG - Intergenic
1063608591 10:7544100-7544122 CTTCTTCAGCTGCAGATCTGGGG + Intergenic
1066365404 10:34771323-34771345 TTACCTCAGATGAAGAGGGGAGG - Intronic
1067721253 10:48729296-48729318 TTGCCTCAGGTGCAGACCTGTGG + Intronic
1068510219 10:57956457-57956479 TTAGCTGAGATACAGATGTGAGG - Intergenic
1070667397 10:78354996-78355018 AGAACTCAGAGGCAGATCTGGGG + Intergenic
1071295384 10:84215604-84215626 CTACCTCACATGCAGGTCTAGGG + Exonic
1072069248 10:91900637-91900659 TGACCTCAGATGTAAATGTGAGG + Intergenic
1072370103 10:94757659-94757681 TTCCCTCAGCTGCAGGTCTGTGG + Intronic
1074221596 10:111443582-111443604 TTTCCTCACATTCAGAGCTGTGG - Intergenic
1079356644 11:19735410-19735432 TTACCTCTGATATAGATCTTTGG - Intronic
1079411064 11:20188101-20188123 TAAGCTCATAGGCAGATCTGAGG - Intergenic
1080505703 11:32911194-32911216 TTACCTGAGATGCAGATTTAAGG - Intronic
1085948716 11:81303971-81303993 CCATCTCAGATGCAGACCTGAGG + Intergenic
1087793552 11:102432348-102432370 TGGTCTCAGATGCAGATTTGAGG + Intronic
1088253411 11:107881030-107881052 ATACTTCAGGTGTAGATCTGGGG + Intronic
1088501975 11:110491860-110491882 TTGCCTCACAGGCAGATGTGGGG - Intergenic
1088918583 11:114245264-114245286 GTCCCTCACCTGCAGATCTGGGG - Intronic
1090553888 11:127852980-127853002 CTACCTCAGAGGCAGAACTGAGG - Intergenic
1090978021 11:131692439-131692461 CTACCTCCCATGCAGATCTCTGG + Intronic
1094559101 12:31533199-31533221 TATCTTCAGATGCAGAACTGTGG - Intronic
1100044947 12:90368335-90368357 TGACCTCAGACACAAATCTGAGG + Intergenic
1100249350 12:92800252-92800274 TTACCTCATTTAGAGATCTGGGG + Intronic
1101433122 12:104643419-104643441 ATACGTCAGATGCAGAGATGGGG + Intronic
1106057047 13:26247870-26247892 TGACCTCATATGCACGTCTGTGG - Intergenic
1109287709 13:60430491-60430513 TTAATTCAGAAGCAGAACTGGGG - Intronic
1110754664 13:79158412-79158434 TTACCACAGATAAATATCTGAGG + Intergenic
1113764414 13:112872023-112872045 TTACCTCCGGTGTAGCTCTGGGG - Intronic
1113919320 13:113898073-113898095 TTATCTCAGATGGAGGGCTGAGG - Intergenic
1115589105 14:34845981-34846003 TTACTACAGTTTCAGATCTGAGG - Intronic
1117158317 14:52962475-52962497 TTTCTTCAGATGCAAATGTGGGG - Intergenic
1120486142 14:85115288-85115310 TTACCTTGGATGCACTTCTGTGG - Intergenic
1121690560 14:95875245-95875267 GTGCCTCAGAAGCAGAGCTGGGG - Intergenic
1123983178 15:25622014-25622036 TTTCCCCAGATGCACCTCTGAGG - Intergenic
1125258552 15:37795928-37795950 ATACCTAAAATGCAGCTCTGTGG - Intergenic
1125773622 15:42190340-42190362 TTACCTCAGATGTTTATCTGTGG + Intronic
1128073260 15:64810532-64810554 TACCCTCAGATGCAGATCCCAGG + Intergenic
1129188840 15:73926286-73926308 CTTCCTCAGAGGCAGGTCTGTGG + Intronic
1131610997 15:93963636-93963658 AAACCTAAAATGCAGATCTGAGG - Intergenic
1132101792 15:99028942-99028964 TTACCTGAGATGTGCATCTGGGG + Intergenic
1132511950 16:347414-347436 CCACCTCAGCTGCAGAGCTGAGG + Intronic
1135531327 16:23257389-23257411 TTTCCCCAAAAGCAGATCTGGGG + Intergenic
1136004192 16:27317310-27317332 TTGCCTCAGGTCCACATCTGAGG + Intronic
1136771067 16:32841906-32841928 GACCCTCAGCTGCAGATCTGTGG + Intergenic
1139332887 16:66207578-66207600 TTACCTCAGGGGAACATCTGTGG - Intergenic
1203073490 16_KI270728v1_random:1104019-1104041 GACCCTCAGCTGCAGATCTGTGG + Intergenic
1143409634 17:6701147-6701169 CCACCTCAGATGCTGAGCTGTGG + Intronic
1143419370 17:6776802-6776824 TTACCCCATATACAGATGTGAGG + Intronic
1144813709 17:18018673-18018695 TTCCCTCAGATCCAGAAGTGGGG - Exonic
