ID: 990787184

View in Genome Browser
Species Human (GRCh38)
Location 5:59434779-59434801
Sequence CCTGATTAGCAGTTATTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990787184 Original CRISPR CCTGATTAGCAGTTATTGTC TGG (reversed) Intronic
902096314 1:13948801-13948823 CCTGTTTTGCTGTTATTTTCAGG + Intergenic
917245180 1:172993173-172993195 CCTGCTTAGCAGTTATTGGGAGG + Intergenic
917770322 1:178269950-178269972 CCTGATTAGCAGTTCGTGGTAGG + Intronic
919457991 1:197842757-197842779 CCTGATTAGGAGTCATTGTGAGG - Intergenic
923334197 1:232952710-232952732 CCCCATTAGGAGTTATTGTCAGG + Intronic
1067433393 10:46260466-46260488 CCTGATTTGCAGTTTGTCTCTGG - Intergenic
1074357665 10:112800297-112800319 CCTGATTAGCTTGGATTGTCCGG - Intronic
1078567880 11:12432622-12432644 CCAGATAAGCAGTTATTTTTTGG - Intronic
1080237322 11:30086263-30086285 CCTGATTAGGAGCTGTTGTCAGG + Intergenic
1080835792 11:35939721-35939743 TCTGACAAACAGTTATTGTCTGG - Intergenic
1088095811 11:106100196-106100218 CCAGTTTATCAGTTAATGTCAGG + Intergenic
1089910581 11:122095978-122096000 ACTAATTAGCATTTATTGCCTGG + Intergenic
1100831799 12:98523143-98523165 CATGATTAGCAGTTTCAGTCAGG - Intronic
1102444360 12:112990399-112990421 CCTGATTAGCAGTTAGTTGAAGG + Intronic
1103867714 12:124066311-124066333 CCTGATCAGCAGAAATTGTGAGG - Intronic
1113125600 13:106975475-106975497 TCTGATTAGTTTTTATTGTCAGG + Intergenic
1116060497 14:39918584-39918606 CCTGAGTAGCTGTGATTATCCGG + Intergenic
1121682517 14:95805496-95805518 TCTGATTTGCAGTGATTGCCAGG + Intergenic
1125189844 15:36978041-36978063 TTTGATAAGCAGTTATTTTCTGG + Intronic
1126432019 15:48596411-48596433 CTTCATTAGCATTTATTTTCAGG - Intronic
1128438304 15:67677916-67677938 CCTCAATGGCAGTTATTGCCTGG - Intronic
1131192056 15:90324708-90324730 CCTGATTAGCAGCAGTTGTGAGG - Intergenic
1136854002 16:33638358-33638380 ACTGATTATCAGTTTTTGTGAGG + Intergenic
1144058103 17:11559215-11559237 CCTGAGTGGCAGTCATGGTCAGG - Exonic
1144377681 17:14661700-14661722 CCTCATTGGCAGTGATTCTCAGG + Intergenic
1148810841 17:50290074-50290096 CTTGATTAGCAGTGCTTGTCAGG - Intergenic
1149010628 17:51853220-51853242 CCTGATTAGCAGTTTCTGTGGGG - Intronic
1150172903 17:63018736-63018758 ATGGATTAGCAGTTATTATCAGG - Intronic
1153040037 18:803823-803845 ACTGATTATCAGTTTTTGCCTGG - Intronic
1155601041 18:27547975-27547997 TCTGACCAGCAGTTATTGACTGG + Intergenic
1156690403 18:39700538-39700560 CCTGAATATCAGGTATTGTCTGG - Intergenic
1157215801 18:45782500-45782522 CCTGATTGGTAGTTATTTGCTGG + Intergenic
1158760659 18:60381787-60381809 CCTGCTGCACAGTTATTGTCTGG + Intergenic
1167194073 19:48014787-48014809 CATTATTAGCATTCATTGTCAGG - Intronic
926041965 2:9680658-9680680 CCTGATTAACACTTATTCTTAGG + Intergenic
926762049 2:16286740-16286762 CCTGATTATGAGTTATTGGAGGG - Intergenic
928942554 2:36741463-36741485 CCTGAGTAGCAAAGATTGTCTGG + Intronic
929490768 2:42394251-42394273 CCTTTTTAGCAGTTTTTGTTGGG - Intronic
929636052 2:43521645-43521667 CCTGAATAGCAGCTATAGCCTGG - Intronic
933159569 2:79009139-79009161 CCTGATAGGCTGTTACTGTCAGG + Intergenic
933254342 2:80063574-80063596 CCTGATTAACAGTATTTGCCTGG + Intronic
941438955 2:165509404-165509426 CTGGATTCGAAGTTATTGTCAGG + Intronic
