ID: 990795549

View in Genome Browser
Species Human (GRCh38)
Location 5:59535908-59535930
Sequence TTGACATTCAATAAAAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 726
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 683}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990795545_990795549 22 Left 990795545 5:59535863-59535885 CCTGGAAATCCTAAAATCGCTAG 0: 1
1: 0
2: 0
3: 0
4: 71
Right 990795549 5:59535908-59535930 TTGACATTCAATAAAAATTCTGG 0: 1
1: 0
2: 2
3: 40
4: 683
990795547_990795549 13 Left 990795547 5:59535872-59535894 CCTAAAATCGCTAGATGGACTTT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 990795549 5:59535908-59535930 TTGACATTCAATAAAAATTCTGG 0: 1
1: 0
2: 2
3: 40
4: 683

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990795549 Original CRISPR TTGACATTCAATAAAAATTC TGG Intronic
901331991 1:8417154-8417176 CTGAAATTAAATAAAACTTCAGG + Intronic
906567049 1:46808313-46808335 ATGACAATCATTAAAAAGTCAGG - Intronic
906856650 1:49313543-49313565 ATGGCAATCATTAAAAATTCAGG - Intronic
907899718 1:58727123-58727145 TTGTCATCAAGTAAAAATTCAGG + Intergenic
908107803 1:60863454-60863476 TTTACATTTGATAATAATTCTGG + Intergenic
908859466 1:68466743-68466765 TGGACATGCAATAAAAATGCAGG - Intergenic
909179527 1:72404525-72404547 ATGACAATCATTAAAAACTCAGG + Intergenic
909247622 1:73307649-73307671 TTTAGAATCAATAAAATTTCAGG - Intergenic
909439597 1:75683078-75683100 ATGGCAATCAATAAAAAGTCAGG + Intergenic
909539528 1:76775644-76775666 TTTGCATTCAATATAAGTTCTGG + Intergenic
909799812 1:79792414-79792436 GAGACATGCAATGAAAATTCAGG - Intergenic
909986548 1:82167713-82167735 TTGATATTTGAGAAAAATTCTGG + Intergenic
910401278 1:86840593-86840615 CTGTCATCAAATAAAAATTCTGG + Intergenic
910502149 1:87904793-87904815 TGGACATTAAACAAAAAGTCAGG - Intergenic
910695496 1:90010119-90010141 TTGATAGTCAACAACAATTCCGG - Exonic
911326911 1:96479336-96479358 ATCACATTCAATTAAAATTCAGG - Intergenic
911723610 1:101218413-101218435 TTGAAATTCAATAAAAAAGCAGG + Intergenic
911874072 1:103136355-103136377 ATGACAATCATTAAAAACTCAGG - Intergenic
912885896 1:113473935-113473957 ATGGCAATCATTAAAAATTCAGG - Intronic
912905802 1:113705503-113705525 TTGAAATTTGATAAAAATTATGG - Intronic
913424187 1:118708569-118708591 TTTACAGTCATTAAAAAGTCAGG - Intergenic
913458545 1:119058977-119058999 ATGGCAATCATTAAAAATTCAGG - Intronic
913661142 1:121007421-121007443 TTTACATTAAAAAAAAAATCGGG + Intergenic
914012509 1:143790601-143790623 TTTACATTAAAAAAAAAATCGGG + Intergenic
915829781 1:159116155-159116177 ATGGCAATCACTAAAAATTCAGG + Intronic
916283270 1:163076119-163076141 TGGGCATTCATTAATAATTCAGG - Exonic
916363270 1:163995064-163995086 ATGACAATCATTAAAAAGTCAGG + Intergenic
916949431 1:169763923-169763945 TGGGCATTCAATAGAATTTCAGG - Intronic
916975796 1:170076155-170076177 TTGTCACTGAATAAAAATTTTGG + Intronic
917146916 1:171901802-171901824 TTGACATTAAAATAAAATTTTGG + Intronic
917699305 1:177563983-177564005 ATGACAATCATTAAAAAGTCAGG - Intergenic
918536032 1:185575460-185575482 TTGAAATTCATTAAAAAATAAGG - Intergenic
918560012 1:185854289-185854311 TAGACCTTAAAAAAAAATTCAGG + Intronic
918703418 1:187633506-187633528 ATGACAATCATTAAAAAGTCAGG + Intergenic
918948047 1:191095468-191095490 TTGACAGCAAATAAAAATTTGGG - Intergenic
919288412 1:195596348-195596370 TTGAGATTCTATAAAAATGAAGG - Intergenic
919300659 1:195759472-195759494 AGGACATTCAGTAAAAATTAGGG + Intergenic
919449380 1:197752289-197752311 TTGAAATTTAAACAAAATTCAGG - Intronic
919457219 1:197834596-197834618 ATGACAATCATTAAAAAGTCAGG + Intergenic
919504522 1:198382376-198382398 TAGACATTCCAATAAAATTCTGG - Intergenic
