ID: 990791712

View in Genome Browser
Species Human (GRCh38)
Location 5:59488082-59488104
Sequence GGGTGAAAACTGAGGGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990791712_990791717 -3 Left 990791712 5:59488082-59488104 CCTAGTTCCCTCAGTTTTCACCC 0: 1
1: 0
2: 0
3: 19
4: 251
Right 990791717 5:59488102-59488124 CCCCGGTCACTATTTACCCGTGG 0: 1
1: 0
2: 0
3: 2
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990791712 Original CRISPR GGGTGAAAACTGAGGGAACT AGG (reversed) Intronic
900559318 1:3295874-3295896 TGGTGAGAACTGGGGTAACTGGG + Intronic
902464593 1:16608170-16608192 GGGTGGAAACAGAGAGAAATGGG + Intronic
903156215 1:21445535-21445557 GGGTGGAAACAGAGAGAAATGGG - Intronic
903294363 1:22334187-22334209 GGGTGAAAACTGTAGGTACAAGG - Intergenic
903471198 1:23588578-23588600 GGGAGGAAACTGGGGGAACAGGG + Intronic
904359789 1:29963895-29963917 GGGTGACTGCTGAGGGACCTTGG + Intergenic
905196569 1:36283298-36283320 GTGTGAAAACTGACTGAATTAGG - Intronic
907454953 1:54569485-54569507 AGGGGAAAACAGAGGGAACAAGG - Intronic
909368913 1:74861608-74861630 GCCTGAAAACTGAGGCAACTGGG - Intergenic
910287395 1:85570917-85570939 GAGTGAAAACTCAAGGAATTAGG + Intronic
911017176 1:93345873-93345895 GGGGGAAATCTGAGGGAACGAGG + Exonic
911794606 1:102059489-102059511 TGGGCAAAACTGAGGCAACTAGG + Intergenic
913133839 1:115867947-115867969 GGGTGAAAACTAAGTGATTTTGG - Intergenic
914222845 1:145695873-145695895 TGGAGAAATCTGAGGGAACAAGG - Intronic
916985844 1:170191099-170191121 TGGGAAAAACTGAGGCAACTAGG - Intergenic
917427332 1:174928592-174928614 GGGTGGAGCCTTAGGGAACTCGG + Intronic
917991472 1:180384069-180384091 AGATGAAAACATAGGGAACTTGG + Intronic
918205502 1:182304852-182304874 GTGTGAAAACTGAGGCCTCTAGG - Intergenic
918349017 1:183635245-183635267 GGGTGCAACCTGAGGAATCTGGG + Intronic
918710701 1:187725592-187725614 GGAAGAAACCTGGGGGAACTAGG - Intergenic
918841905 1:189551911-189551933 AGGTAAAAACTAAGGAAACTTGG - Intergenic
919052272 1:192525869-192525891 AGGGGAAAACTGATGGCACTTGG - Intergenic
919112588 1:193239362-193239384 GGGGGAAAACTGAGGGTATTTGG + Intronic
919686319 1:200486875-200486897 AAGTGAAAACTGAGGGCACCTGG + Intergenic
919698419 1:200605179-200605201 GGGTGAAAACTGAATGAGATCGG + Intronic
919698428 1:200605241-200605263 GGGTGAAAACTGAAAGAGATCGG + Intronic
919698437 1:200605303-200605325 GGGTGAAAACTGAATGAGATCGG + Exonic
920691660 1:208151468-208151490 TGGTGAGAACTGATGGAATTAGG + Intronic
921087629 1:211810947-211810969 AGGTGACAACAGAGGGAAGTAGG + Intronic
922219099 1:223544175-223544197 GGGTGAAACCTGAGGGCAGAGGG + Exonic
922585980 1:226735863-226735885 GGGTGCAATCAGAGGGGACTTGG - Exonic
924770181 1:247073187-247073209 GGTTGAAAAATGAGTGAATTGGG - Intronic
1063114754 10:3066295-3066317 GGGTGAGCACTGAAGGAACCCGG + Intergenic
