ID: 990790653

View in Genome Browser
Species Human (GRCh38)
Location 5:59475039-59475061
Sequence CTTCAAGTCATGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 359}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990790648_990790653 29 Left 990790648 5:59474987-59475009 CCAGCATGAACCAATATAATTTT 0: 1
1: 0
2: 2
3: 19
4: 241
Right 990790653 5:59475039-59475061 CTTCAAGTCATGAAGGAAGAAGG 0: 1
1: 0
2: 0
3: 40
4: 359
990790650_990790653 19 Left 990790650 5:59474997-59475019 CCAATATAATTTTGAGTTGGAAG 0: 1
1: 0
2: 2
3: 24
4: 225
Right 990790653 5:59475039-59475061 CTTCAAGTCATGAAGGAAGAAGG 0: 1
1: 0
2: 0
3: 40
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990790653 Original CRISPR CTTCAAGTCATGAAGGAAGA AGG Intronic
900037607 1:430508-430530 CTCTAAGTCAAGAAGGAAAATGG + Intergenic
903596533 1:24499770-24499792 GTTCAAATCAGGAAGGAAAAGGG + Intergenic
903649766 1:24915528-24915550 CTTAAAGCCAGGAAGGAAAAGGG + Intronic
905026015 1:34850047-34850069 CCACAACCCATGAAGGAAGAGGG + Intronic
905609441 1:39337383-39337405 CTTGAAATCTTCAAGGAAGATGG - Intronic
906046660 1:42836303-42836325 CTAGAAGTCATGAGTGAAGAGGG + Intronic
908771006 1:67595435-67595457 ATTCAAGTCCTGCGGGAAGAGGG + Intergenic
909042244 1:70668479-70668501 CTTCAAGTCAAGAAAGCAAATGG - Intergenic
909250638 1:73350341-73350363 CTTCAAATCCTGAAGGGTGATGG + Intergenic
910524337 1:88160555-88160577 TTTCAAGTCATGAAGCATAAAGG + Intergenic
913156276 1:116102419-116102441 AATCAAGTCATGAAGGGTGACGG + Intergenic
914946104 1:152067804-152067826 CTCCAAGAGATGAAGAAAGAAGG - Intergenic
914977495 1:152379736-152379758 CTTTAAGTCCTGTAGGGAGAAGG + Intergenic
915249151 1:154576284-154576306 CTCCAAGTCATGGGAGAAGAGGG + Exonic
916926469 1:169526430-169526452 CTTGAAAACATGGAGGAAGAAGG - Intronic
917170159 1:172164151-172164173 CTTAAAGTAATAAAGGAAAAGGG + Intronic
918229415 1:182514601-182514623 CTTCAAGTCCTGTAGAGAGAAGG + Intronic
918837538 1:189487173-189487195 CATCAAGTCATGAAAAAAGAGGG - Intergenic
919147135 1:193650571-193650593 TTTCAAGTGATGAAAGATGAGGG - Intergenic
919197413 1:194305035-194305057 ATTCAATTGATGAGGGAAGATGG - Intergenic
919579315 1:199351709-199351731 ATTGAAGTGATGAAGGTAGAGGG + Intergenic
919605014 1:199670972-199670994 CTTCCACTCATGATGGAAGGTGG + Intergenic
920749726 1:208662310-208662332 CTTCAAGGCTTCAAGGAAGAGGG - Intergenic
921712963 1:218391213-218391235 CTGCAAATCATCAAGGAAAATGG - Intronic
922338834 1:224639308-224639330 CTTCAAGGCCTGAAGTACGAGGG - Intronic
924395893 1:243620247-243620269 CTTACAGTCATGATGGAAGGGGG - Intronic
924416409 1:243860890-243860912 CTTCATGGCATGGAGGAGGAAGG + Intergenic
924620133 1:245653213-245653235 CTCCAAGGGAGGAAGGAAGAAGG - Intronic
924708510 1:246516814-246516836 CTACAGGTCATGAAAGAAAAGGG - Intergenic
1062937777 10:1400940-1400962 CCTCAAGGCAGGAGGGAAGAAGG + Intronic
1064292180 10:14045200-14045222 CATGAAGTCATGATGGCAGAAGG - Intronic
1064300111 10:14115741-14115763 CTTCCAATCATGGTGGAAGATGG - Intronic
1065131770 10:22628936-22628958 GTTCAGGCCATGATGGAAGAGGG - Intronic
1065691388 10:28337400-28337422 ATATAAATCATGAAGGAAGAAGG + Intergenic
1069200657 10:65611047-65611069 CTTCAAATCATGGTGGAAGGTGG + Intergenic
1069604754 10:69732177-69732199 CTTCAGTGCATGCAGGAAGAAGG + Intergenic
1070365166 10:75729686-75729708 CTTCAAATCATGATTGAACAAGG + Intronic
1070389688 10:75958651-75958673 ATTCAAGAAATGAAGGAAAAGGG + Intronic
1070713098 10:78697652-78697674 ATTCAAGGCAAGAAGGCAGAGGG + Intergenic
1071512878 10:86276014-86276036 CTTAAAGGCATAAAGAAAGAAGG + Intronic
1071923482 10:90377641-90377663 CTTCAAATCATGAAGGAAACTGG + Intergenic