920235638 1:204502114-204502136 TGCACATTCAAACAAAATTCTGG - Intergenic
920960681 1:210661373-210661395 ATGACAATCACTAAAAAGTCAGG + Intronic
921386004 1:214570442-214570464 TTGACATGCAATAGACTTTCTGG + Intergenic
921686695 1:218097552-218097574 ATGACAATCATTAAAAAGTCAGG + Intergenic
921691697 1:218158425-218158447 TAGACAGTCAATACACATTCAGG + Intergenic
922112164 1:222570688-222570710 TTAACATTCATTAAACATTGAGG + Intronic
922756187 1:228098167-228098189 TTTACATTAAATAAAAAGCCTGG - Exonic
923254296 1:232207513-232207535 TTGACATTAAATATTTATTCTGG + Intergenic
923422228 1:233827702-233827724 ATGACAGTCATTAAAAAATCAGG + Intergenic
923645095 1:235811968-235811990 ATGAAATTCACTAAAAATACAGG + Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
924830856 1:247593106-247593128 ATGACAATCATTAAAAAGTCAGG - Intergenic
1062935088 10:1379614-1379636 TTGACATGCATTAAAAATAAAGG + Intronic
1063406233 10:5798285-5798307 TATTTATTCAATAAAAATTCTGG + Intronic
1063644240 10:7862825-7862847 TTGAGATTCATCCAAAATTCTGG + Intronic
1063893668 10:10656193-10656215 ATGACAATCATTAAAAAGTCAGG + Intergenic
1064467610 10:15600362-15600384 TTGAGACTTAATAAAAATTGAGG - Intronic
1065147254 10:22782174-22782196 TTGAGATTCTTTACAAATTCTGG + Intergenic
1066677661 10:37905257-37905279 ATGACAATCATTAAAAAGTCAGG + Intergenic
1066810987 10:39335163-39335185 ATGACAATCATTAAAAAGTCAGG + Intergenic
1066965066 10:42255787-42255809 ATGGCATTCATTAAAAAGTCAGG - Intergenic
1067210105 10:44253141-44253163 ATGACAATCATTAAAAAGTCTGG - Intergenic
1068033752 10:51734993-51735015 GAGATATTCAATAAAAATCCCGG + Intronic
1068240125 10:54293790-54293812 ATGACAATCATTAAAAAGTCGGG + Intronic
1068552124 10:58418446-58418468 ATGACAATCATTAAAAAGTCAGG - Intergenic
1068553229 10:58428955-58428977 ATGACAATCATTAAAAAGTCAGG - Intergenic
1070221595 10:74453184-74453206 TAGAAATTCAATAAAACATCTGG - Intronic
1070351580 10:75597705-75597727 ATAACTTTGAATAAAAATTCAGG - Intronic
1071152086 10:82647673-82647695 ATGGCAATCATTAAAAATTCAGG - Intronic
1071618549 10:87096958-87096980 TTGACCATCAAGGAAAATTCAGG - Exonic
1072140444 10:92584654-92584676 CTTACGTTAAATAAAAATTCAGG + Intergenic
1072461182 10:95620256-95620278 ATGGCATTCATTAAAAAGTCAGG + Intronic
1073705923 10:105984370-105984392 TTGACCTGCATTATAAATTCAGG - Intergenic
1076254943 10:129015133-129015155 TTGGCAATCATTAAAAAGTCAGG + Intergenic
1076418967 10:130314722-130314744 ATGACAATCATTAAAAAGTCAGG - Intergenic
1076459166 10:130627601-130627623 TTGGCACTCACTAAAAATTGAGG + Intergenic
1077449958 11:2634848-2634870 ATGGCAATCATTAAAAATTCAGG - Intronic
1078636815 11:13058814-13058836 ATGACAATCATTAAAAAGTCAGG + Intergenic
1078803055 11:14666756-14666778 ATGACAATCATTAAAAAGTCAGG + Intronic
1078997755 11:16721456-16721478 GTGACACTGAATCAAAATTCAGG - Intronic
1079057840 11:17222470-17222492 TTGACAGTAAATCAAAATACTGG - Intronic
1079510076 11:21200314-21200336 ATGACAATCATTAAAAAGTCAGG - Intronic
1079677531 11:23249187-23249209 TTAAAATTCAGTAAAAATGCAGG - Intergenic
1079843285 11:25430471-25430493 ATGGCAATCATTAAAAATTCAGG + Intergenic
1079923135 11:26456547-26456569 ATGACAATCATTAAAAAGTCAGG + Intronic
1080118425 11:28646734-28646756 ATGACAATCATTAAAAAGTCAGG + Intergenic
1080287481 11:30632197-30632219 TTGACAATCAATATGAATTAAGG + Intergenic
1080965145 11:37205754-37205776 ATGACAATCATTAAAAAGTCAGG - Intergenic
1081035072 11:38134064-38134086 ATGGCAATCACTAAAAATTCTGG + Intergenic
1081709035 11:45205302-45205324 TTGGCATTTAAGAAAACTTCTGG - Intronic
1081958350 11:47113518-47113540 ATGACAGTCATTAAAAAGTCAGG - Intronic
1082148404 11:48700501-48700523 ATGACAATCATTAAAAAGTCAGG - Intergenic
