ID: 990779088

View in Genome Browser
Species Human (GRCh38)
Location 5:59337811-59337833
Sequence TGGGGTATTCTGAATGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990779085_990779088 -9 Left 990779085 5:59337797-59337819 CCTTTGAAGTGAATTGGGGTATT 0: 1
1: 0
2: 0
3: 10
4: 115
Right 990779088 5:59337811-59337833 TGGGGTATTCTGAATGGGCATGG 0: 1
1: 0
2: 1
3: 14
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990779088 Original CRISPR TGGGGTATTCTGAATGGGCA TGG Intronic
901273379 1:7971345-7971367 TGGGGGCTTCTGAATTTGCAGGG - Intronic
904493776 1:30875689-30875711 TGGGATATTCTGGATGGGGCAGG - Intronic
904942634 1:34176140-34176162 GGGGGAATTATGAATGGGGATGG + Intronic
905385130 1:37597636-37597658 TGAGGTATTCTAATTGAGCAGGG + Intergenic
906604605 1:47158334-47158356 TGGGGTTTTCTAAATGTACAAGG - Intergenic
908140442 1:61179036-61179058 TGGGGCAGGCTGAAAGGGCAGGG - Intronic
911124059 1:94323767-94323789 TGGGGTTTTCTGAAGTGCCAAGG - Intergenic
912245002 1:107952647-107952669 TGGGTTAGAGTGAATGGGCATGG - Intronic
913494998 1:119420343-119420365 TTGGGTAGTCTGAATGTGGAGGG - Intronic
913504998 1:119508760-119508782 TGGGGGATTCTCTGTGGGCAGGG - Intronic
916690303 1:167183883-167183905 TGGGCTATACTGAATGTGAATGG - Intergenic
917957172 1:180111363-180111385 TGGGTTATTTTCAGTGGGCAGGG + Exonic
919929177 1:202210057-202210079 TGGGGTATTTGGAAGAGGCAAGG + Intronic
924094579 1:240537977-240537999 TCGGGTTTTTTAAATGGGCATGG - Intronic
924166791 1:241291862-241291884 TTGGGAATTCTGGCTGGGCATGG - Intronic
1063363291 10:5474082-5474104 TGGGATATTGTCAATGAGCAGGG - Intergenic
1066625684 10:37403024-37403046 AGGGCTATTCTGAATGAGGAAGG + Intergenic
1067979811 10:51073211-51073233 TGGGGAATATTGAGTGGGCAGGG + Intronic
1068579244 10:58720556-58720578 TGGGGCATTCTGTGTGGGAAAGG + Intronic
1070605366 10:77894655-77894677 TAGGATCTTCTGGATGGGCAAGG + Intronic
1071892234 10:90022888-90022910 TGGGGGATACTGACTGGGAATGG + Intergenic
1072191002 10:93076053-93076075 TGGAGTATTTTGAAAGTGCAGGG + Intronic
1072830488 10:98652540-98652562 TGGGAGATTGGGAATGGGCAGGG - Intronic
1075083164 10:119397233-119397255 TGGAGTATTCTGAAGGGTCAGGG + Intronic
1076178113 10:128384336-128384358 TGGGGAATTCAGAGTGGGCCTGG + Intergenic
1076613165 10:131738881-131738903 TGGGGTGTTGGGAGTGGGCAGGG - Intergenic
1078346685 11:10555908-10555930 AGGGGCATTCTGAAAGGGCAGGG + Intergenic
1081021073 11:37948201-37948223 TGTGTTATTCTGAATGGTGAAGG + Intergenic
1083401735 11:62428123-62428145 TGGTGTATTCTGAAAGTGCTTGG - Intergenic
1086920497 11:92581145-92581167 TGGAGTATGCTGGATGGGGAGGG - Intronic
1090695024 11:129231704-129231726 TAGGGAATTCTGAATTGGGATGG - Intronic
1091945786 12:4540017-4540039 TAGGGTATTATTAGTGGGCATGG + Intronic
1092199316 12:6570265-6570287 GGGGGTATTCAGAGTGGGCTGGG - Exonic
1093221496 12:16425810-16425832 TGGGGTATTGAGAAAGGGCTTGG - Intronic
