ID: 990778660

View in Genome Browser
Species Human (GRCh38)
Location 5:59333176-59333198
Sequence ATCCAGTTCTCTAGGTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990778656_990778660 22 Left 990778656 5:59333131-59333153 CCATAGAACATACTCTATAATCA 0: 1
1: 0
2: 1
3: 31
4: 371
Right 990778660 5:59333176-59333198 ATCCAGTTCTCTAGGTCAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 116
990778657_990778660 -5 Left 990778657 5:59333158-59333180 CCAGTTACAAATCCGCGAATCCA 0: 1
1: 0
2: 0
3: 1
4: 19
Right 990778660 5:59333176-59333198 ATCCAGTTCTCTAGGTCAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990778660 Original CRISPR ATCCAGTTCTCTAGGTCAAA AGG Intronic
909602561 1:77476038-77476060 ACCTAGTTCTCTAGGAGAAATGG - Intronic
910140433 1:84021276-84021298 ATCTAATTCACTATGTCAAAAGG - Intergenic
914913050 1:151802060-151802082 ATCCAGTTCTCTAAGCCTTAGGG + Exonic
918137157 1:181684002-181684024 ATCAGGTTTGCTAGGTCAAATGG + Intronic
920710401 1:208289196-208289218 ATCCAATTCTATAAGCCAAAAGG + Intergenic
921716318 1:218420472-218420494 ATCCATTTCTCCAGGTTGAAGGG - Intronic
1064504273 10:16012352-16012374 ATCCAGTCATCTGAGTCAAAGGG - Intergenic
1068831291 10:61498144-61498166 AAACAATTCTTTAGGTCAAAAGG - Intergenic
1071263266 10:83940376-83940398 ATCCAGATCTCTAGGTCAGAGGG - Intergenic
1078273579 11:9820801-9820823 CTCCAGTTCACTACGTCAAAAGG + Intronic
1079691424 11:23422854-23422876 AGACATTTCTGTAGGTCAAAGGG + Intergenic
1082646115 11:55728103-55728125 ATACAGGTCTCTAGTTCCAAAGG - Intergenic
1083477252 11:62922513-62922535 ACCCACATCTCTAGGGCAAACGG - Intergenic
1083957347 11:65992094-65992116 ATCCAGGTGTATAGGTGAAATGG - Intergenic
1084673112 11:70619237-70619259 TGCCAGTTCTGTAGGTCAGAGGG + Intronic
1085059689 11:73433811-73433833 AGTCAAATCTCTAGGTCAAAGGG + Intronic
1087519379 11:99211477-99211499 AACAAGTTCTCTAGATCAGAAGG - Intronic
1088356491 11:108949421-108949443 AACCAGATTTCTGGGTCAAATGG + Intergenic
1088466442 11:110145419-110145441 TTCCAGTTGTCTAGTTCATAAGG + Intronic
1089541243 11:119190213-119190235 ATCCACTTCTCTCTGCCAAACGG + Exonic
1092404746 12:8211752-8211774 ATCCCCTTATCTAGGTCCAACGG - Intergenic
1093832408 12:23778730-23778752 ATCCAGAGCTCTAGGTAAAAGGG - Intronic
1094111625 12:26868771-26868793 ATCAGGTTCTATATGTCAAAAGG + Intergenic
1094754823 12:33455564-33455586 ACCCAGTTCTCTTGATGAAAAGG - Intergenic
1095583439 12:43825574-43825596 ATCACGTTCTTTATGTCAAAGGG - Intergenic
1095583568 12:43826963-43826985 ACACAGTCCTCTATGTCAAAAGG - Intergenic
1099759083 12:86894368-86894390 ATCTAGGTCTCTAGCTGAAATGG + Intergenic
1102500937 12:113352127-113352149 ATCCAGGGCTCTAGGAGAAATGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1106801129 13:33257137-33257159 TTCCAGTTCTATATGTCAAATGG - Intronic
1110352604 13:74526958-74526980 GTACAGTTCTCTACGTCACATGG + Intergenic
1115383140 14:32762847-32762869 ATTAAGATCTTTAGGTCAAAAGG + Intronic
1116013337 14:39376989-39377011 CTCCAATTCACTAGGCCAAATGG - Intronic
1118055455 14:62075066-62075088 CTCAATTTCTCTAGGTAAAAAGG + Intronic
1119136510 14:72226022-72226044 ATCCAGTTTTCTTGCTTAAAAGG + Intronic
1124128492 15:26962563-26962585 AGTCAGATTTCTAGGTCAAAGGG - Intergenic
1125744048 15:41987171-41987193 GGCCAGTTCTCTAGGTGGAAAGG - Exonic