1150888867 17:69121500-69121522 TTAGCTCAGGTGGAGACCTGAGG - Intronic
1153347232 18:4040245-4040267 TTACCTCACATGTAGTTGTGAGG + Intronic
1155045274 18:22097792-22097814 TTACCTCAGAAGCAGAGCAGAGG + Intronic
1155596307 18:27491984-27492006 ACAGCTCAGATGCAAATCTGAGG - Intergenic
1157286033 18:46378087-46378109 TTAGCTCAAATGCAAATCTCAGG - Intronic
1158561586 18:58518501-58518523 TTACCAAAGAGGCAGATTTGAGG - Intronic
1167492008 19:49798490-49798512 TTTCCTCATCTGCAGCTCTGAGG - Intronic
925542663 2:4982784-4982806 TTATCTCATCTGCAGACCTGAGG - Intergenic
925754146 2:7117757-7117779 GTAGCTGAGATGCAGATGTGGGG + Intergenic
925756431 2:7136654-7136676 TTACCACTGCTGCTGATCTGTGG + Intergenic
925897121 2:8481101-8481123 TGACCGCAGCTTCAGATCTGTGG - Intergenic
926131279 2:10304341-10304363 TTCCCGCACATGCAGATCTCGGG + Intronic
927841345 2:26446661-26446683 TTTCCTCTGAGGCAGTTCTGTGG - Intronic
928583014 2:32727637-32727659 TGACTGCAGAAGCAGATCTGAGG + Intronic
930399041 2:50859709-50859731 TTACTTGAGATGGAGAACTGTGG - Intronic
931901060 2:66788634-66788656 TTACCTTAGAGGTAGTTCTGAGG + Intergenic
940298545 2:152155319-152155341 TTAACTCTGATGCCCATCTGTGG + Intronic
940347832 2:152645915-152645937 TTGCCTCATATGCAGCTTTGTGG - Intronic
941485998 2:166083502-166083524 TTGCCTGAGATTCAGATCTCAGG + Intronic
944158407 2:196633615-196633637 TTACGTCACATGCACATCTTTGG - Intergenic
947973064 2:234340582-234340604 TTACATCAGATGAAATTCTGTGG + Intergenic
1168769547 20:406812-406834 TTATCCCAGATGAAGGTCTGAGG + Intergenic
1169385062 20:5141680-5141702 TTCCATCAGTTGTAGATCTGAGG - Intronic
1169663917 20:8012795-8012817 TTACCTCAGTGGCATATCCGAGG - Intronic
1172817737 20:37701775-37701797 TCATCTCAGCTGCAGATGTGTGG + Intronic
1172817738 20:37701815-37701837 TCATCTCAGCTGCAGATGTGTGG + Intronic
1172817739 20:37701855-37701877 TCATCTCAGCTGCAGATGTGTGG + Intronic
1172817740 20:37701895-37701917 TCATCTCAGCTGCAGATGTGTGG + Intronic
1172817741 20:37701935-37701957 TCATCTCAGCTGCAGATGTGTGG + Intronic
1174124256 20:48291089-48291111 TGACCACAGAGGCAGGTCTGGGG - Intergenic
1174223990 20:48982237-48982259 GTCCCTCAGCTGCAGGTCTGTGG + Intronic
1176049664 20:63111262-63111284 TGACTTCAGAGGCAAATCTGAGG + Intergenic
1180117372 21:45719199-45719221 TTACCTCAGAATTAGAGCTGAGG + Intronic
949584857 3:5427616-5427638 GTACCTCAGAGGCATATCTGGGG - Intergenic
950895315 3:16444443-16444465 TTACCTAACATGCACATCTTTGG - Intronic
952750850 3:36823740-36823762 TTACCTTATATGCACATGTGAGG - Intergenic
955213470 3:56963452-56963474 TTACCTCAGGTCCAGATTTGTGG - Intronic
956644048 3:71439132-71439154 TTGCCACAGATGCAGAGCTCGGG + Intronic
957581664 3:82080966-82080988 ATGCCTCTGATACAGATCTGTGG + Intergenic
962767049 3:138574836-138574858 GTCCCTCAGCTGCAGGTCTGTGG - Intronic
963117787 3:141747152-141747174 TTCCCTCAGATGCTGGTGTGTGG - Exonic
964885344 3:161476040-161476062 TTACATGAGATACACATCTGGGG + Intergenic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
968276145 3:197441888-197441910 TAGCCTAAGAAGCAGATCTGGGG + Intergenic
968333372 3:197891227-197891249 TTTCCCCAGATGAAGAGCTGGGG + Intronic
970803799 4:20006379-20006401 TTAAATTAGATGCAGCTCTGAGG - Intergenic
971517827 4:27511012-27511034 TTACAACAAATGCAGCTCTGTGG - Intergenic
974704569 4:65495495-65495517 TCACCTCACATCCAGAGCTGCGG - Exonic
976975941 4:91166121-91166143 TTACATCAGATACAGAAGTGAGG + Intronic
979029047 4:115616695-115616717 TTACCTAACATGCTGTTCTGAGG + Intergenic
