ID: 990777025

View in Genome Browser
Species Human (GRCh38)
Location 5:59314358-59314380
Sequence GCTCTTGGCCTTATAATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990777021_990777025 12 Left 990777021 5:59314323-59314345 CCATCTATAACATTACAAATTCT 0: 1
1: 0
2: 2
3: 34
4: 372
Right 990777025 5:59314358-59314380 GCTCTTGGCCTTATAATGGTAGG 0: 1
1: 0
2: 1
3: 3
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990777025 Original CRISPR GCTCTTGGCCTTATAATGGT AGG Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
906893269 1:49741417-49741439 GCTGTTGGCCTTTTTTTGGTTGG - Intronic
911892710 1:103392914-103392936 GCTCTTGGCTTGATGATTGTTGG + Intergenic
912636489 1:111299104-111299126 GGTCTTGGCCTTTTTCTGGTTGG - Intronic
914683156 1:149954672-149954694 GGTCTTGGACTTTTTATGGTTGG + Intronic
919602219 1:199636354-199636376 GCTCTTGGGCTTTTTTTGGTTGG - Intergenic
1067789898 10:49279934-49279956 GCTCCTGGCCATATGATTGTGGG - Intergenic
1076144173 10:128103837-128103859 GCTCTTGGCCTTCTCCTGCTGGG + Exonic
1079745807 11:24128285-24128307 GCTTTTGGACTTATAATGGGAGG + Intergenic
1080617292 11:33955755-33955777 GCTCCTGGCTTTACCATGGTGGG - Intergenic
1090174787 11:124638913-124638935 GCTCTGGGCCTTCTATGGGTTGG + Intronic
1096034262 12:48450843-48450865 GGTCTTGGCCTTTTTATGGTTGG - Intergenic
1097241076 12:57575632-57575654 GATCTTGGCCTCATGCTGGTGGG - Exonic
1102468127 12:113142491-113142513 GGTCTTGGCCTCAGAATGGAAGG - Intergenic
1105461542 13:20594228-20594250 TCTCTTGGCATCATAATGATCGG - Intronic
1105735041 13:23259168-23259190 GCTCTTGGACTTTTTTTGGTTGG + Intronic
1105954241 13:25265015-25265037 CCTCTTGGCCTTCTATTAGTAGG + Intronic
1108703409 13:52963118-52963140 GCTCTTAGCCTTATAATTGTAGG + Intergenic
1108774700 13:53751450-53751472 CCTCTTGCCCTTATAAAGTTAGG + Intergenic
1113659973 13:112100209-112100231 CCTCTTGTCCTTATAATGAGTGG + Intergenic
1119006500 14:70935459-70935481 GCTCTTAGCAATATAATAGTAGG + Intronic
1123776806 15:23588707-23588729 GCTCTTGGGCTGATCCTGGTAGG - Intronic
1123983990 15:25628426-25628448 GCTCTTGGCTTGATTATTGTTGG + Intergenic
1130570758 15:85041398-85041420 GCTCTTGGCCTTCCTATGGCAGG - Intronic
1131616571 15:94022539-94022561 CCTCTGGGGCTCATAATGGTTGG - Intergenic
1137671141 16:50280068-50280090 GGTCCTGGCCTTTTATTGGTAGG + Intronic
1148563959 17:48622236-48622258 GCCCTTGGCCTGAGAATAGTTGG + Exonic
1153498505 18:5723832-5723854 TTTCTTTGCCTTAAAATGGTTGG + Intergenic
1154938748 18:21089539-21089561 GCTCCTAGACTTATAATGGGTGG + Intronic
1157921977 18:51722401-51722423 GCTCTTGGCCATTTATTTGTTGG + Intergenic
929452756 2:42047982-42048004 GCTCTGGGCCTTATAAGCGGCGG + Intergenic
929886825 2:45886167-45886189 GTTCTTGGCCTTAGAATGCATGG + Intronic
937606964 2:123812153-123812175 GCTCTTGGCCTGATGGTTGTTGG - Intergenic
937814956 2:126241089-126241111 GCTCTTGTCCTTGAAATGCTTGG + Intergenic
945209984 2:207372632-207372654 GCTCTATGCCTTTTAATTGTTGG - Intergenic
948069254 2:235106497-235106519 GCTCTTGTTCTTTTCATGGTTGG + Intergenic
1168852656 20:987268-987290 GCTCTGGGCCTGAGGATGGTTGG + Intronic
1170972924 20:21133483-21133505 GCTCCTGGCCTTCTGGTGGTGGG + Intronic
