ID: 990773391

View in Genome Browser
Species Human (GRCh38)
Location 5:59276935-59276957
Sequence GTGTAGATGTTCAGAGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 295}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990773391_990773393 -2 Left 990773391 5:59276935-59276957 CCTATCTCTCTGAACATCTACAC 0: 1
1: 0
2: 0
3: 15
4: 295
Right 990773393 5:59276956-59276978 ACAGAGGATATATACTCCTCTGG 0: 1
1: 0
2: 1
3: 4
4: 134
990773391_990773396 22 Left 990773391 5:59276935-59276957 CCTATCTCTCTGAACATCTACAC 0: 1
1: 0
2: 0
3: 15
4: 295
Right 990773396 5:59276980-59277002 TGTGCCAACTTCAATTATTTTGG 0: 1
1: 0
2: 2
3: 10
4: 188
990773391_990773394 -1 Left 990773391 5:59276935-59276957 CCTATCTCTCTGAACATCTACAC 0: 1
1: 0
2: 0
3: 15
4: 295
Right 990773394 5:59276957-59276979 CAGAGGATATATACTCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990773391 Original CRISPR GTGTAGATGTTCAGAGAGAT AGG (reversed) Intronic
900202355 1:1415244-1415266 GTCTAGTTGTTTTGAGAGATAGG + Intergenic
905553258 1:38860209-38860231 TTGAAGATGAACAGAGAGATCGG + Intronic
908840423 1:68274871-68274893 GTGTACATTTTCAAAAAGATAGG + Intergenic
908864375 1:68529543-68529565 CTGTATATGGTCACAGAGATAGG + Intergenic
913079929 1:115374243-115374265 GTGTGGAGAGTCAGAGAGATTGG - Intergenic
916681369 1:167108201-167108223 GAGTGGATGTACAGACAGATGGG - Intronic
917115954 1:171603766-171603788 GTCTAGTTGTTTTGAGAGATAGG - Intergenic
917281703 1:173383285-173383307 GTGCATGTGTTCAGAGAAATAGG + Intergenic
918004520 1:180529254-180529276 ATGAAGATGCTCAGAGAGGTTGG - Intergenic
918571342 1:185996800-185996822 ATGGAGCTGTTCAGAGACATGGG + Intronic
921074774 1:211691553-211691575 GTCTAGTTGTTTTGAGAGATAGG - Intergenic
921231372 1:213075530-213075552 TTGGAGCTGTTCAGTGAGATAGG - Intronic
921563623 1:216688874-216688896 GTGTATATATTCAGAAAGAGTGG + Intronic
921927285 1:220721917-220721939 GTCTAGTTGTTTTGAGAGATAGG - Intergenic
921965699 1:221086479-221086501 GTGCATATGGACAGAGAGATTGG + Intergenic
924858943 1:247901344-247901366 GTCTAGTTGTTTTGAGAGATAGG + Intergenic
1063081506 10:2772182-2772204 GTGCAGATGTTGAGAAATATAGG - Intergenic
1064397315 10:14992294-14992316 GTCTAGTTGTTGAGAGAGGTAGG + Intergenic
1065802285 10:29363471-29363493 GTCTAGTTGTTTTGAGAGATAGG + Intergenic
1065931148 10:30480181-30480203 GTCTAGTTGTTTTGAGAGATGGG - Intergenic
1066000500 10:31100719-31100741 AGGTAGACGGTCAGAGAGATTGG - Intergenic
1068425154 10:56850903-56850925 GTGAAGATGTTCAAAAAGAGAGG + Intergenic
1068671666 10:59729488-59729510 GTCTAGTTGTTTTGAGAGATAGG + Intronic
1069353535 10:67557946-67557968 GTGGCCATGTTTAGAGAGATAGG - Intronic
1070405116 10:76087569-76087591 GTGTAGCTGTAGAGAGAGATGGG + Intronic
1071257704 10:83887658-83887680 ATGCAGATGTTCAAAGAGCTTGG - Intergenic
1071916941 10:90303362-90303384 ATGTGCATATTCAGAGAGATAGG - Intergenic