1126983813 15:54278781-54278803 TTCCATTTTTATAGGTCAAAAGG - Intronic
1128302534 15:66575558-66575580 ATCCATTTCTCAAGGTAAAGTGG + Intergenic
1130821696 15:87502854-87502876 ATCCAGGTCTCTGTGTCCAAAGG - Intergenic
1132180657 15:99750367-99750389 CCCCAGTTCACTATGTCAAAGGG + Intergenic
1132967369 16:2665827-2665849 TTTAAGTTCTCCAGGTCAAAGGG + Intergenic
1133789005 16:8994839-8994861 TTCCATTTCTCTGGGTCACAAGG + Intergenic
1134467168 16:14489822-14489844 ATCAAGTTCTCAATGTCTAAGGG + Intronic
1134833214 16:17340230-17340252 ATCCAGTTCTGCAGCTCAACTGG + Intronic
1135064254 16:19296052-19296074 ATCCTCTTCTATATGTCAAAAGG - Intronic
1136922033 16:34341054-34341076 ATCTAGTTCTCTTTGGCAAATGG + Intergenic
1136982540 16:35070752-35070774 ATCTAGTTCTCTTTGGCAAATGG - Intergenic
1139721581 16:68860290-68860312 ATTCAGTTCTATATCTCAAAGGG - Exonic
1153899303 18:9602034-9602056 ATTCAGTTCTATAGGTAACAAGG - Intronic
1156609294 18:38707614-38707636 ACCCAGATCTCCAGGTCTAAGGG + Intergenic
1157732373 18:50015247-50015269 ATGAAGTTCACTAGGTCAGAGGG - Intronic
1157782298 18:50450212-50450234 ATCCAGATCTGTATATCAAACGG - Intergenic
1157961288 18:52156311-52156333 ATCCAGTTCTCAAGTTTCAAAGG - Intergenic
1164558924 19:29275215-29275237 ATGCAGTTCCCTTGGGCAAATGG + Intergenic
1167888730 19:52522872-52522894 ATCCAGTCCTGGAGGTCAAGAGG - Intergenic
927378667 2:22451041-22451063 ACACAGTTCTCTAGAACAAAGGG - Intergenic
929637439 2:43538749-43538771 ATCCAGCTCTCTTGGACAAGAGG - Intronic
931517950 2:63061520-63061542 ATCCAGTAATTTAGGTGAAATGG + Intergenic
933291345 2:80441898-80441920 AGCCATTTTCCTAGGTCAAAAGG + Intronic
933536651 2:83583945-83583967 ATTCACTTCTCTGGTTCAAAGGG - Intergenic
935675291 2:105589955-105589977 ATCCAGTTCTTCAGATGAAATGG - Intergenic
937575704 2:123418939-123418961 TTCCTGCTCTCTAGGTCTAAGGG - Intergenic
938402746 2:131006321-131006343 ATCTGTTTCTGTAGGTCAAAGGG - Intronic
941514607 2:166457247-166457269 ATGCAGGTCTCAAGTTCAAAAGG - Intronic
943393627 2:187304102-187304124 CTCCAGTTCTCCAAGCCAAAAGG + Intergenic
1169856291 20:10106924-10106946 ATCCAGTTTTATAGTTCAGACGG - Intergenic
1170016290 20:11785958-11785980 ATTCAGCTCTTTAGGTCAAAAGG - Intergenic
1178590234 21:33903340-33903362 ACCAAATTCTCTAGGCCAAAAGG + Intronic
1178630802 21:34259766-34259788 TTCCAGTTGTCTGTGTCAAAAGG - Intergenic
1184411442 22:44328648-44328670 TTCCAGTTCCCTAGGACAATTGG - Intergenic
950711261 3:14814424-14814446 ATCATGTTATCTAGGTCTAAGGG - Intergenic
953179120 3:40580310-40580332 ATCCAGCTCTCTAGTTGAGATGG + Intergenic
955056744 3:55461786-55461808 ATGGAGTTCTCCAGGTGAAATGG + Intergenic
957118144 3:76054279-76054301 ATTTAGTTCTTTAGGTCAGATGG + Intronic
962120620 3:132556578-132556600 TTCCAGATGTCTAGGTCAAAAGG - Intergenic
962886456 3:139632423-139632445 CTCCAGTTCTGTAGGGCAGAGGG - Intronic
966837004 3:184056993-184057015 GTACAGTTCTGTTGGTCAAAAGG - Exonic
967650986 3:191986374-191986396 AGCAAGTTCTCTAGCTTAAATGG - Intergenic
969936121 4:10683609-10683631 AGCCAGCTCTCTAGGTCAGCAGG + Intronic
972226880 4:37023782-37023804 ATCCAGGTTTCAACGTCAAAGGG + Intergenic
973963749 4:56138797-56138819 TTTCAGTTTTCTAGGTCAAAAGG - Intergenic
974239514 4:59228406-59228428 ATCAAGATCTCTTGGTCAGAGGG + Intergenic
976946815 4:90780571-90780593 ATCCAGTTCTCTAGTCTGAAAGG + Intronic
