ID: 990773641

View in Genome Browser
Species Human (GRCh38)
Location 5:59280227-59280249
Sequence TTAACCAGTATTGCCTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990773641_990773642 -3 Left 990773641 5:59280227-59280249 CCTCATTAGGCAATACTGGTTAA 0: 1
1: 0
2: 0
3: 6
4: 87
Right 990773642 5:59280247-59280269 TAATAAATGATCATTTTAAAAGG 0: 1
1: 1
2: 15
3: 96
4: 1017
990773641_990773643 19 Left 990773641 5:59280227-59280249 CCTCATTAGGCAATACTGGTTAA 0: 1
1: 0
2: 0
3: 6
4: 87
Right 990773643 5:59280269-59280291 GTAACAATACGTGAGACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990773641 Original CRISPR TTAACCAGTATTGCCTAATG AGG (reversed) Intronic
910781247 1:90936722-90936744 TTATTCAGTATTGCCAAGTGTGG - Intronic
912325341 1:108753715-108753737 TTAATCTGTATTACCTATTGAGG + Intronic
916766785 1:167868567-167868589 GTATCCAGTATAGCCTAGTGGGG - Intronic
919510896 1:198462693-198462715 TTATCCAGTTGTCCCTAATGAGG + Intergenic
921911433 1:220553443-220553465 TCAACAAGTATGGCCTCATGGGG - Intronic
1064386970 10:14903996-14904018 TTAACCAAAATTGCAGAATGGGG + Intronic
1065112499 10:22453580-22453602 TTAACCAGTTGTTCCCAATGAGG - Intronic
1067429389 10:46233080-46233102 TTAAACAGTATTGACTAATTTGG - Intergenic
1080700251 11:34638553-34638575 TTAACCAGTATTCTCCACTGGGG + Intronic
1086047984 11:82555375-82555397 TAAACTAGTGTTCCCTAATGAGG - Intergenic
1086189999 11:84067780-84067802 TAAACTAATAATGCCTAATGAGG - Intronic
1089045096 11:115494655-115494677 TTTTTCAGTATTCCCTAATGTGG + Intronic
1089238851 11:117056817-117056839 TTCACCAATATTGCCAAAGGTGG - Intronic
1093283838 12:17232127-17232149 GGAACCAGTATTGCAGAATGGGG - Intergenic
1093290394 12:17312914-17312936 TTAAACAGTATTGTCTCATAAGG - Intergenic
1093613339 12:21189989-21190011 TTGACCAGTATCTCCTCATGTGG + Intronic
1094822145 12:34234463-34234485 TTTACCAAGATGGCCTAATGAGG + Intergenic
1095864953 12:46961652-46961674 TTAAAGAGAATTACCTAATGGGG - Intergenic
1096642887 12:53008483-53008505 GTAACCAGTATTCCCTGATGTGG + Intronic
1097985269 12:65776346-65776368 TTATCCAGTATTGCCTCTTTAGG + Intergenic
1098049947 12:66442823-66442845 TTAACAAATATTGCCCAGTGTGG - Intronic
1098228881 12:68352534-68352556 TTAACCTGTATGGCCTAAAAAGG + Intergenic
1101611160 12:106293320-106293342 TTCACCATTCTTGCCAAATGAGG - Intronic
1107816170 13:44246457-44246479 TTAAGACGTTTTGCCTAATGGGG - Intergenic
1109010239 13:56931355-56931377 TTAAACAGTATTGCAAGATGAGG - Intergenic
1113050636 13:106207660-106207682 TTAACCAGACCTTCCTAATGAGG + Intergenic
1117548995 14:56815462-56815484 TCAAACAATATTCCCTAATGTGG + Intergenic
1134601139 16:15534625-15534647 TTAACCAGGAATGTCAAATGTGG - Intronic
1145286283 17:21508288-21508310 TTCACCTGTATTGACTAATCAGG - Intergenic
1150936664 17:69643176-69643198 GTAACCAGTATTGACTGATTAGG - Intergenic
1159422857 18:68246296-68246318 TTAACAACTATAGCCTATTGTGG + Intergenic
1163138732 19:15332197-15332219 GTAACCTGCATTGCGTAATGGGG - Intronic
925490312 2:4384777-4384799 GTAACAAGTATTACCTAAAGTGG - Intergenic
927839653 2:26431696-26431718 TTGGCTTGTATTGCCTAATGCGG - Intronic
928150067 2:28818911-28818933 TGAACCAGTGTTGCCTAAGGTGG - Intronic
928788155 2:34915644-34915666 TTAAACAGTATTGCTTCTTGAGG - Intergenic
931579328 2:63756014-63756036 TTAATTAGTTTTGCTTAATGAGG + Intronic
939657277 2:144842935-144842957 TTCACCAGTATTGCCAAAAATGG + Intergenic
941723391 2:168836162-168836184 ATAACAAGTATTGAATAATGAGG + Intronic
945986089 2:216354743-216354765 TTCACCAGTCTTGCTCAATGAGG - Intronic
1169294312 20:4379704-4379726 TGAACCAGTCTTTCCTAGTGGGG - Intergenic
1169951200 20:11045421-11045443 ATAGCCAGTATAGCCTAGTGTGG - Intergenic