1064575760 10:16744914-16744936 GTGTGAAAACTGAGGCACATAGG - Intronic
1071264739 10:83954862-83954884 AGGTGAAGACTGAGGGAAAGTGG - Intergenic
1071331688 10:84566721-84566743 AGGTCAAAACTGAGGGGACATGG + Intergenic
1074395612 10:113095654-113095676 TGGTGAACAATGAGGGAAATGGG - Intronic
1075730537 10:124632911-124632933 GGGTGTGCCCTGAGGGAACTTGG + Intronic
1075757863 10:124829851-124829873 GGGGGCAAAGTGAGTGAACTAGG - Intronic
1075847511 10:125556583-125556605 GGGGGTAAACTGAGGAAGCTGGG + Intergenic
1077055911 11:593033-593055 GGGTGAAAGGTGAGGGACCAAGG - Intronic
1077725907 11:4674804-4674826 GGGTAGAACCTGTGGGAACTGGG + Intergenic
1077956652 11:7027698-7027720 GGGTGAAACCTAATTGAACTAGG - Intronic
1078501757 11:11885939-11885961 TGGGAAAAACTGAGGCAACTAGG + Intronic
1078613380 11:12841628-12841650 GGGTGCAAACTGAAGGAAGATGG - Intronic
1079437618 11:20473965-20473987 TGGGAAAAACTGAGGCAACTAGG - Intronic
1079473281 11:20801075-20801097 GGAAGACAACTGAGAGAACTAGG - Intronic
1081157162 11:39707370-39707392 AGGAGAAAACTGAGGAAATTGGG - Intergenic
1081685287 11:45038144-45038166 GGGTGGAGGCTAAGGGAACTGGG + Intergenic
1083121621 11:60518924-60518946 GGGTGATAGCTGGGGAAACTTGG + Intronic
1083538019 11:63490072-63490094 GGGTGATAACAGATGGTACTGGG - Intronic
1084259773 11:67968408-67968430 CAATAAAAACTGAGGGAACTTGG - Intergenic
1086610445 11:88748792-88748814 TGGGAAAAACTGAGGCAACTGGG + Intronic
1087735182 11:101824610-101824632 GGGTGTAAACTCAGGCATCTGGG - Intronic
1089831083 11:121328875-121328897 GGGTGAAAATGGAGGGAGCAGGG - Intergenic
1090126487 11:124090965-124090987 GGATGAAAAGTGAAGCAACTGGG + Intergenic
1091214181 11:133890380-133890402 GGGTGAATCCTGAGGGTCCTGGG - Intergenic
1091791011 12:3272234-3272256 GGGAGCAACCTGAGGGCACTGGG + Intronic
1093103042 12:15050730-15050752 GTGTTAAAACTCATGGAACTTGG + Intergenic
1095886124 12:47190342-47190364 GGGTTAGAACAGATGGAACTTGG - Intronic
1097279152 12:57833790-57833812 AGGTGAGCACTGAGGGAGCTGGG + Intronic
1100355023 12:93820771-93820793 GGGTGATATCTGAGAGAAATGGG - Intronic
1101325941 12:103716067-103716089 GGGGGAAAACCAAGGGTACTAGG + Intronic
1101641985 12:106592971-106592993 GGGTCCAAATTGAGGCAACTAGG + Intronic
1103912606 12:124360635-124360657 GGGTGGACAGTGAGGGAAGTGGG - Intronic
1106364821 13:29068366-29068388 GGGTGTAGACGGAGGAAACTTGG - Intronic
1106864946 13:33953741-33953763 GTATGAAAAATTAGGGAACTGGG - Intronic
1108173881 13:47772795-47772817 AGGGGAAAACTGAGGCAACTAGG - Intergenic
1108875498 13:55044113-55044135 GGTATAAAACTTAGGGAACTTGG - Intergenic
1109097189 13:58133768-58133790 TGGGAAAAACTGAGGCAACTAGG - Intergenic
1109895881 13:68689166-68689188 GGGTCAAAACTGATGGACTTTGG + Intergenic
1114675292 14:24436254-24436276 GGGTGAAAACTCTGGGAAGGAGG + Intronic