1072035392 10:91558584-91558606 AAGCAGATGTTCAGAGAGGTAGG + Intergenic
1076270346 10:129147197-129147219 GTGTAACTGTCCAGAGAAATGGG + Intergenic
1079549800 11:21680855-21680877 ATGTAGATTTTTAGAGAGATTGG + Intergenic
1080798355 11:35586841-35586863 GGGTAGAGGGTCAGAGAGGTAGG + Intergenic
1081738344 11:45420823-45420845 GTGTAGATGGTTAGGTAGATGGG - Intergenic
1081811337 11:45915766-45915788 GTGGAGGTGTTCATGGAGATGGG - Exonic
1083090020 11:60190157-60190179 GTCTAGTTGTTTTGAGAGATAGG - Intergenic
1083264767 11:61541658-61541680 CTATAGAAGGTCAGAGAGATGGG + Intronic
1084227803 11:67728271-67728293 GTCTAGTTGTTGAGAGAGGTAGG + Intergenic
1084244805 11:67849770-67849792 GTCTAGTTGTTTAGAGAGGTAGG + Intergenic
1084807424 11:71588595-71588617 GTCTAGTTGTTGAGAGAGGTAGG - Intronic
1084811448 11:71614144-71614166 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
1084827881 11:71744787-71744809 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
1084844514 11:71888603-71888625 GTCTAGTTGTTGAGAGAGGTAGG - Intronic
1085476365 11:76791647-76791669 CTGTGGATGCTCAGAGAGATTGG - Intronic
1085718500 11:78893350-78893372 CTGTGGATGCTTAGAGAGATTGG - Intronic
1085869261 11:80330106-80330128 GTGTAGATGTCCACAGTAATGGG - Intergenic
1085998876 11:81954939-81954961 GTTTAGTTGTTTTGAGAGATAGG - Intergenic
1086381148 11:86255535-86255557 GTGCAGATGTCTATAGAGATAGG + Intronic
1086827316 11:91515563-91515585 GTGTAGGAGTTCAGATAAATAGG - Intergenic
1086973323 11:93106531-93106553 GTCTAGCTGTTTTGAGAGATAGG + Intergenic
1087394189 11:97575406-97575428 GTGTAATTTTTCATAGAGATGGG - Intergenic
1088203053 11:107361123-107361145 TTGTGTATGTTCAGAGATATGGG + Intronic
1088619581 11:111668105-111668127 GTGGAGATATTCAGAGGGAATGG + Intronic
1089280884 11:117373570-117373592 GTGCACATGTCCAGAGAGAATGG + Intronic
1091814383 12:3425377-3425399 GTCTAGTTGTTTAGAGAGGTAGG + Intronic
1092411595 12:8257346-8257368 TTTTTGTTGTTCAGAGAGATGGG - Intergenic
1092415374 12:8286917-8286939 GTCTAGTTGTTTAGAGAGGTAGG + Intergenic
1092849442 12:12613171-12613193 GGGTAGATGTAAAGAGAGAAAGG - Intronic
1093808805 12:23467955-23467977 ATGTTGATGTTCAGAGATATTGG - Intergenic
1094366467 12:29688262-29688284 TTTTAGATATTTAGAGAGATGGG - Intronic
1095974156 12:47927863-47927885 ATGTATATGTTCAGAGTGGTGGG + Intronic
1098086437 12:66849339-66849361 AAGTAGATGTTTAGAGAGAAAGG - Intergenic
1098156668 12:67606713-67606735 GTGTAGGTGGTCAGAGAAAGTGG - Intergenic
1098248522 12:68544938-68544960 GTCTAGTTGTTTTGAGAGATAGG - Intergenic
1098336172 12:69407114-69407136 GTATAAATGTTAAGAGAAATTGG - Intergenic
1099249677 12:80237804-80237826 TTGAAGATATTCAGAGAGAGTGG + Intronic
1100117343 12:91323307-91323329 TTGTAGATGTTCAAAGAAAGTGG - Intergenic
1100394021 12:94169139-94169161 GTGTGCATGTTCAGAAAGAAGGG + Exonic
1102671931 12:114627216-114627238 GTGTAGGTATATAGAGAGATAGG - Intergenic