1075180342 10:120205227-120205249 CTTTAATTCAAGAAGGAAAATGG - Intergenic
1076964334 11:68431-68453 CTCTAAGTCAAGAAGGAAAATGG + Intergenic
1078748071 11:14134358-14134380 ATTTAAGTCCTGGAGGAAGAAGG - Intronic
1079870169 11:25787898-25787920 TTTAAAGTTTTGAAGGAAGAAGG - Intergenic
1080496793 11:32828674-32828696 CATCAAGTAATGAAGGCAGCAGG - Intergenic
1081330325 11:41792906-41792928 CTTTAAGTCCTGTAGGGAGAAGG - Intergenic
1085206204 11:74733491-74733513 GTTCAAGTAAGGAATGAAGATGG - Intergenic
1086285304 11:85242184-85242206 TTTCAAGTTTTGAAGGAAAAAGG - Intronic
1086493887 11:87383224-87383246 CTTTAATTCAAGAAGGAAAATGG + Intergenic
1087015191 11:93547935-93547957 ATGCAAGTAATGAAGTAAGAGGG + Intergenic
1087220092 11:95537459-95537481 CATGAAGTAGTGAAGGAAGACGG + Intergenic
1087740537 11:101882226-101882248 CTTCAAATCCTGAAAAAAGAAGG + Intergenic
1088241004 11:107773629-107773651 ATTCAAGTGATGGAGGAAGCTGG + Intergenic
1089129192 11:116199071-116199093 CTTCCAGTCAGGAAAGTAGACGG + Intergenic
1089806503 11:121095361-121095383 CATCAAGTCATGAAGTCAGGTGG - Intergenic
1090439403 11:126713468-126713490 CCTCAAGGTATGTAGGAAGATGG + Intronic
1092569801 12:9709441-9709463 CTTTAAGTCCTGTAGGGAGAAGG - Intergenic
1092714583 12:11375783-11375805 CTTAAAGACATGAAGTAGGATGG - Intronic
1092718291 12:11414798-11414820 CTTAAAGACATGAAGTAGGATGG - Intronic
1092913625 12:13170119-13170141 CTTTAAATTATGAAGGAAAATGG + Intergenic
1093369884 12:18354228-18354250 CCTCAAGTCCTGTAGGTAGAAGG + Intronic
1094350660 12:29521278-29521300 CTTCAAGTAATGAAAGGATAGGG - Intronic
1095602277 12:44027624-44027646 CTTCATGTAATGCAGTAAGAAGG - Intronic
1096238706 12:49947779-49947801 CTTCATGCCAGGGAGGAAGAAGG - Intergenic
1098678158 12:73316647-73316669 CTTTAATTCAAGAAGGAAAATGG - Intergenic
1100074883 12:90767580-90767602 TTTCAAGTCATGGAATAAGATGG - Intergenic
1100358835 12:93857689-93857711 CTTCCACTTATGACGGAAGAAGG + Intronic
1100931800 12:99618458-99618480 CTTTAATTCAAGAAGGAAAATGG + Intronic
1101133508 12:101713905-101713927 CTTTAAGTCATCTAGGTAGAGGG - Intronic
1101778652 12:107816279-107816301 CTTCAACTCATGACAGAAGACGG - Intergenic
1103029011 12:117597155-117597177 CCTCAGGTCACCAAGGAAGAAGG - Intronic
1105832040 13:24171282-24171304 TTTCAAGAGACGAAGGAAGATGG + Intronic
1106099192 13:26679857-26679879 CTTCAATTAAGGAAGGAAAAAGG + Intronic
1106505528 13:30367930-30367952 CTTTAAGTCCTGATGGAAAATGG + Intergenic
1106993159 13:35448609-35448631 TTTCCAGTCATGAAGGAACTTGG + Intronic
1107718415 13:43223237-43223259 TTTCTGGTCATGAAGGAAAATGG - Intronic
1107781288 13:43905281-43905303 CTTCTAGTAAGGAAGGAAGAGGG - Intergenic
1107852752 13:44587468-44587490 GTTCAGGCCATGAAAGAAGAAGG - Intergenic
1107972610 13:45658472-45658494 CCTCTAGTGATGATGGAAGATGG - Intergenic
1108381204 13:49856243-49856265 CTTCAAGTGGGTAAGGAAGAAGG - Intergenic
1108743360 13:53362297-53362319 CTTCAATGAAAGAAGGAAGATGG - Intergenic
1108866931 13:54935446-54935468 CTTTATCTCATGAATGAAGAAGG - Intergenic
1110023604 13:70508089-70508111 CTTCAATTTATTATGGAAGAGGG + Intergenic
1111041519 13:82756087-82756109 CTTTAACTCAAGAAGGAAAATGG + Intergenic
1111212467 13:85097654-85097676 CTTTAAGTCATGGATGAAAATGG + Intergenic
1111662853 13:91233152-91233174 TTTCAATTCATGGAGGAAAAGGG - Intergenic
1112849246 13:103684430-103684452 CGTGGATTCATGAAGGAAGAGGG - Intergenic
1113615245 13:111675927-111675949 CTTCCAGTCATGGTGGAAGGTGG + Intergenic
1113620712 13:111760840-111760862 CTTCCAGTCATGGTGGAAGGTGG + Intergenic
1117431679 14:55671704-55671726 ATTTAGGCCATGAAGGAAGAAGG - Intronic
