ID: 990780062

View in Genome Browser
Species Human (GRCh38)
Location 5:59350498-59350520
Sequence GCTTCCTTTTGCCACATTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990780062_990780066 24 Left 990780062 5:59350498-59350520 CCATGAATGTGGCAAAAGGAAGC 0: 1
1: 0
2: 4
3: 17
4: 242
Right 990780066 5:59350545-59350567 ATCGGAACACATTTGCTAATAGG 0: 1
1: 0
2: 0
3: 4
4: 82
990780062_990780063 6 Left 990780062 5:59350498-59350520 CCATGAATGTGGCAAAAGGAAGC 0: 1
1: 0
2: 4
3: 17
4: 242
Right 990780063 5:59350527-59350549 TCCTCACACTTGCCATGAATCGG 0: 1
1: 0
2: 0
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990780062 Original CRISPR GCTTCCTTTTGCCACATTCA TGG (reversed) Intronic
901562710 1:10085403-10085425 TCTTTCATCTGCCACATTCAGGG - Intronic
902743546 1:18457525-18457547 TCTTGGTTTTGCCACTTTCAGGG + Intergenic
902924919 1:19689776-19689798 GCTCCCTTTCACCCCATTCAGGG + Intronic
903673810 1:25052105-25052127 GCTGCCCTTTGCCAAGTTCACGG + Intergenic
903939922 1:26922350-26922372 GCCTCCTATTCCCCCATTCAAGG - Intronic
904052702 1:27649427-27649449 GCTTCTTCTTGCCACCTTCGTGG - Intergenic
904546899 1:31282030-31282052 GTTTCCTTTTTCCTCATTAAGGG - Intronic
904843359 1:33388913-33388935 TCTTCCCTTCTCCACATTCAAGG - Intronic
906137594 1:43510412-43510434 GATTCCTTGTGCCTCATACATGG - Intergenic
906162377 1:43659857-43659879 GCTTCCTTTTGGCTGGTTCAGGG + Intronic
906382355 1:45340880-45340902 GCTTCCTCTCCCCAAATTCAGGG + Intronic
907355785 1:53872753-53872775 TGTTCCTTTTCCCACCTTCAGGG - Intronic
907922763 1:58928880-58928902 TCTTCCCCCTGCCACATTCATGG + Intergenic
907933072 1:59018164-59018186 ATTGCCTTTTGCCACATTCCAGG - Intergenic
909213062 1:72848977-72848999 TCTTCATTCTCCCACATTCATGG - Intergenic
910062078 1:83105943-83105965 GCTTCTTTTTGCTAAATTCTGGG - Intergenic
910532813 1:88259792-88259814 GCTTCCTTTGGCCAAAGACATGG - Intergenic
911668745 1:100584889-100584911 GCTTCATTTTTGCACAGTCAGGG + Intergenic
916442263 1:164839100-164839122 GCTTCCCTTTGCCCCACTCTTGG + Intronic
919094451 1:193013210-193013232 GCTCACTTTTGCAACAGTCAGGG - Exonic
919465747 1:197920257-197920279 CCTACCTTTTGCCCCATTCCGGG + Intronic
919765253 1:201123055-201123077 GCTTCTCTTAGCCACATCCAAGG - Intronic
920774301 1:208921176-208921198 GCTTCCAATTGCTACATTCACGG - Intergenic
921984904 1:221302392-221302414 GCTTCCTCTTACCACATTGTGGG + Intergenic
923014323 1:230114181-230114203 GATTCCTCTGGCCACATTCAGGG + Intronic
1063798211 10:9537714-9537736 TCTTACTTTTGGCAAATTCAAGG - Intergenic
1064814535 10:19244014-19244036 GCTTCCTTTGGCTAATTTCAAGG - Intronic
1065453931 10:25886928-25886950 TCTGCCTTTTGCTACATTGATGG + Intergenic
1065526289 10:26624667-26624689 TCTTTTTTTTGCCACTTTCATGG - Intergenic
1065926854 10:30442267-30442289 CCTTCCTTCTACCACACTCATGG - Intronic