1104659739 12:130602298-130602320 GGTTAGGTGTTGAGAGAGATGGG - Intronic
1107940680 13:45378203-45378225 GTCTAGTTGTTCAGAGACGTAGG + Intergenic
1107941269 13:45380746-45380768 GTCTAGTTGTTCAGAGACGTAGG + Intergenic
1107941866 13:45382763-45382785 GTCTAGTTGTTCAGAGACGTAGG + Intergenic
1108053319 13:46465222-46465244 GTCTAGTTGTTCAGAGACGTAGG - Intergenic
1108054021 13:46468121-46468143 GTCTAGTTGTTCAGAGACGTAGG - Intergenic
1109537249 13:63737878-63737900 GTCTAGTTGTTTAGAGACATAGG + Intergenic
1109537695 13:63739772-63739794 GTCTAGTTGTTCAGAGACGTAGG + Intergenic
1109537819 13:63740439-63740461 GTGTAGGTGTTTAGAGACGTAGG + Intergenic
1109546987 13:63843697-63843719 GTCTAGTTGTTCAGAGACATAGG - Intergenic
1110520758 13:76473219-76473241 TTGTACTTGGTCAGAGAGATGGG + Intergenic
1111878133 13:93921561-93921583 CTGGGGAAGTTCAGAGAGATCGG - Intronic
1113163460 13:107410359-107410381 GTGTCAATGTTCAGAGACATGGG - Intronic
1113220943 13:108101775-108101797 GTATAGATGTACACAGATATGGG - Intergenic
1113619243 13:111701741-111701763 GTGGAAATGTTCTGTGAGATTGG - Intergenic
1113624772 13:111787002-111787024 GTGGAAATGTTCTGTGAGATTGG - Intergenic
1114720602 14:24877366-24877388 GAGTAGATGGACACAGAGATGGG - Intronic
1116107912 14:40535203-40535225 GTGTCTATATTCAGAGACATTGG + Intergenic
1116997758 14:51341658-51341680 GTGTAGGTATTCAGGGACATTGG - Intergenic
1118799682 14:69178122-69178144 TTGTAGATGTTTAGAGAGTTTGG + Intergenic
1119038410 14:71250060-71250082 GTGTAGAGGATAAGAGAGAGAGG - Intergenic
1120468269 14:84889304-84889326 GTGTCAATGTTCATAGAGAGTGG - Intergenic
1120859301 14:89240605-89240627 GTGTGGATGTTTACACAGATGGG - Intronic
1121394680 14:93610017-93610039 GTGAAAATGATCAGTGAGATGGG + Intronic
1123833565 15:24166048-24166070 GTGTAATTGTTTAGAGAAATAGG + Intergenic
1123869203 15:24554175-24554197 GTGTAATTGTTTAGAGAAATAGG + Intergenic
1126204735 15:46033070-46033092 GAGTGTATCTTCAGAGAGATGGG + Intergenic
1126672863 15:51132235-51132257 GTCTAGAGGTCAAGAGAGATGGG - Intergenic
1127089057 15:55448694-55448716 GTGTAGTTTTTAATAGAGATGGG - Intronic
1127622034 15:60743668-60743690 CTGGAGATGGGCAGAGAGATTGG - Intronic
1129359470 15:75015545-75015567 CTGTAGAAGGTCAGAGGGATGGG + Intronic
1129657557 15:77534294-77534316 AAGTAGATGTCCAGAGAAATAGG - Intergenic
1130872937 15:87985639-87985661 GTGCAGATGCTCAGAGGGAGGGG + Intronic
1130883065 15:88071488-88071510 ATGTAGCTGTTCAGAGATAAAGG - Intronic
1131716525 15:95117084-95117106 GTGTATATGGTGAGAGAGACAGG - Intergenic
1132350468 15:101136684-101136706 TTGTAGAGGTTCAGAGGAATGGG - Intergenic
1133472803 16:6091938-6091960 GGGTAGATGGACAGATAGATGGG - Intronic
1135849078 16:25946230-25946252 GTGCAGATGTTGAGGGACATGGG + Intronic
1135969760 16:27063703-27063725 GTGGCGATGTTCAGAGTGAAGGG - Intergenic
1136290871 16:29270657-29270679 GTGTGGATGAACAGACAGATAGG + Intergenic
1137763131 16:50956738-50956760 GTTCTGACGTTCAGAGAGATTGG + Intergenic