1095938245 12:47708301-47708323 GGAAGTATTCTTAATGGGCAGGG - Intergenic
1103024526 12:117562844-117562866 TGGGGTTTTCTGCATGAGCAAGG - Intronic
1104801869 12:131559856-131559878 TGGGGTCTTGTGAGTGGGAAGGG - Intergenic
1104801939 12:131560110-131560132 TGGGGTCTTGTGAGTGGGAAGGG - Intergenic
1118856174 14:69624848-69624870 TGGGGAATTCTGGATGTGAATGG + Intronic
1124086991 15:26560328-26560350 TGGAGAATTCAGAAAGGGCAAGG + Intronic
1126610218 15:50521330-50521352 TGGGATATTTTGGCTGGGCATGG - Intronic
1129674330 15:77624364-77624386 TGGAGGATGCTGACTGGGCATGG + Intronic
1131494948 15:92900139-92900161 TGGGGTGGTCTGGAGGGGCAGGG + Exonic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1142743593 17:1943837-1943859 TGGGGTGTGCAGGATGGGCAGGG + Intronic
1144725243 17:17498564-17498586 TGGGGCATTCAGAATGGGAATGG - Intergenic
1146497783 17:33338230-33338252 TGAGGTGTTCTGGAAGGGCAAGG + Intronic
1147721536 17:42542782-42542804 TGGAGGTTTCTGAATGGGCGTGG - Intronic
1148876047 17:50687776-50687798 TGGGGCATCAGGAATGGGCAGGG + Intronic
1149888147 17:60361230-60361252 TGGGGAAGACTGAATGGGCACGG - Intronic
1156517001 18:37688626-37688648 TGAGGTAGACTGAATGGGCTTGG - Intergenic
1159053182 18:63440730-63440752 TGGGTTATGGTGAAAGGGCATGG + Intergenic
1159417502 18:68172380-68172402 TGGGGTACTCTGGATGGAGACGG - Intergenic
1160018905 18:75165347-75165369 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018914 18:75165403-75165425 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018922 18:75165459-75165481 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018944 18:75165608-75165630 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018955 18:75165683-75165705 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018962 18:75165720-75165742 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018966 18:75165739-75165761 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018973 18:75165776-75165798 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018983 18:75165851-75165873 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018990 18:75165889-75165911 TGGGGTATCCTGTATGAGCTAGG + Intergenic
1160018995 18:75165908-75165930 TAGGGTATGCTGCATGGGCCTGG + Intergenic
1164638135 19:29806343-29806365 TGCGGGATTCTGATTGGCCAAGG + Intergenic
1165002010 19:32772031-32772053 TCAGGAATTCGGAATGGGCATGG + Intronic
1168131147 19:54320071-54320093 TTGGGGATTCTGAATGGCCAGGG + Intergenic
925132206 2:1502035-1502057 TGGGGTCCTCAGAATGGGAATGG - Intronic
927832516 2:26364487-26364509 TGGGGTATTGTGATTGGGGAAGG - Intronic
930245973 2:48983797-48983819 TGAGGTGATCTGAATGAGCAGGG + Intronic
940782962 2:157952755-157952777 TGGGGTTTTCTACATTGGCACGG - Intronic
940856474 2:158732258-158732280 AGGGGCATTCAGAAGGGGCATGG - Intergenic
944633737 2:201654264-201654286 TGGTGTTTTCTGGCTGGGCACGG - Intronic
946497196 2:220206396-220206418 TTGGGAATTCTGAATGAGAAAGG + Intergenic