1066308282 10:34169318-34169340 GTTTCCTTTTGTCACCATCATGG - Intronic
1067571317 10:47373170-47373192 TCTAACTTTTGCCACATGCATGG - Intronic
1068312550 10:55296420-55296442 GCTTTCTTTAACCACATCCAAGG - Intronic
1071385334 10:85113846-85113868 ACTTCCATTTTCCACATTCCTGG + Intergenic
1073029180 10:100511152-100511174 ACTTCAGTTTGCCACATACAGGG + Intronic
1073432624 10:103496025-103496047 ACTTCCATCTGCCAGATTCAAGG - Intronic
1074296050 10:112190562-112190584 ACTTACTTTTACCACATTTATGG + Intronic
1074937454 10:118196491-118196513 GCTTCTTTTTTCCATATTCTTGG + Intergenic
1076796661 10:132801645-132801667 GGTTCTTCTTTCCACATTCATGG + Intergenic
1078435598 11:11322486-11322508 GCTACCTTGGCCCACATTCAAGG + Intronic
1079137567 11:17784591-17784613 GCTCCCTCCTGTCACATTCATGG - Intergenic
1081353769 11:42088231-42088253 GCTTCCTGTTCCCATTTTCAGGG - Intergenic
1082889814 11:58126870-58126892 CCTTCCTTTTGACACATTGGGGG + Intronic
1084474629 11:69381734-69381756 TCTTCCTTTTGCGCCACTCACGG - Intergenic
1087689913 11:101308741-101308763 GCTTCCTTTTTTCACTTTTAAGG + Intergenic
1089539599 11:119181944-119181966 GGTTCCTCTTGCCCCATGCAGGG + Intronic
1090985315 11:131761137-131761159 CCTGCCTCTTGCCACTTTCACGG - Intronic
1091270785 11:134310461-134310483 TCTTCCTTTTGTCTCACTCACGG + Intronic
1091829065 12:3536375-3536397 GCATCCTTTTGCCTCCTGCATGG + Intronic
1091855470 12:3735950-3735972 GCTTCTCTTTGCAGCATTCATGG - Intronic
1095672756 12:44879037-44879059 GCCTCCTTCTTCCACATTTAAGG - Intronic
1096572119 12:52529510-52529532 GCTTCCCTCTTCCACATTTAAGG - Intergenic
1098386667 12:69927025-69927047 GCCTCCTTCTCCCAGATTCAAGG + Intronic
1100162156 12:91872936-91872958 GCTTCCCTCTGCCCCATCCATGG + Intergenic
1100892633 12:99142835-99142857 GCTTCCTTTTGAAACAGTGAGGG + Intronic
1104371250 12:128225647-128225669 GCCTCCTTCTTCCACATTTAAGG - Intergenic
1104806743 12:131594283-131594305 GCTTCCGTTTGTCAATTTCATGG - Intergenic
1107024092 13:35782037-35782059 GCCTCCTTTTGCCATTTTGATGG - Intronic
1107204668 13:37769273-37769295 GCTTCCTTTGACCACAGTTAAGG - Intronic
1107549427 13:41461084-41461106 CCTTCCTGTTCCCACTTTCAGGG + Intronic
1108433738 13:50380867-50380889 TCATCCTTTTACCTCATTCATGG + Intronic
1110244189 13:73303256-73303278 CCTTCCTTTTGCCAAAATAAAGG - Intergenic
1114166414 14:20223207-20223229 CCTTCCTTTTGCTACTCTCAGGG - Intergenic
1115414766 14:33119438-33119460 GCTTGCTGTTGCAACAATCAAGG + Intronic
1115989497 14:39137765-39137787 GCTTCATTTTCCCACTTTCCTGG - Intergenic
1116740028 14:48742712-48742734 GCTTCCTTTTGCCTGATTCTTGG - Intergenic
1117814560 14:59583467-59583489 CCTCCCTTTTCCCACCTTCAAGG - Intergenic
1118009959 14:61600871-61600893 GCTTCCTTTTTACTCATTTAGGG + Intronic
1118163749 14:63316156-63316178 GTTTTCTTTTGCCTCATTCAGGG - Intronic
1118243188 14:64081695-64081717 GCTTCCTTCTGCCACTGACATGG - Intronic