1082314724 11:50703957-50703979 ATGACAATCATTAAAAAGTCAGG - Intergenic
1082316213 11:50725569-50725591 ATGACAATCATTAAAAAGTCAGG + Intergenic
1082628709 11:55515899-55515921 ATGGCAATCATTAAAAATTCAGG - Intergenic
1082730409 11:56789544-56789566 ATGACAATCATTAAAAAGTCAGG - Intergenic
1082885888 11:58082084-58082106 ATGACAATCATTAAAAAGTCAGG + Intronic
1082950873 11:58814613-58814635 ATGACAATCATTAAAAAGTCAGG - Intergenic
1083379915 11:62258162-62258184 TAGACCTCCAACAAAAATTCTGG + Intergenic
1086099154 11:83080977-83080999 CTGAGATTAAATAAAAATTAAGG + Intergenic
1086111319 11:83201671-83201693 ATGACAATCATTAAAAAGTCAGG - Intronic
1086189512 11:84062059-84062081 CTGACATTTAAAAAAAATTCTGG + Intronic
1086271256 11:85069625-85069647 ATGGCAATCATTAAAAATTCAGG + Intronic
1086435822 11:86780381-86780403 TTGGAATTCAATATACATTCAGG + Intergenic
1086466689 11:87061154-87061176 TTTAAATAAAATAAAAATTCTGG + Intronic
1086592993 11:88538345-88538367 TACACAATCAATAGAAATTCAGG + Intronic
1086635422 11:89077426-89077448 ATGGCAATCATTAAAAATTCAGG + Intergenic
1086795429 11:91095621-91095643 ATGACATTCATTAAAAAATCAGG + Intergenic
1086907104 11:92431179-92431201 ATGACAATCACTAAAAAGTCAGG - Intronic
1086914863 11:92517943-92517965 ATGACAATCATTAAAAAGTCAGG + Intronic
1086938754 11:92772673-92772695 TTGACATTTAATTAAAGTTACGG - Intronic
1087145312 11:94804971-94804993 TTTACATACAATAAAAACTTAGG + Intronic
1087329063 11:96756351-96756373 TTTATATTCAATAGAAATCCAGG + Intergenic
1087410056 11:97780138-97780160 ATGGCAATCATTAAAAATTCAGG - Intergenic
1087490287 11:98817366-98817388 TTAACATTCAATAAAATGTCAGG + Intergenic
1087695861 11:101375111-101375133 ATGGCATTCATTAAAAAGTCAGG - Intergenic
1087888275 11:103505921-103505943 ATGACAATCATTAAAAAGTCAGG + Intergenic
1088694134 11:112351934-112351956 ATGACAATCATTAAAAAGTCAGG - Intergenic
1088705119 11:112455202-112455224 TTGAACTTAAAGAAAAATTCAGG + Intergenic
1088931367 11:114354070-114354092 TTTACAGTGAAGAAAAATTCTGG - Intergenic
1090678810 11:129031275-129031297 TTGACATTCACTAAGTATCCAGG + Intronic
1090747396 11:129717981-129718003 ATGACAGTCATTAAAAAGTCAGG + Intergenic
1090881771 11:130839390-130839412 TTGACAGTTAATAAATACTCTGG - Intergenic
1091030561 11:132183766-132183788 TTAATATTCAATACAAATTTAGG + Intronic
1092107949 12:5936879-5936901 ATAAAATTCTATAAAAATTCTGG - Intronic
1092327566 12:7549402-7549424 ATGACAATCAGTAAAAAGTCAGG + Intergenic
1092560598 12:9609252-9609274 ATGACAGTCATTAAAAAGTCAGG - Intergenic
1092567426 12:9683015-9683037 ATGACAATCATTAAAAAGTCAGG - Intronic
1093245864 12:16735699-16735721 TTGACATTTAATAAATAATGAGG + Intergenic
1093826388 12:23695303-23695325 TTGAAATTCCATAAAAATTTTGG + Intronic
1094259662 12:28478935-28478957 ATGACATTCATTAAAATATCGGG + Intronic
1094788693 12:33883192-33883214 ATGACAATTATTAAAAATTCAGG + Intergenic
1095309174 12:40676644-40676666 CTGACATTAAAGTAAAATTCAGG - Intergenic
1095845751 12:46742450-46742472 ATGGCAATCATTAAAAATTCAGG + Intergenic
1096336723 12:50762557-50762579 TTGACATTCAGCAAAAATTGTGG - Intergenic
1097059351 12:56270925-56270947 TTGAAATTTTATAAAAACTCAGG - Exonic
1097461398 12:59867644-59867666 TGAAAATACAATAAAAATTCTGG - Intergenic
1098306146 12:69104815-69104837 TTAAAATACAATAAAAATTGTGG + Intergenic
1098647718 12:72925093-72925115 TTTTCATTTAATAAAAATGCTGG - Intergenic
1099107454 12:78514778-78514800 ATGACAATCATTAAAAAGTCAGG + Intergenic
1099419127 12:82431283-82431305 TTCCCATTCTATAAAAATTTAGG - Intronic
1100400834 12:94227694-94227716 TACACATTCTATAACAATTCTGG - Intronic
1101239820 12:102826766-102826788 TTGACTTTAAAGAAAAAGTCTGG + Intergenic
1101314825 12:103619559-103619581 AGGACATTCACTAAACATTCAGG - Intronic