1137965501 16:52928560-52928582 GTGTAATTGTTCAGAGTGGTAGG - Intergenic
1143228023 17:5324406-5324428 GTGTATATATGGAGAGAGATGGG - Intronic
1143272613 17:5686971-5686993 GTGCAGATGCTCAGAGAGGAAGG + Intergenic
1145864933 17:28235122-28235144 GTCTAGTTGTTTAGAGAGATAGG + Intergenic
1147810178 17:43163215-43163237 GTCTAGTTGTTTTGAGAGATAGG + Intergenic
1149076042 17:52596892-52596914 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
1151511477 17:74563176-74563198 ATGTTGATTTTCAGCGAGATGGG - Intergenic
1152455085 17:80410484-80410506 GTCTAGTTGTTTTGAGAGATAGG - Intergenic
1154014006 18:10600398-10600420 GTCTAGTTGTTTTGAGAGATAGG + Intergenic
1156072096 18:33224371-33224393 ATGTAGATGTTTAGACAGCTAGG - Intronic
1157853847 18:51085247-51085269 GTGATGGTGATCAGAGAGATGGG + Intergenic
1158423683 18:57319963-57319985 GTGGAGCTACTCAGAGAGATGGG + Intergenic
1160248331 18:77178910-77178932 GTGAAGAATTTCAAAGAGATTGG - Intergenic
1162282030 19:9706528-9706550 GTCTAGTTGTTTTGAGAGATAGG - Intergenic
1163710479 19:18843749-18843771 GTGTTGTTGTTAAGAGAGACAGG + Intronic
1163966448 19:20751414-20751436 GTCTAGTTGTTTAGAGAGGTAGG + Intronic
1163991988 19:21007433-21007455 GTCTAATTGTTTAGAGAGATAGG - Intergenic
925317235 2:2935854-2935876 GTGCAGATGTTTAGTGAGGTCGG - Intergenic
926491316 2:13528981-13529003 GTCTAGTTGTTTTGAGAGATAGG + Intergenic
926580410 2:14628470-14628492 GGTAAGATGTTCAGAGAGCTGGG + Intergenic
928136855 2:28694263-28694285 GTGAAGGTGTGGAGAGAGATGGG + Intergenic
928209811 2:29315197-29315219 GTGTAACTGTGCAGAGAGATAGG + Intronic
929482787 2:42327002-42327024 GGGTAGAGGATAAGAGAGATGGG - Intronic
929990559 2:46782646-46782668 GAGTAGATGCTCAGAGAGCAGGG + Intergenic
930518459 2:52434898-52434920 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
930522486 2:52484970-52484992 GTGGAGATGTCAACAGAGATTGG + Intergenic
931174131 2:59835724-59835746 GTGTTGATGGCCAGAGAGGTGGG - Intergenic
931741481 2:65249639-65249661 ATTTAGATATTCAGAGTGATAGG + Intronic
933492446 2:83004035-83004057 TTCTAGAGATTCAGAGAGATGGG - Intergenic
935719349 2:105966570-105966592 CTGCAGATGTTCTGAAAGATGGG - Intergenic
935721353 2:105982122-105982144 GTCTAGTTGTTTTGAGAGATAGG + Intergenic
935970715 2:108528436-108528458 GTATAGTTGTTTTGAGAGATAGG - Intergenic
936419464 2:112349449-112349471 GTCTAGTTGTTTTGAGAGATAGG + Intergenic
937394544 2:121523627-121523649 GTGTAGATTTTAAGAGACATTGG - Intronic
938084990 2:128393746-128393768 GTCTAGAAGTACAGAGAGGTAGG - Intergenic
940869430 2:158847759-158847781 GTCTAGTTGTTTAGAGAGGTAGG - Intronic
941683224 2:168421344-168421366 GGGAATATGTTCAGAGAGAGTGG + Intergenic
944706352 2:202292802-202292824 TTGTAGATATTCATAGAGCTGGG - Exonic
945200817 2:207279167-207279189 GTATATATGTTCATAAAGATAGG + Intergenic
946149647 2:217755599-217755621 GTGTAGGTGTTCAGGAAGCTTGG - Intronic