1118552640 14:66972566-66972588 GCCCCATTTTGTCACATTCAAGG + Intronic
1118895046 14:69938855-69938877 GCTTTCTTCTTCCACATTCTTGG + Intronic
1121406391 14:93721650-93721672 GCTTCCTTCTGACACTCTCACGG - Intronic
1122482161 14:102054312-102054334 TCTTCCCTCTGCCACATCCAGGG + Intergenic
1127821002 15:62656171-62656193 GCTGGCTTCTGCCACATTTATGG + Intronic
1128872454 15:71171983-71172005 GCTTCATTTTGTCACTTTGATGG - Intronic
1130065284 15:80597623-80597645 CCTCCATTTTGCCACTTTCAAGG - Exonic
1131410273 15:92201506-92201528 GATTCCATTTCCCACATTCTGGG - Intergenic
1133269803 16:4605311-4605333 GGTTCTTTGTGTCACATTCAAGG + Intergenic
1134115805 16:11547582-11547604 GCTTCATTTTGCTAGATGCAAGG - Intergenic
1135796086 16:25444254-25444276 CCTTCCTTTTGCCAAATACTTGG + Intergenic
1138508794 16:57495345-57495367 TTTTCCTTTTGCCTCATACATGG - Intergenic
1139900426 16:70323739-70323761 GCTGCTTCTTGCCACCTTCAAGG + Intronic
1139922634 16:70469490-70469512 TCTTCCTTTTGTCTCATTCCTGG + Intronic
1141348061 16:83266742-83266764 GCTGTCTTTTACCTCATTCATGG + Intronic
1141833546 16:86523314-86523336 TTTTCCTTTTGCCACAGTCACGG + Intergenic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1144192391 17:12858528-12858550 GCCCCCTTTTGCTACTTTCAAGG - Intronic
1144478185 17:15607394-15607416 GCTTCATTTTGCACCATTCTTGG - Intronic
1144920109 17:18756312-18756334 GCTTCATTTTGCACCATTCTTGG + Intronic
1145888161 17:28396887-28396909 GGTATCTTTTGCCACATCCAGGG + Exonic
1147714347 17:42494562-42494584 ACTTCCTTTTGATAAATTCATGG - Intronic
1148395332 17:47303749-47303771 GCTTCCCTTTAACACCTTCATGG + Intronic
1149368135 17:55966062-55966084 GCTTCCATATGGCACATCCAGGG - Intergenic
1151903901 17:77035344-77035366 GGGTCCTTATGCCACAGTCATGG + Intergenic
1161422663 19:4184375-4184397 GCTTCTTTCTCCCACATACAAGG - Intronic
1161481116 19:4511125-4511147 GGTCCCTTTGGCCACATTTACGG + Exonic
1161481414 19:4512610-4512632 GGTTCCTCTGGCCAAATTCATGG + Exonic
1161481475 19:4512907-4512929 GGTTCCTTTGGCCACATTCATGG + Exonic
1161481494 19:4513006-4513028 GGTTCCTTTGGCCACATTCATGG + Exonic
1161481513 19:4513105-4513127 GGTTCCTTTGGCCACATTCATGG + Exonic
1161868302 19:6850830-6850852 ACCCCCTTTTCCCACATTCAGGG + Intronic
1162427284 19:10603934-10603956 CCATCCTTTGGCCAAATTCAAGG - Intronic
1163288449 19:16363859-16363881 GCTTTCTTTTTGCATATTCAAGG + Intronic
1164149179 19:22533551-22533573 GGTCCCTTTTTCCACATTCAAGG + Intergenic
929356295 2:41028924-41028946 GGTTGCTATTTCCACATTCAAGG - Intergenic
929408183 2:41666837-41666859 GCCTCCCTGTGCCACATTTAAGG + Intergenic
930451978 2:51552909-51552931 GCTTCCTTTTGGCAGTTTCACGG + Intergenic
931199102 2:60079833-60079855 TCTTCCAATGGCCACATTCATGG - Intergenic
931641323 2:64383204-64383226 GCTTCCGTCTCCCTCATTCAGGG - Intergenic