1117470794 14:56042670-56042692 CTTCAGGAAATGAAGGAAGCAGG + Intergenic
1118600579 14:67469156-67469178 CTTCAAGTGAGGGAGGCAGAGGG + Intronic
1120227118 14:81803264-81803286 ATTCAAGTCACAAAAGAAGAAGG - Intergenic
1120745118 14:88145426-88145448 CTTTAAGTCCTGTAGGGAGAAGG - Intergenic
1122831466 14:104399250-104399272 CTTCCACTCATGATGGAAGGTGG - Intergenic
1123870717 15:24569460-24569482 CTTTCAGTGATTAAGGAAGATGG + Intergenic
1124245361 15:28066392-28066414 GTTCAAGCCATGATGGGAGAGGG + Intronic
1125383638 15:39114003-39114025 CTTTAATTCAAGAAGGAAAATGG + Intergenic
1127139943 15:55965001-55965023 CTTCAAGTCATGACAGAAACGGG - Intronic
1127421381 15:58809589-58809611 TTTCAAGTCAAAGAGGAAGAAGG - Intronic
1127729200 15:61783054-61783076 CATCAAATCATGCAGGAAAAAGG - Intergenic
1128719466 15:69936639-69936661 CATCAAATCACAAAGGAAGATGG + Intergenic
1130645645 15:85724391-85724413 AGTCAAGTCTTGAAGGATGACGG + Intronic
1132064161 15:98716737-98716759 TTTCAAGTCAAGGAGGAATAAGG + Intronic
1132444216 15:101896752-101896774 CTCTAAGTCAAGAAGGAAAATGG - Intergenic
1132733987 16:1376500-1376522 CTGCCAGCCATGAAGGAGGATGG - Intronic
1136036511 16:27544575-27544597 CTGCAAGTCAAGAAAGAAGGTGG + Intronic
1136360913 16:29779203-29779225 AATCAAGTCAACAAGGAAGAAGG + Intronic
1138576416 16:57910135-57910157 ATTCAGGCCATGAAGGAAGAGGG + Intronic
1139058028 16:63210494-63210516 ATTCAAATTAGGAAGGAAGAAGG + Intergenic
1140047033 16:71446791-71446813 TTTCAGGTCCTGAAGGAAGGTGG - Intergenic
1143981893 17:10877336-10877358 CTTCTAGTCCAGAAGGGAGATGG - Intergenic
1144400100 17:14887522-14887544 CTTCAATTCCAGAAGGAAAATGG - Intergenic
1144494675 17:15738715-15738737 CTACAGGTCATGAAGGAGAAGGG + Exonic
1144639323 17:16928863-16928885 CTACAAGTCATGAAGGAGAAGGG - Intergenic
1144862976 17:18317369-18317391 CTTAAAGTCATCAGGGATGAGGG - Exonic
1144905579 17:18637957-18637979 CTACAGGTCATGAAGGAGAAGGG - Exonic
1145760449 17:27422551-27422573 CTACAGGTCATGAAGGAGAAGGG + Intergenic
1145798598 17:27669747-27669769 CTACAGGTCATGAAGGAGAAGGG - Intergenic
1146160477 17:30556867-30556889 CTACAGGTCATGAAGGAGAAGGG + Intergenic
1146477993 17:33178583-33178605 CTTGAGGTCAGGAAAGAAGATGG + Intronic
1146608886 17:34287400-34287422 CTTCAAGTCAAGAGCAAAGATGG + Intronic
1146964485 17:37013470-37013492 CTTCTGTTCATGAAGGAAGGCGG + Intronic
1147584133 17:41643295-41643317 CATCAAGTCAGGAAGGGACAGGG + Intergenic
1148462478 17:47846640-47846662 GTTGGAGCCATGAAGGAAGAGGG - Exonic
1149807019 17:59628123-59628145 CTTCAAGTTCTGAAGTAAGACGG + Intronic
1150110057 17:62491209-62491231 CTTATAGGCAGGAAGGAAGAAGG - Intronic
1150740501 17:67775640-67775662 GTTCAGGTCATGATGGAAGAGGG - Intergenic
1150921228 17:69485675-69485697 CTTTAAGACAAGAAGGAAAAGGG - Intronic
1151074036 17:71250494-71250516 ATTCTGGTCATGAAGGAAGATGG + Intergenic
1151535354 17:74736295-74736317 CTTCAAGTTACCAAGGAACAGGG - Intronic
1152968957 18:142947-142969 GTTCAGGCCATGATGGAAGAGGG + Intergenic
1155311744 18:24531035-24531057 CTTTGAGTCATGAGGGAACAAGG - Intergenic
1155685263 18:28540619-28540641 CTTCTAGTTATGAAGGAGTAGGG + Intergenic
1156632683 18:38988829-38988851 CTTACAATCATGGAGGAAGAGGG - Intergenic
1156907657 18:42373497-42373519 CTTATAATCATGAGGGAAGAAGG + Intergenic
1158479526 18:57808485-57808507 GTGCAGGTCAGGAAGGAAGAGGG - Intergenic
1160641137 19:138063-138085 CTCTAAGTCAAGAAGGAAAATGG + Intergenic
1161120861 19:2525464-2525486 CTGAAAGTCAAGAAGGATGAGGG + Intronic
1161984916 19:7647749-7647771 CTTCAGGTCATCCAGGAAGCGGG - Exonic
1162088222 19:8261296-8261318 CTTCATGTCAGGAAGGCAGGCGG - Intronic
1163094859 19:15049752-15049774 CATTAATTCATGAAGGGAGAGGG - Intronic