946708885 2:222486249-222486271 GGGCAGATGTCCAGAGAGAGGGG - Intronic
1169649959 20:7855955-7855977 GTGTAGTTTTTAACAGAGATTGG + Intergenic
1170271441 20:14531382-14531404 GTGAAGATGGTCACAGAGATTGG + Intronic
1170400974 20:15982920-15982942 GTCTAGTTGTTTTGAGAGATAGG + Intronic
1171408465 20:24929620-24929642 ATGTAGTTGTTTAGAGAGGTAGG - Intergenic
1172066727 20:32226589-32226611 GTGTATATGTTTAGGGAGGTGGG - Intronic
1175513757 20:59554590-59554612 GTCTAGTTGTTTTGAGAGATAGG + Intergenic
1176721171 21:10394388-10394410 GGGTAGATGGTTAGATAGATAGG - Intergenic
1180302361 22:11047182-11047204 GGGTAGATGGTTAGATAGATAGG - Intergenic
1182653573 22:31871896-31871918 TTGAAGATGTTCACACAGATAGG + Intronic
949377500 3:3406503-3406525 GTCTAGATCTTTAGCGAGATTGG - Intergenic
949882960 3:8675936-8675958 GTCTAGTTGTTTAGAGAGGTAGG - Intronic
951248422 3:20366995-20367017 GTCTAGTTGTTTTGAGAGATAGG + Intergenic
952683925 3:36128731-36128753 TTGTATATGTTGAGAGATATGGG - Intergenic
956996134 3:74828323-74828345 GTCTAGTTGTTTTGAGAGATAGG - Intergenic
957044484 3:75363336-75363358 GTCTAGTTGTTTAGAGAGGTAGG + Intergenic
957076276 3:75605520-75605542 GTCTAGTTGTTTAGAGAGGTAGG + Intergenic
957347713 3:78983078-78983100 TTGTAGTTGTTAAAAGAGATGGG + Intronic
957999776 3:87736587-87736609 GTCTAGTTGTTTTGAGAGATAGG + Intergenic
960295028 3:115932474-115932496 GTGCAGAGGTACAGAGGGATAGG + Intronic
960374994 3:116889876-116889898 GTGTCGACGTTCAGTGAGAGTGG - Intronic
960532374 3:118779672-118779694 GTGTCCATGTTAAGAGAGACAGG + Intergenic
960555884 3:119030003-119030025 GGGAAGATGTTCAGAGAATTAGG - Intronic
960612665 3:119569376-119569398 GTTTAGATGGGCAGAGAGAATGG - Intergenic
960787829 3:121393604-121393626 TTGTATATGTTGAGAGATATGGG + Intronic
961277941 3:125742290-125742312 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
961850741 3:129815565-129815587 TTGTATATGTTCAGAGATAGGGG - Intronic
962097505 3:132307383-132307405 GTCTAGTTGTTTTGAGAGATAGG - Intergenic
963018261 3:140846443-140846465 CTGAAGATGATCAAAGAGATAGG + Intergenic
963751520 3:149184515-149184537 ATGGAGATGATCTGAGAGATTGG - Intronic
964040434 3:152254889-152254911 ATATAGAAGTTCAGAGAGGTAGG + Intronic
966089248 3:176111575-176111597 GGGTAGATGTTAAGAAATATTGG + Intergenic
967424919 3:189316125-189316147 GTGCATATGTTCAGAGAGGAGGG + Intronic
967953070 3:194855646-194855668 CTGTAGATTTTTAGAGAGTTAGG + Intergenic
969019728 4:4131819-4131841 GTCTAGTTGTTGAGAGAGGTAGG + Intergenic
969729388 4:8944944-8944966 GTCTAGTTGTTGAGAGAGGTAGG - Intergenic
969734130 4:8975593-8975615 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
969749839 4:9101612-9101634 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
969754364 4:9138731-9138753 TTTTTGTTGTTCAGAGAGATGGG + Intergenic
969785557 4:9454478-9454500 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