933402981 2:81822226-81822248 CCTCCCTTCTGCCACATTAAGGG + Intergenic
933656522 2:84891713-84891735 AGTTCCTTTTGCCACATGAATGG + Intronic
935081931 2:99806921-99806943 GTTTCCATGTGCCACATTCCAGG - Intronic
935830528 2:106996954-106996976 CCTTCCTTTGGCCACATCAAGGG + Intergenic
939442243 2:142264126-142264148 ACTTCCTTTTGCTTCATTGATGG - Intergenic
940577137 2:155523057-155523079 GCTTCCTCTTGTCATCTTCAAGG + Intergenic
940909331 2:159196387-159196409 GGTTCCCTTTGCAAGATTCAGGG - Intronic
941848433 2:170154869-170154891 TGTTGTTTTTGCCACATTCAAGG - Intergenic
943190161 2:184665913-184665935 GCCTCCTTCTTCCACATTTAAGG + Intronic
944546078 2:200800072-200800094 GCCTCCCTTTTCCACATTTAAGG - Intergenic
945299902 2:208206444-208206466 GCTTCCATTTGCCACCTTCATGG - Intergenic
946625728 2:221610614-221610636 ACTTCCTTTTTCTTCATTCAAGG - Intergenic
947900414 2:233717161-233717183 GGGTGCTCTTGCCACATTCAAGG - Intronic
1174736322 20:52969208-52969230 CCTTCCTTTCGCCAAGTTCAGGG + Intergenic
1180975737 22:19847083-19847105 GCTTCCTTTGGCCACAGAAATGG + Exonic
951079061 3:18429614-18429636 GCTTCCTTTCCCCAAGTTCAAGG - Intronic
952495188 3:33909620-33909642 GTTTTCTTTTGCCAAATGCATGG - Intergenic
952582997 3:34856478-34856500 GCTTCCATATGCCATATTTAGGG - Intergenic
953805656 3:46065404-46065426 GCTTCCATTTGCCACACTCTGGG + Intergenic
954667878 3:52268359-52268381 GTTTCCTTTTGCCTGATTCCAGG - Intronic
954921137 3:54192017-54192039 GCTGCCTTCTAGCACATTCATGG + Intronic
956313828 3:67912613-67912635 ACTTCATTTTGCCTCACTCAGGG - Intergenic
956346268 3:68282550-68282572 GCTTCCTTGTCTCACATTCAAGG - Intronic
957582342 3:82090322-82090344 CCTTCCTTTTGCCTTCTTCATGG - Intergenic
957649824 3:82985477-82985499 GCTTCCTTTTGCCTCAAGCTGGG + Intergenic
957958471 3:87219669-87219691 GCTTTCTTCTTCCACATTTAAGG - Intergenic
959078686 3:101778325-101778347 ACTTCCTTTTATCCCATTCACGG + Intergenic
959554743 3:107703923-107703945 GCTTCCTTTTGGTATTTTCATGG + Intronic
959929452 3:111963013-111963035 GCTTCCTTTTAACAAATACAAGG - Intronic
962734014 3:138307999-138308021 GCTTCCTTTGTCCACACTCTAGG - Intronic
964192735 3:154023906-154023928 TGTTCCTTTGGCCACATACATGG + Intergenic
964509181 3:157431477-157431499 GCTTCCCTTTTCCACTTTTAAGG + Intronic
965327629 3:167327596-167327618 GCTTCATTTTAAAACATTCATGG + Intronic
965934530 3:174090873-174090895 GCTTCATTCTGGCACATCCAGGG + Intronic
967320054 3:188186027-188186049 GCTTCCTATTTCCTCATTCAGGG + Intronic
967350414 3:188508270-188508292 TCTTCCATTTGCCACATACTAGG - Intronic
967388762 3:188934923-188934945 GCTTCCTTGGGCCACATTAGAGG - Intergenic
967875054 3:194262936-194262958 GCCTCCTTTTTCCAGATTAAGGG + Intergenic
969505720 4:7586213-7586235 GCTTCCTTCTGCCACCTTCTGGG + Intronic
972072643 4:35039582-35039604 GCTTACTTTTATCAAATTCATGG + Intergenic