1163815119 19:19460476-19460498 CTTCCTATCAGGAAGGAAGAAGG - Intronic
1164963991 19:32464000-32464022 CTGCAAGTCATAAAAGGAGATGG - Intronic
1167549496 19:50150227-50150249 CTACAAGCCATGAAGGAGGTTGG + Intergenic
925025247 2:602101-602123 CCTCAAGCCCTGGAGGAAGAAGG - Intergenic
925645357 2:6030060-6030082 CTTCCAGTCATGGTGGAAGAGGG - Intergenic
925890391 2:8429207-8429229 CTTAAAGTCATGAGGGAAGTTGG - Intergenic
925943672 2:8841656-8841678 GTTCAGGCCATGATGGAAGAGGG - Intergenic
926107661 2:10162567-10162589 TTTGACCTCATGAAGGAAGATGG - Intronic
926349289 2:11980871-11980893 TTTCAAATCATGAAGCAAGAAGG + Intergenic
926853254 2:17224202-17224224 ATTGAACTCATGAAGGTAGAAGG - Intergenic
927507183 2:23622170-23622192 ACTCAAGTAATGAAGGAACAGGG + Intronic
927656365 2:24950228-24950250 CTTCAAGTCCAGAAGGAAAGCGG - Intronic
928296787 2:30090632-30090654 CCTCCAGTGATGAAGGAAGGAGG - Intergenic
930734164 2:54758201-54758223 TTTCAAGTCCTGAAGGGAGAGGG + Intronic
931609550 2:64083839-64083861 CTTCAACACATGAAGGATGAAGG + Intergenic
931838062 2:66120432-66120454 TTTCAAGTCATGAAAAAACATGG - Intergenic
931991594 2:67795930-67795952 CTTTATGGCATGAAGGAAGAGGG - Intergenic
932598891 2:73111070-73111092 CAGCAAGTCATGAAGGAAGGCGG + Intronic
932719409 2:74127475-74127497 CTACTAGTGCTGAAGGAAGAGGG - Intergenic
933141102 2:78793735-78793757 CTTTAAGTCCTGTAGGGAGAAGG + Intergenic
933165139 2:79067324-79067346 CTTCCACTCATGGAGGAAGGTGG - Intergenic
933275855 2:80283749-80283771 CAGCTAGTCATGCAGGAAGAAGG + Intronic
933318532 2:80743778-80743800 CTAGAATTCAGGAAGGAAGAGGG - Intergenic
935362126 2:102254530-102254552 CATGAAGTCAAGAATGAAGAGGG + Intergenic
936289304 2:111207627-111207649 CTTAAAGCCATGAGAGAAGAAGG - Intergenic
937567914 2:123318597-123318619 CTTGAAGTCATGATGAAAGATGG + Intergenic
937609086 2:123839369-123839391 CTTTAAATCAAGAAGGAAAATGG + Intergenic
937874653 2:126813362-126813384 ATTCAAGTCGGGAAGAAAGAAGG - Intergenic
938142119 2:128803282-128803304 GTTCAGGCCATGATGGAAGAAGG - Intergenic
938154946 2:128927879-128927901 TATCAAGTCATGAAGAAACATGG - Intergenic
938378218 2:130822481-130822503 CCTCAAGTCAGCAGGGAAGAAGG + Intergenic
939500486 2:142977133-142977155 GTTCAAGCCATGATGGAAGAGGG - Intronic
939512351 2:143122836-143122858 CTTCCAGTCAAATAGGAAGATGG - Intronic
939600676 2:144186152-144186174 TTTCAAGAGATGAAGGCAGAAGG - Intronic
940408564 2:153333473-153333495 CTTTAAATCAAGAAGGAAAATGG - Intergenic
941383142 2:164820727-164820749 CTCAAAGTCATGGAGGAAGAAGG - Intronic
942181012 2:173380749-173380771 CTTCAAGAGAAGAATGAAGAGGG - Intergenic
942947730 2:181687890-181687912 GGACAAGTCATGAAGGAAGATGG - Intergenic
943249152 2:185494992-185495014 CTTTAATTCAAGAAGGAAAATGG - Intergenic
943263193 2:185692799-185692821 CTTCAAGTCATCTTGGAAAATGG - Intergenic
943540668 2:189209955-189209977 CATGAAGCCATGAAGGCAGATGG + Intergenic
943587017 2:189752757-189752779 CTCCAAGATCTGAAGGAAGAAGG + Intronic
944254600 2:197612556-197612578 CTTGAACTCTTGAAGGAAAAAGG + Intronic
944670925 2:201993854-201993876 GTTGAAGTCTTGAAGGCAGATGG + Intergenic
945128075 2:206535561-206535583 CTTCAATTGTTGAAGGAATAAGG + Intronic
945417899 2:209597951-209597973 ATTCTAGTCTTGTAGGAAGATGG - Intronic
947293603 2:228605267-228605289 ATTCTAGACAGGAAGGAAGATGG - Intergenic
947544853 2:231003366-231003388 CTTCCAGGGATGAGGGAAGATGG - Intronic
1169066312 20:2696004-2696026 CTTCAAGCCAGGGAGGAAGCGGG - Intronic
1169194829 20:3677451-3677473 CTTCTGGGCATGAAAGAAGAGGG - Intronic
1169302431 20:4455845-4455867 CTTAAAGGTAAGAAGGAAGATGG - Intergenic