1101771846 12:107759492-107759514 TTGAAATTAAATAAATATTCAGG - Intronic
1103427035 12:120844937-120844959 TTTACATTGAATAAAAAGCCTGG + Intronic
1104118153 12:125770341-125770363 TTGGCAAACACTAAAAATTCAGG + Intergenic
1105238404 13:18584503-18584525 TTAACATTCAAAAATAAGTCAGG - Intergenic
1106902376 13:34367632-34367654 ATGGCAATCATTAAAAATTCAGG + Intergenic
1106976386 13:35221832-35221854 TTGAAATTCAACAAAATTTTTGG - Intronic
1107190655 13:37580886-37580908 TTGACTTTTAATAAAAAACCCGG - Intronic
1107231696 13:38117494-38117516 ATGACAATCATTAAAAAGTCAGG + Intergenic
1107393049 13:39987102-39987124 ATGACAATCATTAAAAAGTCAGG - Intergenic
1107774109 13:43819958-43819980 TTGACAATAAAAAAAACTTCAGG - Intergenic
1108433641 13:50379956-50379978 TTAGGACTCAATAAAAATTCTGG - Intronic
1108824337 13:54393552-54393574 TTGAAAATCAATAGCAATTCTGG + Intergenic
1108865981 13:54923204-54923226 ATGACAATCATTAAAAAGTCAGG + Intergenic
1109187093 13:59283055-59283077 GTGACATTTTATAAATATTCAGG + Intergenic
1109415584 13:62034866-62034888 ATGACATTCAATAGGAATGCAGG - Intergenic
1109964367 13:69672282-69672304 ATGACAATCATTAAAAAGTCAGG + Intergenic
1110728734 13:78855579-78855601 ATGGCATTCATTAAAAAGTCAGG - Intergenic
1110734859 13:78924500-78924522 ATGGCATTCATTAAAAAGTCAGG - Intergenic
1110735387 13:78929652-78929674 ATGGCATTCATTAAAAAGTCAGG - Intergenic
1110942537 13:81368294-81368316 ATGACAATCATTAAAAAGTCAGG + Intergenic
1111035243 13:82663497-82663519 TTGACAATAAATAAATATTATGG + Intergenic
1111412713 13:87897035-87897057 ATGACAATCACTAAAAAGTCAGG - Intergenic
1111415982 13:87944629-87944651 TTGTCATTAAAATAAAATTCTGG - Intergenic
1111500459 13:89113499-89113521 ATGTCATTAAATAAAAATACTGG + Intergenic
1112164442 13:96903121-96903143 TGGTCATCCAAGAAAAATTCTGG - Intergenic
1113288890 13:108883924-108883946 TTCAAATTCAAAAAATATTCTGG - Intronic
1114009586 14:18353045-18353067 ATGACAATCATTAAAAAGTCAGG + Intergenic
1114359221 14:21951658-21951680 TTCACATGCAATAAAATTTTTGG + Intergenic
1114508415 14:23235943-23235965 TTGATATCACATAAAAATTCAGG - Intronic
1114700809 14:24676408-24676430 ATGACAATCATTAAAAAGTCAGG + Intergenic
1114847605 14:26342837-26342859 TTGACATTCATTAATAAAACCGG + Intergenic
1115148112 14:30250467-30250489 TTGACATTATATGAAACTTCAGG - Intergenic
1115869249 14:37781297-37781319 ATGACAATCATTAAAAAGTCAGG - Intronic
1115911660 14:38263574-38263596 ATGACAATCATTAAAAAGTCAGG - Intergenic
1115936356 14:38557624-38557646 ATGACAATCATTAAAAAGTCAGG - Intergenic
1116096513 14:40377227-40377249 ATGACAATCATTAAAAAGTCAGG - Intergenic
1116271480 14:42774526-42774548 ATGGCATTCATTAAAAAGTCAGG + Intergenic
1116566568 14:46452063-46452085 TCAACCTTCAATAAAAATTATGG + Intergenic
1116580899 14:46640235-46640257 ATGACAATCATTAAAAAGTCAGG + Intergenic
1116581373 14:46646432-46646454 CCGACATTAAAAAAAAATTCTGG + Intergenic
1117105036 14:52389618-52389640 ATGACAATCATTAAAAAGTCAGG + Intergenic
1117494468 14:56289111-56289133 TGGATATTCACTAAAACTTCTGG - Intronic
1117514788 14:56489962-56489984 TTCACATTCTTTAAAAACTCTGG - Intronic
1117683088 14:58225628-58225650 CTGAGATTCAATAAACAATCAGG - Intronic
1118066653 14:62199770-62199792 ATGACAATCATTAAAAAGTCAGG - Intergenic
1118670417 14:68119987-68120009 ATGACAATCATTAAAAAGTCAGG - Intronic
1119110947 14:71973382-71973404 TTAACATTAAATAAAATTCCTGG + Intronic
1119297453 14:73544634-73544656 GTGAAATTCAATAACAATTTAGG + Intronic
1119634383 14:76262055-76262077 CTGACATTAAAAAAAAATTCAGG + Intergenic
1119905827 14:78301129-78301151 TCCACATTAAATAAAATTTCAGG - Intronic
1119990383 14:79190246-79190268 TTGACAGTCAGTAAAATATCAGG + Intronic