1115020073 14:28668435-28668457 AGATGAAAACTGTGGCAACTTGG + Intergenic
1118321756 14:64757595-64757617 GGGTGAGAGATGAAGGAACTGGG + Intronic
1118523177 14:66610389-66610411 GGGTGAAGAGAGAGGAAACTGGG - Intronic
1119534520 14:75392122-75392144 GGGCAAAAACTAAGGAAACTGGG + Intergenic
1119993435 14:79225837-79225859 GGCTGAAAACTGAGGGCCATTGG + Intronic
1120336458 14:83163065-83163087 GGGTAAATGATGAGGGAACTTGG - Intergenic
1120937537 14:89912169-89912191 GGGTTAAAACTGAGGTAAAATGG + Intronic
1121774850 14:96583902-96583924 GGCTGTAAAGTGAGGGCACTGGG + Intergenic
1122196435 14:100090722-100090744 TGATAAAAACTGAGGAAACTAGG + Intronic
1124153287 15:27201473-27201495 GGAGGAAAACAGAGGGAAATAGG + Intronic
1125216562 15:37282584-37282606 TGGGAAAAACTGAGGCAACTAGG - Intergenic
1125732406 15:41900604-41900626 GGGTGGGAACTGGGGGACCTGGG - Exonic
1127134933 15:55910387-55910409 GGGTGAAAGGTGAGGGAAGGAGG - Intronic
1127264047 15:57346877-57346899 GGGGGAAAACTGAGGAAGCTAGG + Intergenic
1129241667 15:74255756-74255778 GGGGGGAAAGTGGGGGAACTGGG - Intronic
1130047421 15:80456575-80456597 AGGTGCAAACTGAGGGACCTAGG - Intronic
1130260198 15:82348640-82348662 GTGAGAAAACTTAGGGGACTGGG + Intronic
1130268533 15:82430793-82430815 GTGAGAAAACTTAGGGGACTGGG - Intronic
1130281035 15:82520367-82520389 GTGAGAAAACTTAGGGGACTGGG - Intergenic
1130403553 15:83579056-83579078 GGGGGAAAACTGAGGTCTCTTGG - Intronic
1130472406 15:84236548-84236570 GTGAGAAAACTTAGGGGACTGGG - Intronic
1130479897 15:84351119-84351141 GTGAGAAAACTTAGGGGACTGGG - Intergenic
1130484025 15:84387549-84387571 GTGAGAAAACTTAGGGGACTGGG - Intergenic
1130491873 15:84437010-84437032 GTGAGAAAACTTAGGGGACTGGG + Intergenic
1130503487 15:84516050-84516072 GTGAGAAAACTTAGGGGACTGGG + Intergenic
1130594703 15:85241184-85241206 GTGAGAAAACTTAGGGGACTGGG - Intergenic
1130642474 15:85691656-85691678 GGGTGAACAGTGGGGGCACTGGG - Intronic
1131571771 15:93544793-93544815 GAGTGGAAACAGAGGGGACTAGG - Intergenic
1132691374 16:1183264-1183286 GGGGGAAAACTGGGGGAACGCGG - Intronic
1134629932 16:15749333-15749355 AGGTGAGAAGTGAAGGAACTAGG - Intronic
1135117548 16:19736461-19736483 GGGCAAAAACTCAGTGAACTCGG + Intronic
1136034566 16:27529346-27529368 GGGTGAGAACTGCTTGAACTGGG + Intronic
1136096407 16:27960272-27960294 GGCTGGAAAATGGGGGAACTGGG - Intronic
1139019479 16:62729488-62729510 TGGTGAAAACTTTGGAAACTGGG - Intergenic
1139340019 16:66262456-66262478 GGGAGAAGGCTGAGGGTACTGGG - Intergenic
1140686361 16:77437252-77437274 AGGTGAACACTGACGGAACCTGG + Intergenic
1141059633 16:80853769-80853791 GGGTGACAGCTAAGGGAAGTAGG - Intergenic
1142202507 16:88767981-88768003 GGGGGAAATCTCAGGGACCTGGG - Intronic
1144120916 17:12151326-12151348 GGGGAAAAACTGAGGCAACTAGG + Intergenic
1144128791 17:12226021-12226043 TGGTCAAGGCTGAGGGAACTGGG + Intergenic