969814261 4:9675007-9675029 TTTTTGTTGTTCAGAGAGATGGG + Intergenic
970078264 4:12249961-12249983 GTATAGATGTTCAAAGATACTGG + Intergenic
971027433 4:22602392-22602414 GTCTAGTTGTTTTGAGAGATAGG - Intergenic
972141245 4:35962407-35962429 GAGTAGTTTTTCAGAGAGAATGG + Intronic
975934623 4:79563389-79563411 GTCTGGATATTCAGAGTGATGGG + Intergenic
976100029 4:81551398-81551420 CTGTAGATTTTCAGGGAGAAAGG - Intronic
976134728 4:81923403-81923425 GTGTAGACCTTCAGACTGATTGG - Intronic
976613903 4:87056936-87056958 ATTTAGAGGTACAGAGAGATTGG + Intronic
977351099 4:95888829-95888851 ATGTAGATGTATATAGAGATTGG + Intergenic
979052581 4:115953473-115953495 GTCTAGTTGTTTTGAGAGATAGG - Intergenic
979101972 4:116629334-116629356 GTGTAGATATAGAGATAGATTGG + Intergenic
979270642 4:118756639-118756661 TTGTTGATGTTCAGGGAGACAGG + Intronic
980017628 4:127670931-127670953 TTGTATATGGTGAGAGAGATGGG - Intronic
981042728 4:140238237-140238259 GTGAATGTGTACAGAGAGATAGG + Intergenic
981186914 4:141815320-141815342 TTATAGAGGTTCAGAGAAATAGG + Intergenic
981604912 4:146530045-146530067 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
981650721 4:147055026-147055048 GCTTGGATGTTCAGAGAGAAAGG - Intergenic
982410653 4:155072605-155072627 GTGCAGATGTTTCCAGAGATTGG - Intergenic
987342134 5:16948622-16948644 GTGTAGAGCTCCAGAGAGGTAGG + Intergenic
987930408 5:24393846-24393868 GTCTAGTTGTTTTGAGAGATAGG + Intergenic
987954958 5:24727308-24727330 GAGGAAATGTTCAGAGAAATAGG - Intergenic
989519377 5:42383022-42383044 GTGGAGATGGTCACAGAGCTGGG - Intergenic
990073007 5:51808133-51808155 ATGTAGAAATTGAGAGAGATGGG + Intergenic
990773391 5:59276935-59276957 GTGTAGATGTTCAGAGAGATAGG - Intronic
990985941 5:61641022-61641044 CTGTAGATGTCCAGAGGGAAAGG - Intronic
992989566 5:82270296-82270318 GTCTAGTTGTTTTGAGAGATAGG + Intronic
993328224 5:86567623-86567645 GTCTAGTTGTTTAGAGAGGTAGG + Intergenic
994043055 5:95279635-95279657 ATGTAGATGTTATGAGAGATTGG - Intronic
995474628 5:112535106-112535128 CTGTAGATTTTCAGACAGTTGGG - Intergenic
995867553 5:116707665-116707687 GTCTAGCTGTTTTGAGAGATAGG - Intergenic
996093343 5:119372786-119372808 GTGTATATTTTAGGAGAGATGGG - Intronic
996379637 5:122849913-122849935 GTGTAGCAGCTCAGAGAGTTAGG + Intronic
998114828 5:139528485-139528507 GTCTAGTTGTTTTGAGAGATAGG - Intronic
998952612 5:147407052-147407074 GTGATGCTGTTCAGAGAGCTGGG - Intronic
1000422329 5:161053051-161053073 ATGTTGATGTTGAGAGAGAATGG + Intergenic
1001108559 5:168876233-168876255 GTGCAGTTGTTCAGAAATATGGG - Intronic
1002851853 6:1003643-1003665 GTGTGGATGTGGAGAGAGGTGGG - Intergenic
1005813941 6:29535307-29535329 GTGTAGATGTGGGGAGAGAAGGG + Intergenic
1005891846 6:30146774-30146796 CTGTAGATATTCAGAGAGTGAGG + Intronic
1006032045 6:31183471-31183493 GTCTAGTTGTTTTGAGAGATAGG + Intergenic
1006802879 6:36770598-36770620 GAGGAGATGGTCAGAGGGATAGG - Intronic