1120446572 14:84605301-84605323 TTTACATTTAATAAGAATACAGG + Intergenic
1120586474 14:86317689-86317711 ATGGCAATCAATAAAAAGTCAGG + Intergenic
1120977449 14:90261624-90261646 TTGGCAATCATTAAAAAGTCAGG + Intronic
1121235138 14:92386595-92386617 TTGGCTTTAAATAATAATTCTGG - Intronic
1121385978 14:93525528-93525550 TTGACCTTCAATAGACATTTGGG + Intronic
1121790145 14:96693098-96693120 TAGACACTCAATAAATATTTGGG + Intergenic
1123819928 15:24018566-24018588 ATGACAATCATTAAAAAGTCAGG - Intergenic
1124842840 15:33260350-33260372 TGCAAATGCAATAAAAATTCTGG + Intergenic
1125082612 15:35693279-35693301 TTGTCATTCCATAAAATATCTGG + Intergenic
1125210981 15:37215046-37215068 ATGGCATTCATTAAAAAGTCAGG + Intergenic
1125256118 15:37765264-37765286 TTTACTTTCAATAATAATTCAGG - Intergenic
1126310307 15:47308394-47308416 TAAACATTCAATAAACATTAAGG + Intronic
1126710383 15:51448975-51448997 TTGACATTCTATAAAGATTGGGG - Exonic
1126903674 15:53340854-53340876 ATGACAATCATTAAAAAGTCAGG - Intergenic
1127227835 15:56952433-56952455 TGGAATTACAATAAAAATTCTGG - Intronic
1127247047 15:57188474-57188496 TTGAAATTCCATATAAATTTAGG - Intronic
1127802172 15:62486489-62486511 TTGACATTTTAAAAAAATACAGG + Intronic
1128848392 15:70923570-70923592 TTAACATTAAATAAACATTAAGG - Intronic
1129010608 15:72413185-72413207 ATGACAATCATTAAAAAGTCAGG + Intergenic
1129495074 15:75972037-75972059 ATGACAATCATTAAAAAGTCAGG - Intronic
1130946961 15:88554902-88554924 ATGGCATTCATTAAAAAGTCAGG - Intergenic
1132066605 15:98736255-98736277 CTGAGATGCATTAAAAATTCTGG - Intronic
1133408228 16:5543965-5543987 TTGACGTTCAATCATAATTCTGG - Intergenic
1133545362 16:6801240-6801262 TTGCCATGCAATTAAAATGCTGG + Intronic
1135494004 16:22935854-22935876 TTGACATCCAATTATAATTGTGG - Intergenic
1137784463 16:51126407-51126429 CTGACATTCAAAAAAAAATCTGG + Intergenic
1138974622 16:62188768-62188790 TTGACACTCATTCAAAATCCAGG + Intergenic
1139154475 16:64423889-64423911 TTGACATCCAAAATAAATTTTGG + Intergenic
1139888884 16:70233836-70233858 GTGACAGTCAATAAGGATTCTGG - Intergenic
1140309699 16:73837302-73837324 TTGAAATTAAATAGAAATTTGGG - Intergenic
1143127553 17:4653267-4653289 TTGGGATTTAATAAGAATTCTGG - Intergenic
1144655660 17:17034191-17034213 TTCAAATTCAAAAAAAATTGTGG + Intergenic
1145219476 17:21076383-21076405 CTGACCTCCAATAAAAATCCTGG + Intergenic
1146600301 17:34208810-34208832 TTGAATTTCAATATAAATTTTGG + Intergenic
1147501507 17:40968595-40968617 ATGACAATCATTAAAAAGTCAGG - Intergenic
1149208011 17:54270938-54270960 TTGACATTTAATTTAAAATCTGG - Intergenic
1149240629 17:54644672-54644694 TTGGCAATCATTAAAAAGTCAGG + Intergenic
1149322170 17:55492711-55492733 TTGAAATTCACTTAAAATTAAGG + Intergenic
1149398222 17:56266646-56266668 TTGACATTCAACAAAAACCAAGG - Intronic
1149509692 17:57229900-57229922 TTGAAAATAACTAAAAATTCTGG - Intergenic
1149901261 17:60481569-60481591 TTGACAATCCCTAAAAATTTAGG + Intronic
1149946916 17:60938192-60938214 TTGAAATTCCATACAAATTTTGG - Intronic
1151088106 17:71404504-71404526 TTTAAATTCAATAATAATTTGGG - Intergenic
1151104847 17:71601068-71601090 TTGACATGCAAGAAAACTTTTGG + Intergenic
1152561413 17:81080694-81080716 TTGACATTCACTTATAATTTGGG + Intronic
1153195929 18:2596498-2596520 ATGACAGTCATTAAAAAGTCAGG + Intronic
1154010940 18:10573338-10573360 ATGGCAATCATTAAAAATTCAGG - Intergenic
1154058748 18:11037802-11037824 TTGACATAGAATCATAATTCTGG - Intronic
1154511799 18:15112363-15112385 TTAACATTCAAAAATAAGTCAGG - Intergenic
1155077274 18:22370262-22370284 TTGATGTTCAATAAATATTGTGG + Intergenic
1155167343 18:23241972-23241994 TTGAACTTAAAAAAAAATTCCGG + Intronic
1155586180 18:27368338-27368360 TTTACATTTAAAAAAAATTCTGG + Intergenic