1170059990 20:12248746-12248768 TTATCCATAATTGCCAAATGTGG + Intergenic
1172619948 20:36312175-36312197 TTAACCAGAATTGCATGCTGGGG - Intronic
1173968579 20:47132755-47132777 TATACAAGCATTGCCTAATGGGG - Intronic
1177440881 21:21122562-21122584 TGAGCCCGTATTGTCTAATGTGG + Intronic
949689542 3:6620147-6620169 TTAATCAGTCTTGTCTTATGGGG - Intergenic
954967303 3:54623098-54623120 TTAACCAGTTTTAGCTGATGTGG - Intronic
955676200 3:61451428-61451450 TAAACGTATATTGCCTAATGGGG + Intergenic
957439086 3:80218820-80218842 TTGACTAGTAGTGCCTAGTGAGG + Intergenic
965689873 3:171344232-171344254 GTAACCAGAATTGCCCACTGAGG - Intronic
965899452 3:173620427-173620449 CTAACCAGCCTTGTCTAATGTGG + Intronic
966238925 3:177733359-177733381 TTAACAAGTATTTCCTAAACAGG - Intergenic
970852026 4:20614219-20614241 TGAACCCTTATTACCTAATGGGG + Intronic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
982625700 4:157763528-157763550 TTAAGCAGTATTGCCTAAAAAGG + Intergenic
982925763 4:161335361-161335383 TTACCCAGTATAGCCCCATGGGG + Intergenic
985120525 4:186636440-186636462 TTATCCGGCATTGCCTAATGGGG + Intronic
990773641 5:59280227-59280249 TTAACCAGTATTGCCTAATGAGG - Intronic
992297617 5:75341030-75341052 TTAACGTGTATTTCCTACTGTGG - Intronic
993804664 5:92389921-92389943 TTAACTTGTCTTGCCGAATGAGG - Intergenic
995360124 5:111287223-111287245 TTAAGCAGTATTCCCTATTCAGG - Intronic
996831122 5:127741416-127741438 TAAACAAGGATTGCTTAATGTGG + Intergenic
1005478024 6:26227715-26227737 TAAAACAGTAATGCCTAGTGGGG - Intergenic
1009218287 6:60949503-60949525 TTCAACAATATTGCCTGATGAGG - Intergenic
1012304633 6:97638102-97638124 TCAAACAGTATTGCCTGCTGTGG + Intergenic
1012536128 6:100299289-100299311 CTAACCGATATGGCCTAATGTGG - Intergenic
1012735884 6:102942434-102942456 TTAACCAGTTTACCCTGATGTGG + Intergenic
1013476962 6:110517310-110517332 TCACCCAGTACTGCCAAATGAGG + Intergenic
1014961579 6:127692822-127692844 TTAAACAGTATTGCCAAAATAGG - Intergenic
1015235421 6:130965376-130965398 TTAACCAGTATTTCCTATGAAGG - Intronic
1021800400 7:24299596-24299618 TTATCCAGGTTTGCCTAAAGCGG - Intergenic
1022314099 7:29228690-29228712 TTTCCCAATATTGCCCAATGAGG - Intronic
1023063835 7:36355017-36355039 TTTACCAGTATTCCTTAATTTGG - Intronic
1024469042 7:49748086-49748108 TTGACCAGTATGTCCTTATGTGG + Intergenic
1027575908 7:79930762-79930784 TCAACCAGCATTGCATCATGGGG + Intergenic
1029919656 7:104249405-104249427 TAAACCATTGTGGCCTAATGAGG + Intergenic
1031412773 7:121459684-121459706 TTAAGCAGAAATGCATAATGAGG + Intergenic
1032979311 7:137263827-137263849 ATACCCAGTATAGCCTAGTGGGG + Intronic
1039404852 8:37303746-37303768 TTAACCAGAATTGTCTCATATGG + Intergenic
1045027536 8:98102279-98102301 TTAAAACGTATTGCCTAGTGGGG - Intergenic
1047098215 8:121646858-121646880 CAAACCAGTATTTTCTAATGTGG - Intergenic
1047645283 8:126863704-126863726 TTAACCAGTATTGAGTTATCAGG - Intergenic
1048100865 8:131349965-131349987 TTGACCAGAATTGTCTAATATGG - Intergenic
1049677736 8:143899977-143899999 GTGACCAGTATTGGCCAATGAGG - Intergenic
1053031635 9:34784867-34784889 TCAACCAGTTTTTTCTAATGTGG + Intergenic
1054973035 9:71111375-71111397 TTAAACAGTGTTGCCAACTGGGG + Intronic
1055299833 9:74871486-74871508 CTGACCAGTATTCCCTAATATGG + Intronic
1186959744 X:14722920-14722942 TTTACAAGTATTGCCTTATCTGG + Intronic
1189511099 X:41662337-41662359 TGAAACAGTATTTTCTAATGTGG + Intronic
1195813094 X:108855639-108855661 TGAACCAGTATTGCATCCTGGGG - Intergenic
1197088305 X:122506329-122506351 TTAAGCAGTATTGCCCGCTGTGG + Intergenic
1199201852 X:145099973-145099995 TTAACCTGTATCGCATCATGAGG + Intergenic
1199383592 X:147198834-147198856 TTAACTATTTTTGCCAAATGAGG - Intergenic