1170114470 20:12842146-12842168 ATTTAAGACATGAAAGAAGATGG - Intergenic
1170847997 20:19978264-19978286 CTTGAAGTCAAGAAGGTAGGAGG + Intronic
1170905636 20:20513459-20513481 CTTTAATTCAGGAAGGAAAATGG + Intronic
1171393883 20:24818476-24818498 CCTCAAGTCATGGAGGCACAGGG + Intergenic
1172120622 20:32596658-32596680 TTTCAAGTCAGGGAGGAGGAAGG - Intronic
1172507260 20:35472667-35472689 TTTCAGGTCATGGTGGAAGAAGG + Exonic
1176107587 20:63396650-63396672 CTCCAGGCCATGAAGGATGAGGG + Intergenic
1176216269 20:63949418-63949440 CTGTCAGTCAAGAAGGAAGACGG + Intronic
1177109121 21:17002752-17002774 CTTTAAGTCTTGAAGGGAGTTGG + Intergenic
1177948318 21:27501037-27501059 CTTCAACTCATGGTGGAAAATGG + Intergenic
1181692671 22:24573414-24573436 ATTCAAGTAATGAAAGAGGAGGG + Intronic
1181848932 22:25735931-25735953 CTTCTTGGCCTGAAGGAAGAAGG - Intergenic
1182159573 22:28107944-28107966 CTTCAAGACATGGAAGGAGAAGG - Exonic
1182894489 22:33848028-33848050 CTCCTAGTCATGAAGCAAAATGG - Intronic
1184806915 22:46801034-46801056 TTTCAAGACTTGTAGGAAGATGG + Intronic
949231528 3:1756485-1756507 CTTTAATTCAAGAAGGAAAATGG + Intergenic
951435696 3:22661103-22661125 CATCAAGTCATGAAAGGAGATGG + Intergenic
951473570 3:23081503-23081525 CTTCAACCCATGAAGGGAGTTGG + Intergenic
955832742 3:63021723-63021745 CTGAAAGTCATAGAGGAAGATGG - Intergenic
957336003 3:78830303-78830325 GTTCAAGTCATGAAGTAATATGG - Intronic
958051571 3:88354098-88354120 CTTCCAGTCATCATGAAAGATGG - Intergenic
958812105 3:98872401-98872423 CTTCAACTCATGGAGGAAACTGG - Intronic
959139064 3:102463026-102463048 CTTCAGGACAGGAAGGGAGAAGG - Intronic
959298369 3:104567670-104567692 CTTCAAGATAGGAAAGAAGATGG - Intergenic
959447274 3:106455717-106455739 CATGCAGTCAGGAAGGAAGATGG + Intergenic
959525997 3:107377983-107378005 CATCAAGGCATTAAAGAAGAAGG + Exonic
959739200 3:109696095-109696117 CTTTAATTCAAGAAGGAAAATGG - Intergenic
959739288 3:109697396-109697418 CTTTAATTCAAGAAGGAAAATGG - Intergenic
959753979 3:109874900-109874922 CTTTAATTCAAGAAGGAAAATGG + Intergenic
959948355 3:112150535-112150557 CTACAATTCAAGAAGGAAGATGG - Intronic
960767744 3:121155473-121155495 CTTGAACACATGAAAGAAGAAGG - Intronic
960882364 3:122357956-122357978 CCTCAACTAATGAAGGAAGATGG - Intergenic
963547111 3:146672846-146672868 CTTTAATTCAAGAAGGAAAATGG - Intergenic
964104906 3:153028519-153028541 GTTCAACGCAGGAAGGAAGAGGG + Intergenic
964846902 3:161054189-161054211 CCTCAGGTCTTGATGGAAGAAGG + Intronic
968273991 3:197426019-197426041 CTTGAATTTATGGAGGAAGATGG + Intergenic
969209065 4:5672374-5672396 CTTTAAGCCATGAAGAAACATGG + Intronic
969433049 4:7167190-7167212 CTGCAGGTCCTGAAGGGAGAAGG + Intergenic
972332701 4:38078657-38078679 CTGCAAGTCAGGAAGAGAGAGGG + Intronic
973336556 4:48962541-48962563 GTTCAGGTCATGATGGAAGGGGG - Intergenic
974096519 4:57370376-57370398 GTTCAGGACGTGAAGGAAGAGGG - Intergenic
974786032 4:66620333-66620355 CTTTAATTCAAGAAGGAAAATGG - Intergenic
975754022 4:77553705-77553727 CTTCATTTCAAGAAGGAAAATGG - Intronic
975787712 4:77910279-77910301 ATTCCAGTCATGAGGCAAGATGG - Intronic
976281336 4:83329781-83329803 CTTGAAGTCATCTAGGATGATGG + Intronic
976538677 4:86247110-86247132 CTTAAAGTAAAGAAGGAAGAGGG + Intronic
977070744 4:92383000-92383022 CTTTTACTCATGGAGGAAGATGG + Intronic
977308341 4:95353097-95353119 CTCAAAGTCATTAAGGAATAAGG - Intronic
977992950 4:103466706-103466728 GTTCAGGTCATGATGGAAGCAGG - Intergenic
979156359 4:117395338-117395360 TTTCATGTGATGAAAGAAGATGG + Intergenic
980033273 4:127854902-127854924 CTTCAAGTAGTGAAGAAAAAGGG + Intergenic
981916456 4:150039210-150039232 CTGAAAGTCATGAAGAAATAGGG + Intergenic