978424369 4:108566889-108566911 ATCAATTACCCTAGGTCAAAGGG - Intergenic
982182003 4:152757197-152757219 GTCAAGTTCCCTAGGTCCAAGGG - Intronic
982431311 4:155324832-155324854 TTGCAGTTCTGTAGGTCAGAAGG - Intergenic
982575374 4:157102853-157102875 ATTAGGTTCTCTATGTCAAAAGG + Intronic
982778092 4:159462650-159462672 ATCATGTCCTCTTGGTCAAAAGG + Intergenic
982961696 4:161846716-161846738 ATGCATTTATCTAGGTCAAAAGG + Intronic
983465573 4:168084042-168084064 ATCCAGATTTCTATGTGAAAAGG - Intergenic
983503372 4:168526027-168526049 ATCCAGTGCACTATGTAAAATGG + Intronic
987683832 5:21171179-21171201 ATATAGTTATTTAGGTCAAAGGG + Intergenic
990472089 5:56125029-56125051 ATCCAATTCTCTAGGCCTCATGG - Intronic
990778660 5:59333176-59333198 ATCCAGTTCTCTAGGTCAAAAGG + Intronic
992753435 5:79882179-79882201 ATCCAGTTCTCTAGTTGCAAAGG + Intergenic
995008989 5:107236931-107236953 TTACAGTTCTTTAGTTCAAAAGG + Intergenic
996042485 5:118831370-118831392 ATCCCGTTCAATAGGTCACATGG + Intergenic
996401777 5:123070429-123070451 ATGCAGTTCTCTAGGGAGAATGG + Intergenic
999142312 5:149370687-149370709 ATCCAGACTTCAAGGTCAAAGGG + Intergenic
1000719332 5:164687158-164687180 TTCCAGTTCCCTAGGTAATATGG + Intergenic
1001111871 5:168903456-168903478 ATCCCATTCTCTAGATCAGAGGG + Intronic
1002296769 5:178235730-178235752 AGCCAGTTGTCTGGGTCAACAGG - Intergenic
1004136867 6:12975906-12975928 AGCCAGTGCTATAGGTAAAATGG + Intronic
1005696752 6:28358937-28358959 TTCCAGTTCTATAGGTCAGAAGG + Intronic
1009192774 6:60649784-60649806 ATCCAATGCTCAAGGACAAATGG + Intergenic
1009221406 6:60988031-60988053 TTCCAGTTCTCTAGGGGAATGGG + Intergenic
1009298158 6:61980898-61980920 ATTCAGCTCTTTATGTCAAAAGG - Intronic
1009831296 6:68939372-68939394 ATGCAGTTCTGTAGGTGTAAGGG - Intronic
1011910417 6:92429475-92429497 AGACAGGTCTCTAGGTCAAAAGG + Intergenic
1016087148 6:139927915-139927937 AGCCAGTACTATAGGTCCAATGG - Intergenic
1017248955 6:152259437-152259459 CTAAAGTTCACTAGGTCAAAGGG - Intronic
1028082587 7:86597625-86597647 TTCCAGTTCTCTAGTAAAAAGGG + Intergenic
1029922046 7:104275840-104275862 ATCCAGTGTTCTAGCTCATAGGG + Intergenic
1031210297 7:118816092-118816114 ATGCAATTATCTAGTTCAAAAGG + Intergenic
1031229726 7:119090589-119090611 ATACAGTTCTGTAGGCCCAAAGG - Intergenic
1041720279 8:60969065-60969087 ATCAAGCTCTATACGTCAAAAGG + Intergenic
1043345329 8:79291502-79291524 TTACAGTTCTGTAGGTCAGAAGG - Intergenic
1046575078 8:116018131-116018153 TGCCATTTTTCTAGGTCAAAAGG - Intergenic
1048318094 8:133376774-133376796 ATCCATTTCCCTAGGGGAAAAGG + Intergenic
1050915440 9:11124765-11124787 TTATAGTTCTCTAGGTCAGAAGG + Intergenic
1058175527 9:101732124-101732146 ATACAGTTATCTAGGGCAATGGG + Intronic
1059785802 9:117582544-117582566 ACCCAGCTCTCTATATCAAAGGG - Intergenic
1061459965 9:130729658-130729680 ATACAGTTGTTTAGGACAAAAGG + Intronic
1186273873 X:7919398-7919420 ATCCAGTTCCATAGGTTAAAGGG + Intronic
1190493216 X:51003239-51003261 ATTCAGTCTTCCAGGTCAAAAGG - Intergenic
1190511285 X:51176426-51176448 ATCCAGTCTTCCAGGTCAAAGGG + Intergenic
1194051108 X:89070268-89070290 ATCAAGTTTTCAAGGACAAAAGG - Intergenic
1195995271 X:110725330-110725352 GTCCATTCCTCTAGGTTAAATGG + Intronic
1202025296 Y:20515991-20516013 ATCCACTCCTCTAGGTCACTTGG + Intergenic