946982761 2:225235985-225236007 TGGGGTCTTCAGAATGAGAATGG - Intergenic
1172046548 20:32084527-32084549 TGGGGAAGTCTGGATGGGTAAGG + Exonic
1173088529 20:39948274-39948296 TGGAAGATTCTGATTGGGCATGG + Intergenic
1175617958 20:60419278-60419300 TGTGGGATTGTGGATGGGCACGG - Intergenic
1176364277 21:6023207-6023229 TGGGCTTTTCAGATTGGGCAGGG + Intergenic
1176925304 21:14741991-14742013 TGGGGTATACTAATTGGGAAGGG - Intergenic
1177851890 21:26358636-26358658 AGGGGTATTCTGTACAGGCAGGG + Intergenic
1178158553 21:29883678-29883700 TGTGACATTCTGAATGGGAATGG + Intronic
1179759241 21:43515338-43515360 TGGGCTTTTCAGATTGGGCAGGG - Intergenic
1183013733 22:34969105-34969127 TGAGGTATGCAGAATGGGAAGGG - Intergenic
1183740284 22:39665094-39665116 TGGGGTATGCTGGAAGAGCAGGG + Intronic
949558956 3:5185460-5185482 TGGAGTTTTCTGATTGGGTATGG + Intergenic
952216878 3:31287108-31287130 TGGAGTAGTTTGAATGTGCAGGG - Intergenic
955322289 3:57982933-57982955 TGGTGTAGGCTGAAGGGGCATGG - Intergenic
955457104 3:59135296-59135318 TTGGGTGTTCACAATGGGCAGGG + Intergenic
958007610 3:87832616-87832638 AGGGGTATTCTGGCTGGGCGCGG - Intergenic
958801089 3:98756728-98756750 TGGGATATGCTGAAGGGTCATGG - Intronic
960626240 3:119685069-119685091 TGGGGTTTTCAGAAAGGGAAGGG - Intergenic
961144959 3:124585826-124585848 TGGGGTATTGTAAATGGGGGTGG - Intronic
962288033 3:134105018-134105040 TGGGGGATTCTGTGTGGTCAGGG - Intronic
964937919 3:162116270-162116292 GGGGGTATTCTGAACTGGAAAGG + Intergenic
965330615 3:167370199-167370221 TGGGCTAGTCTGACTGAGCAGGG + Intronic
967134454 3:186501742-186501764 TGAGGTGTTCTGACTGGGCCAGG - Intergenic
969474276 4:7412443-7412465 CGGGGTCGTCTGGATGGGCAGGG - Intronic
972340569 4:38149154-38149176 TGGGGGATTTTGGCTGGGCATGG + Intergenic
974771768 4:66423665-66423687 TGGTGAATTCTGAAAGGACATGG - Intergenic
976055888 4:81066565-81066587 TGGGGATTTCTGAAGGGGCTGGG - Intergenic
977837446 4:101662041-101662063 TGGAGTTTTCTGAATGGCCATGG + Intronic
978407066 4:108391428-108391450 TGGGGTGTTCTTAATGGCCAGGG - Intergenic
979308023 4:119170399-119170421 GAGGGTATTGTGATTGGGCAGGG + Intronic
980625359 4:135368561-135368583 TTGGGTGTTTTGAATGGGGAGGG + Intergenic
981580382 4:146244017-146244039 TGGGTTTTTCTCAATGAGCACGG + Intergenic
984159731 4:176237293-176237315 TGGGGTATTCTGACCAGTCAAGG - Intronic
984706179 4:182848712-182848734 TGGGGAATTCTGAATGAGCATGG - Intergenic
987382000 5:17294313-17294335 TGGGTTATTCTTCAAGGGCAGGG - Intergenic
990779088 5:59337811-59337833 TGGGGTATTCTGAATGGGCATGG + Intronic
993130803 5:83896011-83896033 TGGGGTGTTCTGATTGGGTAAGG - Intergenic
993339668 5:86707918-86707940 TGGAGTACTGTGAATGTGCATGG + Intergenic
996109989 5:119554077-119554099 AAGGGTATTCAGGATGGGCACGG - Intronic
998370244 5:141656121-141656143 TGGGGCAGTCAGAAAGGGCAGGG + Intronic
998524345 5:142828696-142828718 TGGGGTAGTCTGGTTTGGCAAGG + Intronic