981986670 4:150865000-150865022 CTTCAAGTCCTTAGGAAAGATGG - Intronic
982537311 4:156622803-156622825 CTTCACGTCACTAACGAAGATGG - Intergenic
983863797 4:172739087-172739109 TTTCAAGCCATGATGGAAGTGGG - Intronic
984171931 4:176369299-176369321 CTTCAATTCAAGAAAGAAAATGG - Intergenic
985546845 5:514275-514297 CCTCAGGTCAGGGAGGAAGAGGG - Intronic
986219343 5:5753525-5753547 GTTCAGGCCATGATGGAAGAGGG - Intergenic
986407397 5:7439778-7439800 CTTCATGTCATGGATGAGGATGG + Intronic
987580074 5:19778767-19778789 ATCCAATTCATGAAGGAACAGGG - Intronic
988177043 5:27742332-27742354 CTTTAATTCAAGAAGGAAGATGG + Intergenic
989788706 5:45364416-45364438 CTTGAAGACATGCAGGAAAAAGG - Intronic
990352746 5:54935105-54935127 CTGGAAGTAATAAAGGAAGAAGG - Intergenic
990790653 5:59475039-59475061 CTTCAAGTCATGAAGGAAGAAGG + Intronic
991002112 5:61792847-61792869 CTGCAGCTCATGAAGGAAGATGG - Intergenic
993008937 5:82458361-82458383 CTTTAATTCAAGAAGGAAAATGG + Intergenic
993599902 5:89909048-89909070 CTTCAAGTACTGACAGAAGATGG + Intergenic
993802049 5:92354059-92354081 CTGTAAGTCAGGAAGGAGGAAGG + Intergenic
994412961 5:99432383-99432405 TCTGAACTCATGAAGGAAGAGGG + Intergenic
994480878 5:100333336-100333358 TCTGAACTCATGAAGGAAGAGGG - Intergenic
995400557 5:111736187-111736209 CTTCAAGTAATGACAGGAGAGGG + Intronic
995518182 5:112974836-112974858 CTTCAACCAATGAAGGAAGTTGG + Intergenic
995620287 5:114018599-114018621 CTTCAAGACAAGAAGTAAGCTGG - Intergenic
996108327 5:119533781-119533803 CTGCATGTCATGAAGCAAGGTGG - Intronic
996632997 5:125659867-125659889 CAAGAAGTCATGAAGAAAGAGGG + Intergenic
996637491 5:125710836-125710858 CTTCTGGTCATGAAGGGATATGG - Intergenic
998706410 5:144766652-144766674 CTTCAATTCCTAAAGGGAGAGGG + Intergenic
999415903 5:151395701-151395723 CTTCAAGACATAATGGTAGATGG + Intergenic
1000460481 5:161510882-161510904 CTTCAAGGGATGAAAGCAGAAGG - Intronic
1000645743 5:163758368-163758390 CTTGATGTCATCACGGAAGAAGG - Intergenic
1000903206 5:166933407-166933429 GTTCAGGTCATGATGGAAGAGGG - Intergenic
1001061352 5:168492228-168492250 CTTCAAGGCATGAAATAAAAGGG - Intronic
1002459495 5:179365971-179365993 CTTCCACTCATGGAGGAAGGTGG - Intergenic
1002736214 5:181388358-181388380 CTCTAAGTCAAGAAGGAAAATGG - Intergenic
1002748484 6:86466-86488 CTCTAAGTCAAGAAGGAAAATGG + Intergenic
1003068011 6:2919683-2919705 CTGCCAGTGAAGAAGGAAGATGG + Intergenic
1003302276 6:4894300-4894322 CCCCAAGTCATCAATGAAGACGG - Intronic
1003465927 6:6379964-6379986 CTTGAAGTCACGAAGGATAATGG - Intergenic
1004406604 6:15338819-15338841 CTTTAAGTCCTGTAGGGAGAAGG - Intronic
1004578384 6:16922576-16922598 CTCCAAGGCAGGGAGGAAGAGGG - Intergenic
1004871979 6:19914464-19914486 CTTTAATTCAAGAAGGAAAATGG + Intergenic
1006208682 6:32374373-32374395 CTTTAAATCCTGTAGGAAGAAGG - Intergenic
1007304888 6:40896110-40896132 CATCATGTTTTGAAGGAAGAAGG - Intergenic
1007710038 6:43817067-43817089 GTCCCAGTAATGAAGGAAGAAGG + Intergenic
1007735319 6:43978690-43978712 CTGAAAGTCATGAAGGACGGGGG + Intergenic
1009243009 6:61202552-61202574 CCTCCATTCATGAAGCAAGAGGG + Intergenic
1010089518 6:71964237-71964259 TTTCAAGGCAGGAAGGTAGATGG + Intronic
1010354333 6:74912574-74912596 CTTTAATTCAAGAAGGAAAATGG - Intergenic
1011676856 6:89743210-89743232 GTTCAGGCCATGAAGGAGGACGG - Exonic
1012676260 6:102116247-102116269 CTTTAATTCAGGAAGGAAAATGG - Intergenic
1012946287 6:105469349-105469371 TTTTAAGTCATGAAAGAAGAAGG - Intergenic
1013163218 6:107566173-107566195 TTTCAGGTGATGAAGGAAAATGG + Intronic
1013829850 6:114258271-114258293 CTTCAAGACCTGAAACAAGAAGG - Intronic
1014322145 6:119943131-119943153 CTTTAATTCAAGAAGGAAGATGG - Intergenic