1155799702 18:30085645-30085667 TTCACATTTAATAATCATTCTGG + Intergenic
1155979780 18:32167972-32167994 TTGGTATTAAAAAAAAATTCTGG - Intronic
1156102300 18:33611489-33611511 TTGACAATCAATAAACATAAAGG - Intronic
1156382002 18:36571522-36571544 TTGCCTTTTAATACAAATTCTGG - Intronic
1156679451 18:39570929-39570951 ATGGCAATCATTAAAAATTCAGG + Intergenic
1156922668 18:42541717-42541739 ATGGCATTCATTAAAAAGTCAGG - Intergenic
1157026281 18:43847768-43847790 TTGACATTAAAGAAGTATTCTGG - Intergenic
1157561951 18:48654446-48654468 ATGACAATCATTAAAAAGTCAGG + Intronic
1157780710 18:50436583-50436605 ATGACAATCATTAAAAAGTCAGG + Intergenic
1157954844 18:52085518-52085540 TGGGCTTTCAAAAAAAATTCTGG + Intergenic
1158099127 18:53809657-53809679 ATGACAATCATTAAAAAGTCTGG + Intergenic
1158274968 18:55757190-55757212 CTGACTTTGAATAAGAATTCAGG + Intergenic
1158433845 18:57418661-57418683 ATGAAATTCAAAAAAACTTCTGG + Intergenic
1158784358 18:60691534-60691556 TTGTCACTCAAGCAAAATTCCGG - Intergenic
1158793339 18:60810001-60810023 TTTACATGCAAAATAAATTCAGG + Intergenic
1159233204 18:65635768-65635790 TTCACATTCAATAAAAATAAAGG + Intergenic
1159696809 18:71569296-71569318 TTGAGATCAAATAAAAATTCTGG + Intergenic
1159900858 18:74044294-74044316 ATGACAATCATTAAAAAGTCAGG + Intergenic
1160258683 18:77269887-77269909 ATGACATTCAAAAAAAATCATGG + Exonic
1162941504 19:14012645-14012667 TTGAAATTCATTTTAAATTCTGG - Intergenic
1164347216 19:27281223-27281245 ATGGCAATCAATAAAAAGTCAGG - Intergenic
1164377000 19:27696108-27696130 ATGGCAATCATTAAAAATTCAGG - Intergenic
1164395956 19:27863172-27863194 ATGACAATCATTAAAAAGTCAGG - Intergenic
1164555830 19:29250308-29250330 ATGACAATCATTAAAAAGTCAGG - Intergenic
925132990 2:1506552-1506574 ATGACAATCATTAAAAAGTCAGG - Intronic
926074204 2:9927539-9927561 ATGGCAATCAATAAAAAGTCAGG - Intronic
927035169 2:19166969-19166991 ATGACAATCATTAAAAAGTCAGG + Intergenic
928820726 2:35357277-35357299 TTTACCTTAAATAATAATTCTGG + Intergenic
928917998 2:36494403-36494425 TTTACATTTATTAAAAATTTAGG - Intronic
929315573 2:40473917-40473939 TTGATATTCAATATAAATATAGG + Intronic
929370125 2:41213128-41213150 TTGAAATTCAGGATAAATTCAGG - Intergenic
930923863 2:56791996-56792018 ATGACAATCATTAAAAAGTCAGG + Intergenic
931352269 2:61502447-61502469 TTGGCATTTTAAAAAAATTCCGG + Intronic
933572070 2:84025625-84025647 TTGAATCCCAATAAAAATTCTGG + Intergenic
934154535 2:89184040-89184062 ATGACAATCATTAAAAAATCAGG + Intergenic
934212700 2:89997900-89997922 ATGACAATCATTAAAAAGTCAGG - Intergenic
935012388 2:99147398-99147420 TTGCCATTCAAGAAGAAATCTGG - Exonic
935397771 2:102625989-102626011 ATGACAATCATTAAAAAGTCAGG - Intronic
936620942 2:114096964-114096986 ATGACAATCATTAAAAAGTCAGG - Intergenic
936736907 2:115456282-115456304 ATGGCAATCAATAAAAAGTCAGG + Intronic
937526569 2:122777528-122777550 ATGACAATCATTAAAAAGTCTGG + Intergenic
938511367 2:131949112-131949134 TTAACATTCAAAAATAAGTCAGG - Intergenic
938704983 2:133915813-133915835 ATGGCAATCATTAAAAATTCAGG + Intergenic
939250965 2:139680988-139681010 TGGGCTTCCAATAAAAATTCAGG - Intergenic
939500192 2:142974807-142974829 TTGTCTTTCAATAAAAACCCTGG - Intronic
939818427 2:146925272-146925294 TTCACATTAAAAAAAATTTCTGG - Intergenic
940842528 2:158600426-158600448 TAGCCATTCAATAAAAGTTGAGG + Intronic
940965014 2:159827431-159827453 ATGACAATCATTAAAAAGTCAGG + Intronic
941070633 2:160950764-160950786 ATGGCATTCATTAAAAAGTCAGG + Intergenic
941195402 2:162444546-162444568 TTAAAATGCACTAAAAATTCTGG - Intronic
941546638 2:166859160-166859182 ATGGCATTCATTAAAAAGTCAGG + Intergenic
941603450 2:167565823-167565845 ATGGCATTCATTAAAAAGTCAGG + Intergenic