1172546952 20:35769608-35769630 GTTCTTGGCATTATTGTGGTTGG + Intergenic
1178393983 21:32223645-32223667 GGTCTTGGCCTTTTTTTGGTTGG - Intergenic
1182109515 22:27713091-27713113 GCTCTTGGCCTCATTATTTTTGG - Intergenic
1203237293 22_KI270732v1_random:17512-17534 GCTCTGGGCCTAATAAAGGCTGG + Intergenic
949327831 3:2887047-2887069 GCTCTTCGCCAGATAATAGTTGG - Exonic
966262469 3:177995580-177995602 GATCTTTGCCTTATAAAGGATGG + Intergenic
967554584 3:190839782-190839804 GCTCTTGGCTTGATTATCGTTGG - Intergenic
974901209 4:68000747-68000769 TCCCTTGGCCTTTTTATGGTTGG + Intergenic
981057812 4:140383722-140383744 GAGCTTGGCCTTAAAATGATGGG - Exonic
981795948 4:148595591-148595613 GCTCTTGGACTTTTTTTGGTTGG + Intergenic
986296380 5:6442668-6442690 GCTCTTGGCTTGATGGTGGTTGG + Intergenic
990777025 5:59314358-59314380 GCTCTTGGCCTTATAATGGTAGG + Intronic
996166813 5:120234047-120234069 GGTCTTGGCCTTTTATTAGTTGG + Intergenic
996422356 5:123276959-123276981 ACTCTTGGCTTTATAATTTTAGG + Intergenic
999488355 5:152023291-152023313 GGTCTTGGGCTTATTTTGGTTGG + Intergenic
1007764145 6:44151101-44151123 GCTCTTGACCTTATAACTCTGGG + Intronic
1011525224 6:88257117-88257139 GGTCCTGGCCTTTTATTGGTTGG - Intergenic
1012284823 6:97376097-97376119 GCTCTTGGCCTGATGACTGTTGG + Intergenic
1012706915 6:102543078-102543100 GGTCTTGGACTTATTTTGGTTGG + Intergenic
1014790055 6:125662364-125662386 GATCTAGGCCTTATAATAGAAGG + Intergenic
1015462002 6:133501997-133502019 GCTCTTGGCCTTTAAATGTGTGG - Intronic
1015911234 6:138169406-138169428 GCTCTTAGCCTTATAGAGCTGGG + Intronic
1017567466 6:155702905-155702927 GGTCTGGGGCTTATATTGGTTGG + Intergenic
1018348197 6:162925180-162925202 GGTCCTGGACTTTTAATGGTTGG - Intronic
1018404523 6:163464703-163464725 GCTCTTGGGCTTCTATTTGTTGG - Intronic
1020619882 7:10504455-10504477 GGTCTTGGCCTTTTTTTGGTTGG - Intergenic
1020620416 7:10511010-10511032 GGTCTTGGGCTTTTCATGGTTGG + Intergenic
1021200430 7:17722952-17722974 GCTCTTGACCTTGTAAAGATCGG - Intergenic
1022685395 7:32591556-32591578 GTTCTTGGCTTTATTATGTTTGG - Intergenic
1027168796 7:75855187-75855209 GCTCTTGGCCTCATAATCCTTGG + Intronic
1031943845 7:127817871-127817893 GCTCTTTGCCCTATAGGGGTGGG - Intronic
1039674283 8:39643074-39643096 GCTCTTGGCTTGATTATTGTTGG + Intronic
1041518422 8:58728163-58728185 GCTCCTGGACTTATTTTGGTTGG - Intergenic
1049185536 8:141250184-141250206 GGTCCTGGGCTTATGATGGTGGG + Intronic
1049964920 9:770246-770268 GTTCTTGGGCTTTTTATGGTTGG - Intergenic
1185925097 X:4137082-4137104 GCTCTTGCACTTATATTAGTGGG - Intergenic
1185991681 X:4898266-4898288 GCCCTAGGCCTTAGAATGGAGGG - Intergenic
1186474560 X:9847223-9847245 TCTATTGGCCTTTTATTGGTGGG + Intronic
1187305754 X:18093868-18093890 GCTCTTGTCCTCAAAATGGCAGG - Intergenic
1188332352 X:28890756-28890778 GTTCTTGGGCTTATACTGATAGG - Intronic
1191968882 X:66791667-66791689 GGTCTTGGCCTTTTTTTGGTTGG + Intergenic
1202266097 Y:23020845-23020867 GCTGTTGCGCTAATAATGGTTGG + Intergenic
1202419090 Y:24654588-24654610 GCTGTTGCGCTAATAATGGTTGG + Intergenic
1202451696 Y:25015496-25015518 GCTGTTGCGCTAATAATGGTTGG - Intergenic