1144540407 17:16135798-16135820 CTGTGAATACTGAGAGAACTGGG + Intronic
1144895894 17:18532076-18532098 TGGGAAAAACTGAGGCAACTAGG + Intergenic
1146501649 17:33369910-33369932 GGGTTAAAAGTGAGAGAATTTGG - Intronic
1147369244 17:39980461-39980483 CGGGGAAAATTGAGCGAACTTGG + Intergenic
1147659686 17:42110905-42110927 GGGAGAAGACTGAGGGCACAGGG + Exonic
1150567523 17:66355023-66355045 GGGCGAAAACAGAGTGAACGTGG + Intronic
1151162162 17:72175052-72175074 GGATGAAAAATAAGGAAACTGGG + Intergenic
1151972902 17:77467963-77467985 GTGTAAGAACTGAGGGACCTAGG + Intronic
1152545001 17:80995936-80995958 GGCTGGGAACTGTGGGAACTGGG + Intronic
1152806521 17:82359443-82359465 GAGGGAAATTTGAGGGAACTTGG - Intronic
1156191958 18:34730495-34730517 TGGCAAAAACTGAGGGAACATGG + Intronic
1160435195 18:78846389-78846411 GGATGAGAACTGAGTGAACGGGG - Intergenic
1162483725 19:10945565-10945587 GGGTGAAGACATAGAGAACTCGG - Intergenic
1163348956 19:16763319-16763341 GGCTCAAGACTGAGGGCACTGGG - Intronic
1163434275 19:17285869-17285891 AGGAAAAAAATGAGGGAACTGGG - Intronic
1165742023 19:38210450-38210472 GAGTGAGGAGTGAGGGAACTAGG - Intergenic
926776781 2:16430987-16431009 GGGTGAGAATTTAGGGAAGTGGG - Intergenic
927307700 2:21592389-21592411 TGGTGAGAAGTGGGGGAACTGGG + Intergenic
928494129 2:31814197-31814219 TGGTGAAAACTAATGGAACAAGG - Intergenic
928920677 2:36523528-36523550 GGGTGAAAGCCCAGGGAACACGG - Intronic
930483702 2:51984795-51984817 GGGTGAAAACTAAAGGGATTTGG - Intergenic
930671139 2:54151992-54152014 TGGGGGAAACTGAGGGACCTAGG - Intronic
931754372 2:65359335-65359357 GTGTTAAAACTGAGGAAGCTTGG - Intronic
932379690 2:71270550-71270572 TGGGAAAAACTGAGGCAACTAGG + Intergenic
934572219 2:95379998-95380020 GGGAGAAAACAGAGGAAAGTGGG - Intronic
934927392 2:98391196-98391218 AGGTGAAAACTGGAAGAACTTGG + Intronic
937662289 2:124444835-124444857 GGCTGAAACCTGAGGGAAGGAGG - Intronic
939180050 2:138794163-138794185 AGGGAAAAACTGAGGCAACTAGG - Intergenic
940261933 2:151790148-151790170 GGTTGAAAAGAGAGGAAACTGGG - Intronic
940750957 2:157627254-157627276 GGGTGAAAACTCTGCTAACTTGG - Intronic
941557182 2:166995894-166995916 TGGTGAAAGCTGAGGAAAGTAGG - Intronic
942212865 2:173688997-173689019 GGGAGAAAAGAGAGGGAACATGG + Intergenic
944034386 2:195276063-195276085 GGGAGAAAACTCTGGGAATTGGG + Intergenic
944167857 2:196742562-196742584 TGGGAAAAACTGAGGCAACTAGG - Intronic
944363769 2:198892160-198892182 GGAAAAAAACTGAGGCAACTGGG + Intergenic
946409401 2:219508775-219508797 GGGAGAAACAAGAGGGAACTGGG + Intergenic
946799722 2:223400777-223400799 GGGTGGAGACTGAAGGACCTAGG + Intergenic
948672252 2:239576032-239576054 GGCTGGAAACAGAGGGAGCTTGG + Intergenic
1168887485 20:1269657-1269679 GGTTGAAAACTGTGTGAACCAGG + Intronic