973270137 4:48254345-48254367 GCTTCCCTTTGCCACTTCTAGGG - Intronic
973686069 4:53371077-53371099 ACTTCCTTAGGGCACATTCAGGG - Intergenic
973851695 4:54967230-54967252 CTTTCCTTCTGCCTCATTCAAGG + Intergenic
975211363 4:71703898-71703920 GCTTCCTTCTTCCACTTTTAAGG + Intergenic
977844305 4:101748556-101748578 ACTTGCTCTTGCCACATTCTAGG - Intronic
980321060 4:131276091-131276113 GTTTCCTTTTTTCACACTCATGG - Intergenic
983499740 4:168485213-168485235 GCTACCTAGTGCTACATTCATGG - Intronic
983806224 4:171996648-171996670 GCTTCCCTGGGCCACATTCGAGG + Intronic
983976292 4:173938432-173938454 AGTTCCTTTTTCCTCATTCAAGG + Intergenic
984248282 4:177301754-177301776 GCTTTCTTTTGCCAAATTCTTGG - Intergenic
984810717 4:183794159-183794181 GCTTTCTTTTTACAGATTCAGGG + Intergenic
984862351 4:184252279-184252301 CCTTCCCTCTTCCACATTCAGGG - Intergenic
985841873 5:2312456-2312478 CCTTCCTTTTGCCTCCTTCCAGG + Intergenic
986875100 5:12097768-12097790 GCTTGCATTTGTCACATTTAAGG - Intergenic
987726927 5:21715323-21715345 TCTTCCTTATGCCTCACTCATGG + Intergenic
990031840 5:51270790-51270812 ACTTCCTTATGTCACATTCAAGG - Intergenic
990780062 5:59350498-59350520 GCTTCCTTTTGCCACATTCATGG - Intronic
997288154 5:132699137-132699159 CCTTCGTTTTACCAGATTCAAGG + Intronic
999257625 5:150218529-150218551 GCTTCCATTTGCCACCTTTGCGG - Intronic
1000150644 5:158497377-158497399 GCTTGCTTTTGTCACATTATAGG - Intergenic
1000638943 5:163678138-163678160 GATTCCTTTTGGCACACTTAAGG - Intergenic
1001547397 5:172579133-172579155 GCTTCCTTGTGGCCCACTCATGG + Intergenic
1001558933 5:172656683-172656705 GCTTCTTCTTGCCACCTTCGCGG + Intronic
1003293264 6:4801027-4801049 GCTTCCTGTTGTCACATTTTTGG + Intronic
1003519410 6:6845176-6845198 TCTTCCTTCTGCCAAATTGATGG - Intergenic
1007342398 6:41199985-41200007 GCTTCCTTTTCCCACATGCTGGG + Intronic
1011832926 6:91395161-91395183 GCTTCCTTTAGCCATACTAAAGG - Intergenic
1012427182 6:99127814-99127836 CCTTCCTTATGCCAGATGCAGGG + Intergenic
1012896159 6:104952319-104952341 GCTTCCTTTTGTGCCATTCTGGG + Intergenic
1015038143 6:128682759-128682781 GCTGCCCTTTGCCACACTCCGGG - Intergenic
1017362074 6:153585806-153585828 TCTTCCTTATGCCACATTTTTGG - Intergenic
1021796872 7:24264364-24264386 AGTTCATTTTGCCACATTGAAGG - Intergenic
1022789587 7:33673537-33673559 GCTCCCTTTTGCCACAGCCAGGG - Intergenic
1027598660 7:80210555-80210577 TATTCCATTTGCCACAGTCACGG - Intronic
1028835019 7:95365402-95365424 CCTTCATTTTCCCACATTCTTGG - Intronic
1030728668 7:112957514-112957536 TCTTCATTTTGCCATATTCAGGG + Intergenic
1032071632 7:128811372-128811394 TCTTCATATTGCCGCATTCAAGG + Intronic
1032704210 7:134408152-134408174 CCTTCCTTTTGATACATCCATGG + Intergenic
1037101519 8:15052952-15052974 GATTCCTTTGACCACACTCAAGG + Intronic
1037452838 8:19034335-19034357 CCTTCCTTCTGCAAAATTCATGG + Intronic
