ID: 990786415

View in Genome Browser
Species Human (GRCh38)
Location 5:59425498-59425520
Sequence GTCCCCTGCATGAGAGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990786409_990786415 18 Left 990786409 5:59425457-59425479 CCACTTATTACAATAAAAAAAGT 0: 1
1: 0
2: 5
3: 64
4: 735
Right 990786415 5:59425498-59425520 GTCCCCTGCATGAGAGGTGGAGG No data
990786410_990786415 -5 Left 990786410 5:59425480-59425502 CCCTAGACATTGCCAAATGTCCC 0: 2
1: 31
2: 129
3: 143
4: 276
Right 990786415 5:59425498-59425520 GTCCCCTGCATGAGAGGTGGAGG No data
990786408_990786415 19 Left 990786408 5:59425456-59425478 CCCACTTATTACAATAAAAAAAG 0: 1
1: 0
2: 8
3: 90
4: 907
Right 990786415 5:59425498-59425520 GTCCCCTGCATGAGAGGTGGAGG No data
990786411_990786415 -6 Left 990786411 5:59425481-59425503 CCTAGACATTGCCAAATGTCCCC 0: 16
1: 50
2: 185
3: 180
4: 305
Right 990786415 5:59425498-59425520 GTCCCCTGCATGAGAGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990786415 Original CRISPR GTCCCCTGCATGAGAGGTGG AGG Intronic
No off target data available for this crispr