941707766 2:168678016-168678038 ATGGCAATCATTAAAAATTCAGG + Intronic
941737453 2:168994688-168994710 ATTATATTCAATAAATATTCTGG - Intronic
941781023 2:169445851-169445873 TTGAGAGTTAAAAAAAATTCTGG - Intergenic
942110722 2:172680203-172680225 TTGCAATTCAGGAAAAATTCTGG - Intergenic
942416510 2:175764937-175764959 ATGACAATCATTAAAAAGTCAGG + Intergenic
942467014 2:176218822-176218844 ATGGCAATCATTAAAAATTCAGG - Intergenic
943116790 2:183682876-183682898 TTGTCACTCAATATAAAATCAGG - Intergenic
943178386 2:184508704-184508726 AAGATATTCAATAAACATTCTGG + Intergenic
943255285 2:185586555-185586577 ATGGCAATCATTAAAAATTCAGG - Intergenic
943558690 2:189435649-189435671 ATGACAATCATTAAAAAGTCAGG + Intergenic
943709961 2:191081510-191081532 ATGACAATCATTAAAAAGTCAGG - Intronic
943920793 2:193705571-193705593 ATGACAATCATTAAAAAGTCAGG - Intergenic
944564101 2:200970098-200970120 TTGACATATAAAAAAATTTCAGG - Intergenic
944874767 2:203951139-203951161 ATGCCATTCAAGAAAAATTGAGG + Intronic
944984029 2:205154369-205154391 ATGACAATCATTAAAAAGTCAGG + Intronic
945711960 2:213307854-213307876 TCGACAATCATTAAAAAGTCAGG - Intronic
945888623 2:215404717-215404739 TAGACATTCAATCAAGTTTCAGG - Intronic
946773859 2:223117270-223117292 CTGACATTCAAATAAAATTGTGG + Intronic
946910411 2:224455234-224455256 TTGACATTCTACAAAAATGAGGG - Intergenic
947015531 2:225615682-225615704 GTGACATTCAATTAGAATACAGG - Intronic
947226480 2:227845409-227845431 CTGACATTAAAAAAAAATCCTGG + Intergenic
1168789539 20:567015-567037 ATCACATACAATCAAAATTCAGG + Intergenic
1169546917 20:6659984-6660006 GTGACCTTGAAAAAAAATTCTGG + Intergenic
1170365981 20:15598781-15598803 TTGCCATCCAATAAAAATACAGG + Intronic
1170726830 20:18936497-18936519 ATGGCAATCATTAAAAATTCAGG - Intergenic
1171199137 20:23227043-23227065 TTTCCACTCAATAAAAGTTCAGG + Intergenic
1171440689 20:25159637-25159659 TTGTCATTAAAAAAAATTTCAGG - Intergenic
1171740546 20:28880495-28880517 ATGACAATCATTAAAAAGTCAGG + Intergenic
1172281067 20:33708651-33708673 GTGACAGCCAATAAAAATTATGG + Intronic
1172866031 20:38098175-38098197 TAAACATTCATTAAATATTCTGG + Intronic
1173096020 20:40029368-40029390 TAGACATTGAATAAGAATACAGG + Intergenic
1173480698 20:43396665-43396687 ATGACAATCATTAAAAAGTCAGG - Intergenic
1174722361 20:52826594-52826616 TTAAGTTTCAATAAGAATTCTGG + Intergenic
1174989425 20:55493160-55493182 ATGACAATCATTAAAAAGTCAGG - Intergenic
1175063173 20:56262467-56262489 TTAAAATTGAATAAAAATTGAGG - Intergenic
1176319454 21:5296034-5296056 ATGACAATCATTAAAAAGTCAGG + Intergenic
1176782392 21:13212784-13212806 TTAACATTCAAAAATAAGTCAGG - Intergenic
1176813888 21:13576703-13576725 ATGACAATCATTAAAAAGTCAGG - Intergenic
1177218909 21:18165402-18165424 TTGACATTTATTATACATTCTGG + Intronic
1177253971 21:18635121-18635143 TTGATGTTCATTATAAATTCCGG - Intergenic
1177731666 21:25034921-25034943 ATGACAATCATTAAAAAGTCAGG - Intergenic
1177980106 21:27902822-27902844 TTAACATTCAAAAACAAGTCAGG + Intergenic
1180397499 22:12367138-12367160 ATGACAATCATTAAAAAGTCAGG + Intergenic
1180402221 22:12496997-12497019 ATGACAATCATTAAAAAGTCAGG - Intergenic
1180434087 22:15283854-15283876 ATGACAATCATTAAAAAGTCAGG + Intergenic
1180541723 22:16455347-16455369 ATGACAATCATTAAAAAGTCAGG + Intergenic
1182080470 22:27525174-27525196 TTGGCATTTAATAGAATTTCAGG + Intergenic
1184941788 22:47773148-47773170 TTGACATTTCATATAAATTTTGG - Intergenic
949664389 3:6320226-6320248 TTGGCAATCATTAAAAAGTCAGG + Intergenic
951433772 3:22638268-22638290 ATGACAATCATTAAAAAGTCAGG - Intergenic
951614244 3:24523581-24523603 TTGACATTCTAATAAAATACTGG + Intergenic