1008123611 6:47645141-47645163 GTCTAGTTGTTTTGAGAGATAGG - Intergenic
1008271353 6:49494160-49494182 GTGTAGAACTTCTTAGAGATTGG + Intergenic
1009363092 6:62837915-62837937 GTGTACATGTTCTGCGATATTGG - Intergenic
1009927459 6:70136944-70136966 GTGTAGGTATTCAGAGATCTTGG + Intronic
1010317891 6:74471581-74471603 GTCTAGTTGTTTCGAGAGATAGG - Intergenic
1011542597 6:88448222-88448244 GTGAAGATGTGGAGAGAAATTGG + Intergenic
1011565269 6:88666321-88666343 GTCTAGCTGTTTAGAGAGGTAGG - Intronic
1011622195 6:89253385-89253407 GTGTTGATGTTCATAGAGACTGG - Intergenic
1014741273 6:125150316-125150338 GTGTAGATGTTGAGAAAAAGGGG + Intronic
1016675486 6:146761943-146761965 GTGAAGATGTTGGCAGAGATAGG - Intronic
1017331538 6:153204434-153204456 GTGTAGATGTGGAGTGAGAAAGG + Intergenic
1020311594 7:6872690-6872712 GTCTAGTTGTTGAGAGAGGTAGG + Intergenic
1020323147 7:6955030-6955052 GTCTAGTTGTTTAGAGAGGTAGG + Intergenic
1020467979 7:8502823-8502845 GAGAAGCTGTTCACAGAGATGGG + Intronic
1022079416 7:27004869-27004891 GTATCGATGTTCAGGGATATTGG + Intergenic
1022158927 7:27689597-27689619 GTGGGAATGGTCAGAGAGATGGG - Intergenic
1022690406 7:32646029-32646051 GTGTATGTGTTGAAAGAGATGGG + Intergenic
1023963674 7:44949421-44949443 GTGACGGTTTTCAGAGAGATTGG + Intergenic
1026035621 7:66828387-66828409 GTGTAGCTATCCAGAGAGTTTGG - Intergenic
1027023237 7:74831488-74831510 GTGTGTATGTACAGAGAGAGGGG - Intronic
1027064692 7:75113812-75113834 GTGTGTATGTACAGAGAGAGGGG + Intronic
1028248119 7:88507573-88507595 TCGGCGATGTTCAGAGAGATAGG - Intergenic
1028573996 7:92325556-92325578 GTTTAGATGTTCAGGGAGAAAGG - Intronic
1028657116 7:93221067-93221089 GTGAAGAGGACCAGAGAGATGGG + Intronic
1029372069 7:100156643-100156665 GTGTAGATGCTCTGAGTGAAGGG + Exonic
1029486226 7:100843564-100843586 GTCTAGTTGTTTTGAGAGATAGG - Intronic
1030387156 7:108878144-108878166 CTGGGGATGGTCAGAGAGATCGG + Intergenic
1031142593 7:117960558-117960580 GTGTAGGTGTTAAGTGAGACAGG + Intergenic
1033002521 7:137522677-137522699 GAATAGATGTTCAGAAAGTTTGG - Intronic
1033519365 7:142145419-142145441 TTGTAAATGATCAGAGAGAGAGG - Intronic
1033735965 7:144222146-144222168 ATGTATATGTTCATATAGATAGG - Intergenic
1033747086 7:144328806-144328828 ATGTATATGTTCATATAGATAGG + Intergenic
1035170175 7:157012969-157012991 GAGTACAAGTTCAGAGAGTTTGG + Intergenic
1035647957 8:1242866-1242888 GTGTGGATGGTCAGACAGACAGG + Intergenic
1036239735 8:7071710-7071732 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
1036372921 8:8175954-8175976 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
1036377597 8:8214054-8214076 TTTTTGTTGTTCAGAGAGATGGG + Intergenic
1036816707 8:11907906-11907928 GTCTAGTTGTTTAGAGAGGTAGG + Intergenic
1036833427 8:12039435-12039457 GTCTAGTTGTTGAGAGAGGTAGG + Intergenic
1036851965 8:12209094-12209116 TTTTTGTTGTTCAGAGAGATGGG - Intergenic
1036855273 8:12286000-12286022 GTCTAGTTGTTGAGAGAGGTAGG + Intergenic