1014775131 6:125500107-125500129 CTTCAATTTATGAAGGCTGAGGG - Intergenic
1014827911 6:126066904-126066926 TTTTAAGTCATGAATGAAGTTGG - Intergenic
1015276235 6:131385898-131385920 GTTCAGGTCATAATGGAAGAGGG - Intergenic
1015696323 6:135984032-135984054 CATCAGGTCCTGAAGAAAGATGG - Intronic
1015917149 6:138228767-138228789 GTTCAATTCATGAAGGAGCATGG - Intronic
1015961568 6:138655285-138655307 CTACAAGTCCTGCGGGAAGAGGG - Intronic
1016940928 6:149482403-149482425 CTTCCAGTCAGGACGGAGGAAGG - Intronic
1017206108 6:151805950-151805972 CTACAAGTCCTGAAAGAAAAAGG - Intronic
1019241311 6:170663886-170663908 CTCTAAGTCAAGAAGGAAAATGG - Intergenic
1020578784 7:9968753-9968775 CTTCAGCTTATGAAGGGAGAGGG - Intergenic
1020903183 7:14031314-14031336 CTTCAAGTTAATAGGGAAGATGG - Intergenic
1021015985 7:15534350-15534372 CTTCAAGTGTTGAAAGAAAAAGG + Intronic
1021159929 7:17260115-17260137 GTTCTAGTCAAAAAGGAAGAAGG - Intergenic
1021189285 7:17601955-17601977 CTTTAATTCAGGAAGGAAAAAGG + Intergenic
1021923511 7:25512010-25512032 CTTCAAGTAAGAAAGGAAGTAGG + Intergenic
1022024878 7:26438360-26438382 CTTCCACTCATGAAGCAAGAGGG + Intergenic
1023239953 7:38133546-38133568 GTTCAGGTCATGTAGGCAGATGG - Intergenic
1026255223 7:68705354-68705376 TTTCTAGGCATGGAGGAAGAAGG - Intergenic
1027466472 7:78521539-78521561 CTCCAAGTGCTGAAGGAAAACGG - Exonic
1028868216 7:95737397-95737419 CTTTAATTCAAGAAGGAATATGG + Intergenic
1030631334 7:111899297-111899319 CTTCCAGTCTGGAAGGAATAGGG - Intronic
1030717508 7:112827360-112827382 ATTCAAAAGATGAAGGAAGAGGG - Intronic
1030720783 7:112868304-112868326 CTTTAATTCAAGAAGGAAAATGG + Intronic
1031223197 7:118999332-118999354 CTTCGAGTCATTAAAGAAAAAGG + Intergenic
1031243222 7:119271715-119271737 CTTTAAGTCAAAAAGGAAAATGG - Intergenic
1031356675 7:120795708-120795730 CTTCAATTCTAGAAGAAAGAGGG - Intronic
1032039071 7:128543516-128543538 CTTATAGGCAGGAAGGAAGAAGG - Intergenic
1032510874 7:132471441-132471463 CATGAAGGGATGAAGGAAGAGGG - Intronic
1033257910 7:139817902-139817924 CTTCAGGTTATGAAGGTAGGTGG - Intronic
1033345940 7:140525859-140525881 CTGCATGCCAAGAAGGAAGAAGG - Intronic
1033679699 7:143582576-143582598 CTTTAATTCAAGAAGGAAAATGG + Intergenic
1033692136 7:143746867-143746889 CTTTAATTCAAGAAGGAAAATGG - Intergenic
1034611301 7:152372002-152372024 CGTCAAATCACAAAGGAAGACGG + Intronic
1034973415 7:155433538-155433560 CTTCCAGTCATGGTGGAAGGTGG - Intergenic
1035506806 8:144209-144231 CTCTAAGTCAAGAAGGAAAATGG + Intergenic
1036510015 8:9391544-9391566 TTTCAAGACAAGAAGGAATATGG + Intergenic
1036961050 8:13244883-13244905 ATTCCAGGCAAGAAGGAAGACGG + Intronic
1036965456 8:13292496-13292518 CCTAAAGTCATAAAAGAAGAAGG + Intronic
1037114726 8:15210619-15210641 ATTTAAGTCATTCAGGAAGATGG - Intronic
1037222418 8:16540245-16540267 GTGCAAATCATAAAGGAAGAAGG + Intronic
1037531594 8:19780683-19780705 CTCCAGGTGATGAAGTAAGAAGG - Intergenic
1037557870 8:20043031-20043053 CTTCAACTCATGGTGGAAGGTGG - Intergenic
1038454948 8:27667021-27667043 CTTCAGGCCACCAAGGAAGATGG - Intronic
1039132222 8:34279107-34279129 TATCAAGTCATGAAGAAACATGG + Intergenic
1039171788 8:34755629-34755651 CATGCAGCCATGAAGGAAGAGGG + Intergenic
1040624430 8:49130408-49130430 TCTCAAGTCACGAAGGAAAAAGG - Intergenic
1043467079 8:80520194-80520216 ATTCATGTCAAAAAGGAAGAGGG - Exonic
1044308716 8:90667074-90667096 CTTTAATTCAGGAAGGAAAATGG - Intronic
1044514743 8:93125024-93125046 CTGCAAATCATGAAGGAACTTGG - Intergenic
1044937341 8:97305848-97305870 CTTCACATCATGAAGGATGAGGG + Intergenic
1046138711 8:110062513-110062535 CTTTAAGTCCTGTAGGGAGAAGG - Intergenic