941549022 2:166890712-166890734 CCTAAATAACAGGTATTGTCTGG + Intronic
942737184 2:179127752-179127774 CTTGTTTATCAGTTATTGTTTGG + Intronic
942905464 2:181174946-181174968 TATGACTAGCAGTTATTTTCTGG + Intergenic
943704936 2:191024456-191024478 CTGCATTAGCAGTTCTTGTCTGG - Intergenic
945971171 2:216233688-216233710 CCTGAGAAGCAGTTATGGTATGG + Intergenic
1169722765 20:8697148-8697170 CCTGATGAGAATTTATTGTTGGG - Intronic
1178039062 21:28619326-28619348 CCTTATGAGAAGTTATTTTCTGG + Intergenic
952396238 3:32922873-32922895 CCTGATTAGGAGGAATTGTTGGG + Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
955470091 3:59277804-59277826 CCTGATAAGAATTTATTGTTTGG - Intergenic
956184967 3:66553621-66553643 CCTGAATGGCAGTAATTGGCTGG - Intergenic
957176936 3:76823880-76823902 CCTGATTAGCAGTTGTTTTATGG + Intronic
960225574 3:115164413-115164435 TCTGATTAGCACTAATTTTCTGG + Intergenic
962626871 3:137234383-137234405 CCTGATTAGAAGGTAGTTTCAGG + Intergenic
968706653 4:2081465-2081487 CCTGCCTGGCAGTTACTGTCAGG - Intronic
977571831 4:98636984-98637006 CCTGATGAGCAGTCCTTGTCAGG + Intronic
978938429 4:114408274-114408296 CCAGGTGAGCAGTTATTATCTGG + Intergenic
980437501 4:132797439-132797461 TCTGATTAGCACTTTTTTTCAGG - Intergenic
980987084 4:139705843-139705865 CCTGAAGTGCAGTTATTGTCTGG + Intronic
982095224 4:151916069-151916091 GCTGAATAGCACTGATTGTCCGG + Intergenic
982674041 4:158355330-158355352 CCTGTTTAGCACTTTTTGCCAGG + Intronic
987253972 5:16129341-16129363 CATGATTAGCAGTGTTTGTTTGG + Intronic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
994156801 5:96513076-96513098 CCTGATTATCATTCATTCTCGGG + Intergenic
1004608695 6:17218342-17218364 TGTGATTAGCTGCTATTGTCAGG - Intergenic
1013020048 6:106205574-106205596 CCTGTTTAGCATTTTTTTTCAGG - Intronic
1013345238 6:109253770-109253792 CCTCTTCAGCAGTTAGTGTCTGG + Intergenic
1017831531 6:158134719-158134741 CCTGAATAACAGTTATTGTTAGG - Intronic
1018518009 6:164609375-164609397 CCTGATCAGCTTTTATTGCCTGG + Intergenic
1019015536 6:168877235-168877257 CTTGAGGAGCAGTTATTGGCTGG - Intergenic
1020941574 7:14545645-14545667 CCTGCTGAGCAGCTATTGTGAGG - Intronic
1021243822 7:18237238-18237260 CATGATTAGAAGTTATTTTTAGG + Intronic
1022127558 7:27372893-27372915 CATCATTAGCAGTTATGGTTGGG + Intergenic
1027364397 7:77442384-77442406 CCTTATTAGTTGTTATTTTCAGG - Intergenic
1032053373 7:128664045-128664067 CATGTTTGGCAGTTATAGTCAGG + Intergenic
1032704035 7:134406696-134406718 ATTGATTTGCATTTATTGTCAGG + Intergenic
1037684811 8:21129746-21129768 CCAGATTAGCAGCTAGTGCCTGG - Intergenic
1038909448 8:31946632-31946654 CCTGAATGGCACTTATTTTCAGG + Intronic
1040927362 8:52698610-52698632 CCTTATTAAAAGTTATTCTCTGG - Intronic
1050161201 9:2719973-2719995 CCTGATTAACATTTATTTCCAGG - Intronic
1052661340 9:31436181-31436203 CCTGCTTAGAAGATATTTTCTGG - Intergenic
1058657745 9:107239646-107239668 CCTCATAAGCAGTGATTCTCTGG + Intergenic
1058996274 9:110301634-110301656 CATGCTTAGGAGTTATTGGCAGG + Intergenic
1192859447 X:75050687-75050709 CTTGAAAAGCAGTTATTGTAGGG - Intergenic
1197929590 X:131680468-131680490 CCAGATTAGCATTTCATGTCAGG - Intergenic
1197945873 X:131839929-131839951 CCAGATTAGCATTTCATGTCAGG + Intergenic
1198469027 X:136928958-136928980 CCTGATCAGCAGTTATCCTCAGG + Intergenic