1168919533 20:1519888-1519910 GAGTGAAATCTGATAGAACTTGG + Intergenic
1169027110 20:2380609-2380631 GAGAGAAGACTGAGGGAACTCGG - Intergenic
1169045689 20:2533015-2533037 GGGAGGGAACTGAGGGAGCTAGG - Intergenic
1169050009 20:2567893-2567915 GAGTAAAAACTCAGTGAACTTGG + Intronic
1169068218 20:2706386-2706408 GGGTGGGAACTGGGGGAGCTAGG - Intronic
1170978735 20:21191047-21191069 GGATGAAAATTGAGGGAGTTTGG + Intronic
1173334947 20:42105002-42105024 AGGTGAAAGCTGAGGGGACATGG - Intronic
1173616716 20:44407929-44407951 GAATGAATACTAAGGGAACTGGG - Intronic
1178585425 21:33867103-33867125 GGATGACAACTGAGAGACCTGGG - Intronic
1179159281 21:38878750-38878772 TGGTCAAAATTGAGGGATCTGGG + Intergenic
1179408601 21:41144975-41144997 AGGTGGAAAATGAGGGGACTCGG - Intergenic
1181688266 22:24543763-24543785 GGGTGGGAACTGTGGGCACTGGG + Intronic
1184665482 22:45986892-45986914 GGGTGTACACTGAGAGGACTTGG - Intergenic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
1184799631 22:46751760-46751782 GGATGTAACCTGAGGGAAGTGGG - Intergenic
949300841 3:2582303-2582325 GTGTGTAAAATGAGAGAACTGGG - Intronic
950559093 3:13711691-13711713 TGGAGAGAACTGAGGAAACTCGG + Intergenic
950625802 3:14245987-14246009 GGGGGAAGACTGAGGGAAGACGG + Intergenic
951066366 3:18271185-18271207 GGATGAAAGCTGAAGGAACCAGG - Intronic
956699060 3:71942713-71942735 GGGTGAAGACTGAGGGGATATGG + Intergenic
956978561 3:74610776-74610798 GGGTGAACATGGAGGGAAGTGGG + Intergenic
959527950 3:107398603-107398625 TGGTGAAAACTGGGGGAAGGAGG + Intergenic
959947527 3:112142182-112142204 AGATGAAAACTGAGGGATATTGG - Intronic
961194557 3:124990688-124990710 AGGTGTGAACTGAGGGAAGTGGG + Intronic
961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG + Intergenic
963674042 3:148286286-148286308 GGGTCAAAACTTACGGACCTGGG - Intergenic
966005924 3:175012098-175012120 GGGAGACAACTGAGAGAACGTGG + Intronic
967946327 3:194807055-194807077 GGCTGAAAGATGAGGGGACTTGG - Intergenic
968010151 3:195269248-195269270 GGTAGAAAACTGAGGGCCCTTGG - Intronic
970406076 4:15765699-15765721 AGGTGAAATCTGGGGGAACAGGG - Intergenic
971098016 4:23430119-23430141 GGGTGAAAAGTGAGAGGATTTGG - Intergenic
972115692 4:35630893-35630915 TTGTGAAAACTGATGGAACTTGG + Intergenic
973733901 4:53851167-53851189 GGGTGAAAACAGATGGGACTGGG - Intronic
974285673 4:59864417-59864439 TGGTGAATCCTGAGAGAACTGGG + Intergenic
975297688 4:72752244-72752266 TGGGAAAAACTGAGGCAACTAGG + Intergenic
975964429 4:79953191-79953213 TAGTGAAAACTGAGGCAAATGGG - Intronic
976869655 4:89775512-89775534 GTGTAAAAACTGAGGCACCTGGG - Intronic
978530910 4:109712230-109712252 AGGTTAACACTGGGGGAACTGGG + Exonic
978660986 4:111126109-111126131 GGGTGAAAAGGGGGGGAAGTGGG - Intergenic
979179594 4:117708226-117708248 TGGGAAAAACTGAGGTAACTAGG + Intergenic
979897739 4:126180900-126180922 GGGTGAAAACTGAGACAATTGGG + Intergenic