1048237080 8:132701378-132701400 CTTGTAGTCATGAGGAAAGATGG + Intronic
1048389198 8:133945165-133945187 ATTCCATTCAGGAAGGAAGAAGG - Intergenic
1048651479 8:136483452-136483474 CTTCAAGTGGTGATGGAAGCAGG + Intergenic
1050310869 9:4352264-4352286 CTCAAAGTCATGCAGGAATATGG + Intergenic
1051212806 9:14763123-14763145 CTTCAAGTCATTTAGCAGGAGGG + Intronic
1051761868 9:20476261-20476283 CTTTGAGTCTTGTAGGAAGATGG - Intronic
1052818190 9:33118073-33118095 CTTCAAGGGATGAATCAAGAGGG + Intronic
1055976705 9:81962627-81962649 CCTCAAATCATAAAGGAAGTTGG - Intergenic
1056017653 9:82407699-82407721 CTTCAAGTCAAGAGGCAAGTAGG + Intergenic
1057020234 9:91691622-91691644 CTTACAGTCATGATGGAAGGTGG - Intronic
1057052828 9:91938613-91938635 CTTCATCTCAAAAAGGAAGAAGG + Intronic
1058841156 9:108910780-108910802 CTTCAAGTCAGTAAGGGAAAAGG + Intronic
1059007906 9:110423543-110423565 CTTCAAGTTGTTCAGGAAGAAGG + Intronic
1060566886 9:124600852-124600874 TTTCAAGACCTGAAGGAAGAAGG + Intronic
1060964924 9:127707071-127707093 CTTGAAGTCAAGAAGAAAGGGGG + Exonic
1061957837 9:133972864-133972886 GGTTAAGTGATGAAGGAAGATGG - Intronic
1203601503 Un_KI270748v1:13120-13142 CTCTAAGTCAAGAAGGAAAATGG - Intergenic
1185774417 X:2791023-2791045 TTTCAAGTTATGATGGAGGAAGG + Intronic
1185885352 X:3777452-3777474 CTTAAAGTTATGAAGGGAGCTGG + Intergenic
1186007512 X:5089624-5089646 GTTCAAGCCATGATGGAAGAGGG + Intergenic
1186322524 X:8444773-8444795 CTTCAACTTATAAAGCAAGATGG - Intergenic
1186394423 X:9193888-9193910 CTTCAAGTTATCAAAGAATAGGG + Intergenic
1188744099 X:33820496-33820518 CTTTCACTCATGGAGGAAGAAGG - Intergenic
1188904978 X:35780757-35780779 TTTCAGGCCATGATGGAAGAGGG - Intergenic
1189233537 X:39470635-39470657 TTTGGATTCATGAAGGAAGAGGG - Intergenic
1189545545 X:42038728-42038750 TTTCAAGTCATAAAGCAAGTTGG - Intergenic
1190078256 X:47334905-47334927 ATCCAATTCAAGAAGGAAGAGGG + Intergenic
1190276759 X:48904175-48904197 CTTCAAGGTATCAAGGAAGCTGG + Exonic
1190411399 X:50140434-50140456 CTTCAAGTCCAGAGGGAACAAGG - Intergenic
1190980699 X:55454730-55454752 CTGGATGTCAAGAAGGAAGAAGG - Intergenic
1190987998 X:55518450-55518472 CTGGATGTCAAGAAGGAAGAAGG + Intergenic
1191024999 X:55904920-55904942 CATGAAGTCATGAAGAAAGAAGG + Intergenic
1191025155 X:55906493-55906515 CTTCTAGTGGTGAAGGAAAATGG + Intergenic
1191739919 X:64425653-64425675 GTTCAGGCCATGATGGAAGAGGG - Intergenic
1193031696 X:76906121-76906143 CTTTAATTCAAGAAGGAAAATGG + Intergenic
1193203740 X:78723177-78723199 ATTCAAGACAAGAAGGAAAAAGG - Intergenic
1193418119 X:81249011-81249033 CTTTAATTCAAGAAGGAAAATGG - Intronic
1193550948 X:82892241-82892263 CTTTAATTCAAGAAGGAAAATGG + Intergenic
1194620459 X:96164574-96164596 TTTCAGGCCATGATGGAAGAGGG + Intergenic
1194739983 X:97560940-97560962 CTTCATATCATGAATGTAGATGG + Intronic
1194885925 X:99316142-99316164 CTTCAAGTCTTTAAGGCAGGAGG - Intergenic
1195734694 X:108000537-108000559 CTTTAATTCAAGAAGGAAAATGG + Intergenic
1195980730 X:110575825-110575847 CTTTAAGTCATAAATGAAGAGGG - Intergenic
1195989826 X:110671511-110671533 CTTCCACTCATGGTGGAAGAAGG + Intergenic
1196260932 X:113580511-113580533 CTTGTAGTCCAGAAGGAAGAGGG - Intergenic
1197026825 X:121761097-121761119 CATCAAGTCACAAAGGAAGATGG + Intergenic
1197296037 X:124720186-124720208 ATTCAAGCCATGATGGAAGATGG + Intronic
1197390699 X:125860626-125860648 CTTTAATTCAAGAAGGAAAATGG + Intergenic
1197995630 X:132369466-132369488 CTTCATGTCATGAAGGTTAAAGG + Intronic
1198968399 X:142251522-142251544 CTTCAATTCAAGAAGGAAAATGG - Intergenic
1201673117 Y:16547619-16547641 GTTCAGGCCATGATGGAAGAGGG - Intergenic