1037859754 8:22396771-22396793 ACTTCCTCTTGCCACATTTGGGG + Intronic
1038975042 8:32686152-32686174 ACTTGCATTTGCCACAATCAAGG - Intronic
1039229524 8:35428113-35428135 GGTAGCTTTTCCCACATTCATGG + Intronic
1040627866 8:49172592-49172614 GCTTCCTTTTGCTTCTTTCCAGG + Intergenic
1041413634 8:57583375-57583397 CCTTCCATTTTCTACATTCAGGG + Intergenic
1042648168 8:71010245-71010267 GCTTCCCTTGGCCTTATTCAGGG - Intergenic
1046361195 8:113158864-113158886 TCTTTCTTTTGCAACATTTAGGG + Intronic
1047730633 8:127725105-127725127 TCTTACTTTTGCCACTTTCCTGG - Intergenic
1049238724 8:141525752-141525774 GCCTCCATATGCCACATTCTCGG - Intergenic
1052197593 9:25736425-25736447 AATTCCTTTTGCCCCATACAGGG + Intergenic
1052715148 9:32106883-32106905 CCTTTCTTTTGCCACGTACATGG - Intergenic
1056368327 9:85928744-85928766 GTTTTCTTTTGTCATATTCATGG - Intergenic
1059480539 9:114586161-114586183 GCTTCCTATTTCCCTATTCACGG + Intergenic
1060371122 9:123072613-123072635 ACTTCACTTTGCCACATGCAAGG - Intronic
1060965634 9:127710982-127711004 GCTTCCTTTTGCCACTTATTGGG + Intronic
1061013450 9:127968568-127968590 GCCTTCTTGTGCCACCTTCATGG + Intronic
1061817857 9:133207124-133207146 GCTTCCTTTTCCCCCATGCCAGG + Intronic
1062719309 9:138027888-138027910 GCTTTCTTTTGTCACATTTGAGG + Intronic
1185651128 X:1648856-1648878 GGTTGCTTTTTCCCCATTCATGG - Intergenic
1187727456 X:22218209-22218231 GCTTCCATTTTCCACCTTCTTGG - Intronic
1188246979 X:27847895-27847917 CCTTCCTTGTCCAACATTCAAGG - Intergenic
1190092186 X:47448854-47448876 TGTTGCTTTTGTCACATTCACGG + Exonic
1190794169 X:53725632-53725654 GATTCCATGTCCCACATTCAGGG - Intergenic
1192054436 X:67758876-67758898 GCTTCCTTTTGCTACTGTTATGG - Intergenic
1192923129 X:75728995-75729017 GACTCCATGTGCCACATTCAGGG + Intergenic
1194017612 X:88643805-88643827 TGTTCCTTTTCCCACATCCAGGG + Intergenic
1194130597 X:90076368-90076390 AATTCATTTTTCCACATTCAAGG - Intergenic
1197234459 X:124043643-124043665 CCTTCCTTTTACAACATTCCAGG - Intronic
1200749139 Y:6929064-6929086 GCTTTCTTTGGGTACATTCATGG - Intronic
1201993992 Y:20062975-20062997 TCTTCCTTTTGACAGGTTCATGG - Intergenic
1201994426 Y:20068988-20069010 TCTTCCTTCTGGCAGATTCATGG - Intergenic
1201994443 Y:20069237-20069259 TCTTCCTTCTGGCAGATTCATGG - Intergenic
1201995365 Y:20081496-20081518 TCTTCCTTTTGGCAGGTTCATGG - Intergenic
1201996357 Y:20094778-20094800 TCTTCCTTCTGGCAGATTCATGG + Intergenic
1201996665 Y:20098698-20098720 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1201996964 Y:20102589-20102611 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1201997120 Y:20104725-20104747 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1201997328 Y:20107603-20107625 TCTTCCTTCTGGCAGATTCATGG + Intergenic
1201997691 Y:20112247-20112269 TCTTCCTTCTGGCAGATTCATGG + Intergenic