980735487 4:136881078-136881100 TGGGGAAAACTGGGTGAACTGGG + Intergenic
983867740 4:172788749-172788771 AGGTGATAACTAAGGGAACAAGG + Intronic
986355889 5:6925831-6925853 GGGTGATAATTGAGATAACTGGG - Intergenic
986475082 5:8121350-8121372 TGGGGAAAAGTGAGGGAAGTAGG - Intergenic
989723315 5:44554991-44555013 CTGTGAAAACAGAGGGAATTAGG + Intergenic
990641686 5:57792559-57792581 GGCTGATAACTGATGGAACTGGG + Intergenic
990791712 5:59488082-59488104 GGGTGAAAACTGAGGGAACTAGG - Intronic
991463134 5:66880327-66880349 GGGAGAGAAATGTGGGAACTGGG + Intronic
992948781 5:81836252-81836274 GCGTGAAAACTGAAGGAACATGG - Intergenic
993375848 5:87149065-87149087 AGGGAAAAACTGAGGCAACTAGG - Intergenic
994703826 5:103174256-103174278 GGGTCAGAATTGATGGAACTTGG + Intronic
995174106 5:109154247-109154269 GTATGAAAACTGAAGGAACAGGG + Intronic
995522535 5:113024560-113024582 GGGTAACCACTGAGGAAACTAGG + Intronic
998263948 5:140653143-140653165 GCGTGAGTACTGAGGGAACAGGG + Exonic
999300829 5:150489280-150489302 GGGTGCAGACTGCGGGAAATGGG + Intronic
1000392414 5:160738327-160738349 GTGTGAAAACTCAAGGATCTAGG + Intronic
1001241309 5:170072527-170072549 GCATGTATACTGAGGGAACTGGG - Intronic
1003486205 6:6581742-6581764 GCTTGGAAACTGAGGGGACTTGG - Intergenic
1004300263 6:14451453-14451475 TGCTGAAACCTGAGGGAACTTGG - Intergenic
1004418157 6:15444239-15444261 CGTTTAAAACTGTGGGAACTGGG + Intronic
1006316970 6:33297160-33297182 GGGTGAAGGCTGAGGGCAATGGG - Intronic
1007282192 6:40720920-40720942 GGGTGGAGGCTGAGGGAAATAGG - Intergenic
1007405309 6:41632248-41632270 GGGTGGAAACTCAGGCATCTGGG - Intergenic
1008605960 6:53139933-53139955 GTTTGAAAGCTGAGGTAACTTGG - Intronic
1009279038 6:61723075-61723097 TGGGAAAAACTGAGGCAACTAGG + Intronic
1010477659 6:76308323-76308345 AGGTGAGAACAGAGGGAAATGGG - Intergenic
1011336082 6:86261075-86261097 GGGTGAACACTGAGGTAAAGAGG - Intergenic
1012946350 6:105469994-105470016 AGATAAAAACTGAGGGAACTTGG + Intergenic
1013514706 6:110875293-110875315 AACTGAAAGCTGAGGGAACTCGG - Intronic
1015805348 6:137102770-137102792 TTGTGAAAACACAGGGAACTGGG - Intergenic
1017186244 6:151603684-151603706 GGTTGAAAACTGAGGTCACCAGG - Intronic
1017644477 6:156526442-156526464 TGGTGAAATCTGAGGGCACCAGG - Intergenic
1020019255 7:4852841-4852863 GGTTCAAAAGTGAGGGAAATGGG - Intronic
1022864698 7:34405515-34405537 GGGTGAAAACAAAAGGCACTGGG + Intergenic
1023102391 7:36732486-36732508 TTGTGAAAACTCAGGGAAATAGG - Intergenic
1023742307 7:43291792-43291814 GGGGGAAAACTCAGAGAAATGGG + Intronic
1024167088 7:46746133-46746155 GGGAGAACATTGAGGAAACTTGG - Intronic
1024668226 7:51566517-51566539 GGGTGAAAAATGAGCGTATTGGG + Intergenic
1026148907 7:67771711-67771733 GAGTGAGAACTGAGGGATCCAGG - Intergenic