1036873331 8:12451616-12451638 TTTTTGTTGTTCAGAGAGATGGG - Intergenic
1036877984 8:12489687-12489709 GTCTAGTTGTTTAGAGAGGTAGG + Intergenic
1036903590 8:12689852-12689874 GTCTAGTTGTTGAGAGAGGTAGG + Intergenic
1037440164 8:18907715-18907737 GGGTATATGTTCTGAGAAATAGG - Intronic
1038089794 8:24240290-24240312 GTCTAGTTGTTTTGAGAGATAGG - Intergenic
1038446353 8:27606803-27606825 GAGTAGGTGATCAGAGAGAGAGG - Intronic
1038799041 8:30732760-30732782 GTCTAGTTGTTTAGAGAGGTAGG - Intronic
1039672970 8:39624321-39624343 TTGTATATGGTGAGAGAGATAGG + Intronic
1041030849 8:53733954-53733976 GTCTAGTTGTTTAGAGAGGTAGG - Intronic
1041515597 8:58695826-58695848 GTCTAGTTGTTTTGAGAGATAGG - Intergenic
1044257591 8:90083192-90083214 GTTTAAATGTTCAGATAGAAGGG + Intronic
1045186267 8:99841685-99841707 GTGTGGAGGATCAGAGAGAAAGG - Intronic
1045637136 8:104205100-104205122 CTGGAGATGTTCAGAGATGTAGG + Intronic
1046130197 8:109957375-109957397 TTGTACATGTTCAAAGAGAGGGG - Intergenic
1047061227 8:121228841-121228863 GTATAGATATACAGATAGATAGG + Intergenic
1048847991 8:138617591-138617613 GTGCAGATTTTCACACAGATTGG - Intronic
1048957452 8:139548758-139548780 GTTTAGTTGTTTAGAGAGGTAGG + Intergenic
1049397967 8:142410568-142410590 GTGCAGATGTGAAGAGAGGTGGG - Intergenic
1049634012 8:143676411-143676433 CTATAGTTGTTTAGAGAGATAGG - Intergenic
1051736740 9:20208073-20208095 GTGTAAATGGTCAGCAAGATTGG + Intergenic
1051918799 9:22239237-22239259 GTGAAGGTGTTCAGAAAAATAGG - Intergenic
1053357061 9:37455256-37455278 CTGGGGATGGTCAGAGAGATCGG + Intronic
1053687657 9:40553990-40554012 ATGTGGATGTTTGGAGAGATTGG + Intergenic
1053939443 9:43217073-43217095 ATGTGGATGTTTGGAGAGATTGG + Intergenic
1056865755 9:90226215-90226237 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057956577 9:99413793-99413815 GTGTAAACTTGCAGAGAGATAGG - Intergenic
1062695359 9:137873121-137873143 ACGTAGATGTACAGAGAGAAAGG + Intergenic
1186558586 X:10586776-10586798 GTCTAGTTGTTTTGAGAGATAGG + Intronic
1187010415 X:15272903-15272925 GTCTGGATGTTCAGTGAAATTGG + Intergenic
1188129004 X:26407322-26407344 ATTAAGATGTTAAGAGAGATTGG - Intergenic
1189311972 X:40025608-40025630 GGGAAGGTGTTCAGAGAGAGGGG + Intergenic
1190259462 X:48788892-48788914 GCAGAGATGTTCAGAGAGATAGG + Intronic
1194420943 X:93672408-93672430 GTGTAGATCTTAAAAGAGCTAGG - Exonic
1194783402 X:98052443-98052465 TTGTAGATGTTTAGAGATAAGGG + Intergenic
1196422876 X:115540747-115540769 GTCTAGTTGTTTTGAGAGATAGG + Intergenic
1196459945 X:115919452-115919474 GTCTAGTTGTTTTGAGAGATAGG + Intergenic
1196652458 X:118181891-118181913 GTGAAGATGTACAGATACATGGG - Intergenic
1198697048 X:139353537-139353559 GTGTAGGTATAAAGAGAGATGGG - Intergenic
1198969995 X:142269325-142269347 GTCTAGCTGTTTTGAGAGATAGG - Intergenic
1200432333 Y:3100169-3100191 TTGTAGACATCCAGAGAGATAGG + Intergenic