1201999724 Y:20139256-20139278 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1201999990 Y:20142892-20142914 ACTTCCTTCTGGCACGTTCATGG + Intergenic
1202000030 Y:20143390-20143412 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202000094 Y:20144265-20144287 TCTTCCTTCTGGCAGATTCATGG + Intergenic
1202000269 Y:20146648-20146670 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202000529 Y:20150219-20150241 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202001939 Y:20168961-20168983 ACTTCCTTCTGGCACGTTCATGG + Intergenic
1202001979 Y:20169459-20169481 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202002043 Y:20170334-20170356 TCTTCCTTCTGGCAGATTCATGG + Intergenic
1202002255 Y:20173220-20173242 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202002439 Y:20175850-20175872 TCTTCCTTTTGACAGGTTCATGG + Intergenic
1202002649 Y:20178732-20178754 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202002755 Y:20180110-20180132 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202002785 Y:20180489-20180511 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202003114 Y:20184866-20184888 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202003273 Y:20187004-20187026 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202003619 Y:20191634-20191656 TCTTCCTTCTGGCAGATTCATGG + Intergenic
1202004875 Y:20257992-20258014 TCTTCCTTCTGGCAGATTCATGG + Intergenic
1202007982 Y:20299150-20299172 TCTTCCTTCTGGCACGTTCATGG + Intergenic
1202008387 Y:20304632-20304654 TCTTCCTTCTGGCAGATTCATGG + Intergenic
1202008533 Y:20306500-20306522 TCTTCCTTCTGGCAGATTCATGG + Intergenic
1202008703 Y:20308618-20308640 TCTTCCTTCTGGCAGATTCATGG + Intergenic
1202008931 Y:20311484-20311506 TCTTCCTTCTGACACTTTCATGG + Intergenic
1202009286 Y:20316227-20316249 TCTTCCTTCTGACAGATTCATGG + Intergenic
1202009416 Y:20317852-20317874 TCTTCCTTTTGGCAGGTTCAGGG + Intergenic
1202009749 Y:20322357-20322379 TCTTCCTTCTGGCAGATTCATGG + Intergenic
1202011778 Y:20348855-20348877 TCTTCCTTCTGGCAGATTCATGG + Intergenic
1203336433 Y_KI270740v1_random:6231-6253 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1203336938 Y_KI270740v1_random:13106-13128 TCTTCCTTCTGGCAGATTCATGG + Intergenic
1203336958 Y_KI270740v1_random:13356-13378 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1203336979 Y_KI270740v1_random:13606-13628 TCTTCCTTTTGGCAGCTTCATGG + Intergenic
1203337110 Y_KI270740v1_random:15371-15393 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1203337228 Y_KI270740v1_random:16874-16896 TCTTCCTTTTGGCAGATTCATGG + Intergenic
1203337556 Y_KI270740v1_random:21261-21283 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1203338604 Y_KI270740v1_random:35050-35072 TCTTCCTTTTGGCAGGTTCATGG + Intergenic