1026736463 7:72952015-72952037 CAATAAAAACTGAGGGAACTCGG + Intergenic
1027107271 7:75413047-75413069 CAATAAAAACTGAGGGAACTCGG - Intergenic
1029256485 7:99273110-99273132 AGGTGAAACCTGATGGAACCAGG - Intergenic
1029564264 7:101324924-101324946 GGGTGAGAACTGGGTGAACTCGG + Intergenic
1030148578 7:106380477-106380499 GGGAGAAAACAGAGAGAACCTGG + Intergenic
1030891343 7:115002988-115003010 GACTGAAAAGTGAGGGAACAGGG - Intronic
1033456853 7:141510887-141510909 GGGTGACAACTGGGGGTACATGG + Intergenic
1035698153 8:1616300-1616322 GGGAGAAAACTGAGAGAATTTGG + Intronic
1037200772 8:16249774-16249796 GGGTGAGAACTGACTGAACCAGG - Intronic
1037648232 8:20813198-20813220 TGGTGAAGACTGAGGAATCTGGG - Intergenic
1039393005 8:37197030-37197052 GGGTGAAGAGTGAGGAAAATAGG + Intergenic
1040602796 8:48900602-48900624 GGGTGAAAATGGAGTGAACGTGG + Intergenic
1041972520 8:63760358-63760380 TGGGAAAAACTGAGGCAACTAGG - Intergenic
1042489620 8:69382028-69382050 TGGGAAAAACTGAGGCAACTAGG + Intergenic
1044327447 8:90875709-90875731 GGATAAAAACTGAGGGTACGGGG + Intronic
1049281928 8:141753788-141753810 AGGCGAGAACTGAGGGATCTCGG + Intergenic
1050391658 9:5149257-5149279 GGCTGAAAAGGGAGGGAGCTGGG - Intronic
1052636894 9:31118118-31118140 GGGTGGAAAATGAAGGAAATGGG + Intergenic
1053388616 9:37716496-37716518 GGCAGGAAACTGAAGGAACTGGG - Intronic
1058078403 9:100674225-100674247 GGGTGAAAACAGATGGAAAGGGG + Intergenic
1059717117 9:116923599-116923621 GGGTAAAAGCTGAGGAAAGTTGG - Intronic
1061007111 9:127934637-127934659 GGAAGAAAAGTGAGGGAACCGGG + Intergenic
1061096632 9:128460997-128461019 GGGTGAAAACCAAGGTACCTTGG + Exonic
1062358870 9:136178062-136178084 GGGGGAGCACTGGGGGAACTGGG + Intergenic
1062358884 9:136178107-136178129 GGGGGAGCACTGGGGGAACTGGG + Intergenic
1188081399 X:25845786-25845808 GGGTGAAAACTGAATGAAAAAGG - Intergenic
1188283492 X:28299693-28299715 TGGTCATCACTGAGGGAACTGGG - Intergenic
1188533901 X:31173577-31173599 GTGTGAAAGCTGAGGGGACGAGG + Exonic
1188558918 X:31445344-31445366 GGGTAAAAATTGAGGAACCTGGG + Intronic
1188579024 X:31687454-31687476 TGGTGAATGCTGAGAGAACTGGG - Intronic
1189713721 X:43842900-43842922 GGGTGAGAACTGAGGGAATGAGG + Intronic
1189865813 X:45325907-45325929 GGGTGAAAACAGAAGGTGCTGGG + Intergenic
1192550151 X:72047204-72047226 TGGGGAAAGCTGAGGGCACTAGG - Intergenic
1192718538 X:73668637-73668659 ATGAGAAAACTGAGGCAACTAGG - Intronic
1195397253 X:104424962-104424984 GTGGGAAAAATCAGGGAACTGGG - Intergenic
1197858717 X:130947185-130947207 GGGTGAAAACTACTGGACCTGGG + Intergenic
1202366457 Y:24168895-24168917 GTGAGAAAACTTAGGGGACTGGG - Intergenic
1202374051 Y:24217747-24217769 GTGAGAAAACTTAGGGGACTGGG + Intergenic
1202496730 Y:25452373-25452395 GTGAGAAAACTTAGGGGACTGGG - Intergenic
1202504325 Y:25501228-25501250 GTGAGAAAACTTAGGGGACTGGG + Intergenic