999055197 5:148567481-148567503 TGGGATATTCTGCATGAGCTGGG - Intronic
999716427 5:154364501-154364523 TGGGGTGTTTTGCATGGGGAGGG + Intronic
1003329617 6:5119134-5119156 TGGGATATTCTTAATGTGGAGGG + Intronic
1004801006 6:19147688-19147710 TGGGGAATTGTGACTGGGCAGGG - Intergenic
1007662116 6:43493085-43493107 TGGTGTATTCTGAAACGGCTGGG + Intronic
1007712197 6:43831515-43831537 TGGGGCATTCAAGATGGGCAGGG - Intergenic
1008093766 6:47317739-47317761 AGGGATATTGTGAAGGGGCAGGG - Intergenic
1009796231 6:68471711-68471733 TTGTGTATTCTGGCTGGGCATGG - Intergenic
1010613989 6:77990897-77990919 TGTGGTGTTCTGATTGGCCAAGG + Intergenic
1012100863 6:95084270-95084292 TGAGGTATGCAGAATGAGCAAGG - Intergenic
1012397652 6:98818485-98818507 AGGGAAATCCTGAATGGGCATGG + Intergenic
1015255484 6:131174912-131174934 TGGGGAATTCTGACTACGCAGGG - Intronic
1016113348 6:140253438-140253460 TCAGATATTCTGAATGGCCAGGG - Intergenic
1019813724 7:3184135-3184157 AGGGGTATTTTGGCTGGGCATGG - Intergenic
1022042752 7:26596009-26596031 TGGAGTTTTCTGAATAGGCCTGG + Intergenic
1022429304 7:30300435-30300457 TGGGGTATTCTGGCTGGGTGTGG - Intronic
1022524944 7:31030865-31030887 TGGGTTATTCTAAAAGAGCAAGG - Intergenic
1024556053 7:50604495-50604517 TGGGGTCTTCAGATGGGGCAAGG - Intronic
1026901899 7:74042028-74042050 TGGGGTCTTGTGGCTGGGCACGG - Intronic
1027705950 7:81533746-81533768 TGAGGAATTCTGGGTGGGCATGG + Intergenic
1027717411 7:81690285-81690307 TGCGGGTTTCTGAATTGGCAGGG + Intergenic
1029222388 7:99000726-99000748 TGGGGTGTCCTGAAGGAGCAGGG + Intronic
1029950007 7:104573838-104573860 TGGGGAATTCATAATGGGAAAGG - Intronic
1032427443 7:131833102-131833124 TGGGGTATTCTGCATATGAATGG - Intergenic
1032538837 7:132686552-132686574 TGGGGTGTTCTTTATGGCCAAGG - Intronic
1035411335 7:158645078-158645100 TGGGATATTCAGAATAGGCAAGG + Intronic
1038301492 8:26354366-26354388 TGGGGTATTGAGAATGTGCAGGG + Intronic
1042244730 8:66699048-66699070 TGGGATAATGTGACTGGGCAAGG - Intronic
1050996175 9:12220097-12220119 TGGGGAGTTCTGAATAGCCATGG - Intergenic
1054994125 9:71365280-71365302 TGGGGTTTTCTTAGTGGGAAGGG - Intronic
1055420502 9:76136123-76136145 TGAATTATTCTGAATGGGCTGGG + Intronic
1055604167 9:77950446-77950468 AGCTGTATTCTGAATGGGGAAGG - Intronic
1059100911 9:111470641-111470663 TGGGCTATGCTGGATTGGCAGGG - Intronic
1061366529 9:130174852-130174874 TGGTGGATTCTAAATGGGAAGGG + Intronic
1061965028 9:134008626-134008648 GGGTGTATTCTGCATGTGCAAGG - Intergenic
1185691306 X:2157311-2157333 TGGAGCCTTCTGGATGGGCACGG + Intergenic
1189716693 X:43874379-43874401 TGGGTTATTCTGAATGCCCAAGG - Intronic
1192035652 X:67560162-67560184 TGGGGAACTCTGAATTGGGAAGG - Intronic
1198214832 X:134546108-134546130 GGTGGTATTCTGATTGGGAAGGG + Intergenic
1198408363 X:136339314-136339336 TTGGTTTTTCTGAATGGGCGAGG + Intronic
1200833897 Y:7714123-7714145 TAGTGTATTCTGCAGGGGCAGGG - Intergenic