979123350 4:116931728-116931750 TTAACTCAGAGGCATATTTGAGG - Intergenic
982538260 4:156634400-156634422 ATAACTTAGATGCAGATCAGAGG - Intergenic
983767260 4:171499732-171499754 TTACCACAGAGGAAGACCTGAGG - Intergenic
984656846 4:182327905-182327927 TTTCCTCTGCTGCAGCTCTGTGG + Intronic
986228634 5:5840991-5841013 GTACCCCAGAAGGAGATCTGAGG - Intergenic
986428005 5:7654033-7654055 TTCTCTCAAATGCAGATCTCTGG - Intronic
987576279 5:19732955-19732977 TTCCCTCAGAGGCCTATCTGAGG - Intronic
988354855 5:30160998-30161020 TTCCCTCTGATCCAGTTCTGGGG - Intergenic
989198090 5:38735421-38735443 TTATCTAAAAAGCAGATCTGTGG + Intergenic
989737021 5:44720049-44720071 TAACTTCAGATTCAAATCTGTGG + Intergenic
990523321 5:56600809-56600831 TAACAACAGATGCTGATCTGTGG + Intronic
990769735 5:59229700-59229722 TTACCTCAGATGCAGATCTGAGG - Intronic
992053606 5:72964814-72964836 TTTCCACAGTTTCAGATCTGAGG + Intronic
994684736 5:102935303-102935325 CAACAACAGATGCAGATCTGTGG - Intronic
996073944 5:119166763-119166785 TTACCTCAATTGCATCTCTGAGG - Exonic
996520337 5:124418927-124418949 TCACCTAAGATGAAAATCTGGGG - Intergenic
997283240 5:132661562-132661584 TTACCTCAGATGAGGCTCTGAGG - Intergenic
1000427953 5:161115223-161115245 TTACCGGAAATGCAGATCTAAGG - Intergenic
1001228295 5:169964142-169964164 ATAATTCAGATGCAGATTTGGGG + Intronic
1001796361 5:174505420-174505442 TCACCCCAGAGGCAGATCTCAGG - Intergenic
1003911693 6:10749193-10749215 TTTCCCCAGATGCAGGCCTGGGG + Exonic
1007112467 6:39320823-39320845 TCACCTCCAATGCAGAGCTGAGG + Intronic
1008888194 6:56454346-56454368 TTACCTCAGAAGCAGGTTTTAGG - Intergenic
1009504403 6:64457022-64457044 TTACCTCAAAAGCAGTTCTAAGG - Intronic
1011915172 6:92495189-92495211 TTTCCTCAGTTGCAGAGCTTTGG - Intergenic
1012763353 6:103332078-103332100 TTACCTTAGATGCAATGCTGTGG + Intergenic
1012991979 6:105935298-105935320 GCACCTGGGATGCAGATCTGGGG + Intergenic
1017047890 6:150364466-150364488 TTACCTTAGAAGAAGAGCTGTGG - Intergenic
1017264254 6:152423876-152423898 TGACATCAGATTAAGATCTGTGG - Intronic
1018022752 6:159777241-159777263 TAACCTCAGTTACATATCTGTGG - Intronic
1020485923 7:8720392-8720414 CTACATCACAGGCAGATCTGTGG + Intronic
1021477238 7:21076149-21076171 TTTTCTCAGAGGCTGATCTGTGG - Intergenic
1027816959 7:82987132-82987154 TTTCCACAGATGGAAATCTGAGG + Intronic
1028457420 7:91053659-91053681 TTTCCTCATTTGCAGATGTGAGG + Intronic
1030683111 7:112452915-112452937 TTACCTCAGAAGTGGAGCTGGGG + Intronic
1031839721 7:126723366-126723388 TTACTACAGATGTAGACCTGCGG + Intronic
1033789572 7:144775444-144775466 GTGCCCCAGATGCAGATCTTTGG + Intronic
1035420413 7:158724957-158724979 TTACCTCAAAGGCAGAACTGAGG - Intergenic
1046324211 8:112619583-112619605 TGGCCACAGATGCAAATCTGTGG - Intronic
1046704977 8:117439683-117439705 ATACATCACCTGCAGATCTGGGG + Intergenic
1050068488 9:1786116-1786138 GTATCTCAGAAGCAGACCTGAGG + Intergenic
1050270481 9:3939181-3939203 TTCTCTCAGATCAAGATCTGAGG - Intronic
1057031001 9:91775242-91775264 TTCCCCCGGATGCAGACCTGTGG - Intronic
1058136681 9:101315640-101315662 TTACGTAAGACCCAGATCTGTGG + Intronic
1058620744 9:106880192-106880214 TTGCCTCAGATGCTGATCAGTGG + Intronic
1061779946 9:132989599-132989621 TCACCTCAGAGGCAGAGATGAGG + Intronic
1187586973 X:20674093-20674115 TTACCTAACATGCACATCTTTGG + Intergenic
1194840245 X:98731660-98731682 ATACTTCCTATGCAGATCTGCGG - Intergenic
1195422765 X:104694047-104694069 GAACCTCATATGCAGCTCTGTGG + Intronic