951808739 3:26676561-26676583 ATGACAATCATTAAAAAGTCAGG + Intronic
952074197 3:29675750-29675772 ATGACAATCATTAAAAAGTCAGG + Intronic
952190906 3:31022564-31022586 ATAAGATTAAATAAAAATTCAGG + Intergenic
952735382 3:36685598-36685620 TTGAGATTCCATAGAAATTTTGG - Intergenic
952869421 3:37885261-37885283 TTGACATTTTATAGGAATTCTGG + Intronic
953101715 3:39836261-39836283 TTGTCAATCATTAAAAAGTCAGG - Intronic
953191704 3:40693908-40693930 ATGACAGTTAATAAAAAGTCAGG - Intergenic
953651734 3:44811734-44811756 TTAACAAACCATAAAAATTCTGG - Intronic
954531558 3:51325384-51325406 ATGACAGTCATTAAAAAATCAGG + Intronic
955637739 3:61048450-61048472 ATGACAATCATTAAAAAGTCAGG + Intronic
956155234 3:66288995-66289017 ATGACAATCATTAAAAAGTCAGG - Intronic
956346519 3:68285720-68285742 TTCACATTTAAAAAAAAGTCAGG - Intronic
956538263 3:70304265-70304287 TGGAAATTAAATAAAATTTCTGG - Intergenic
957233939 3:77559911-77559933 TTTACAATCAATAAAAAGACAGG - Intronic
957466434 3:80599052-80599074 TTGGCAATCATTAAAAAGTCAGG + Intergenic
957622474 3:82611770-82611792 ATGGCAATCATTAAAAATTCAGG - Intergenic
957683957 3:83475764-83475786 ATGGCATTCATTAAAAAGTCAGG + Intergenic
957693862 3:83607908-83607930 ATGGCATTCATTAAAAAGTCAGG + Intergenic
957786592 3:84890457-84890479 ATGACAATCATTAAAAAGTCAGG + Intergenic
957849342 3:85786174-85786196 TTAAACTTCAATAAAAATTAAGG - Intronic
957972975 3:87406617-87406639 TTGACGATCATTAAAAAGTCAGG + Intergenic
958030261 3:88100295-88100317 ATGACAATCATTAAAAAGTCAGG + Intronic
958214485 3:90544858-90544880 ATGACAATCATTAAAAAGTCAGG + Intergenic
958687416 3:97417336-97417358 TAATCATTCAATAAAAATTAGGG + Intronic
958974349 3:100649632-100649654 TTGACTTTCATTAACACTTCAGG + Intronic
959152485 3:102623874-102623896 ATGACAATCATTAAAAAGTCAGG + Intergenic
959396095 3:105840417-105840439 ATGACATACAATATTAATTCTGG + Intronic
959763529 3:109997125-109997147 ATGACAATCATTAAAAAGTCAGG - Intergenic
960394968 3:117125703-117125725 TTAACATTCATTAAAAATTGAGG + Intronic
960516293 3:118606066-118606088 ATGACAATCATTAAAAAGTCAGG - Intergenic
960719891 3:120615781-120615803 ATGACAATCATTAAAAAGTCAGG - Intergenic
960783161 3:121343015-121343037 ATGACAATCATTAAAAAGTCAGG - Intronic
961705043 3:128778020-128778042 CTGACACACAATAAAAATACTGG - Intronic
962089493 3:132228162-132228184 TTGACATTTATAAAAAATCCTGG - Intronic
963172754 3:142267443-142267465 TTGACATTCAGTAAATAGTGAGG - Intergenic
963779310 3:149471291-149471313 TTTGCATTCAAATAAAATTCAGG - Intergenic
963834171 3:150039388-150039410 TTGACATTAAAAAAAAAAACAGG + Intronic
963910846 3:150816732-150816754 ATGACAATCATTAAAAAGTCAGG - Intergenic
964457879 3:156887802-156887824 TTAACATTTTATAAAAATTTAGG + Intronic
964648590 3:158986263-158986285 ATGACAATCATTAAAAAGTCAGG - Intronic
964839130 3:160974540-160974562 ATGGCAATCATTAAAAATTCAGG - Intronic
964963153 3:162453853-162453875 TTGAGATTCAAAAGAAATTTAGG - Intergenic
965059180 3:163761658-163761680 ATGGCAATCATTAAAAATTCAGG + Intergenic
965066393 3:163856027-163856049 ATGACAATCATTAAAAAGTCAGG + Intergenic
965134939 3:164752216-164752238 TTAACATTCAATAAACATTTTGG + Intergenic
965339900 3:167476907-167476929 TTAACATTCCATTAAATTTCTGG + Intronic
965454234 3:168877656-168877678 TTGATTTTCGATAAAAATTGAGG - Intergenic
966081945 3:176015760-176015782 ATGACAATCATTAAAAAGTCAGG - Intergenic
966261076 3:177980172-177980194 TTGAGATTCAGTAAAAATGACGG + Intergenic
966264669 3:178024938-178024960 TTTTCATTCAATAAACATTTTGG + Intergenic
966560604 3:181315636-181315658 TAGACATTTAATAAAAATTCTGG + Intergenic
967501088 3:190198400-190198422 TTGACATTCTCAAGAAATTCTGG - Intergenic
967563139 3:190940992-190941014 TTAAAAATGAATAAAAATTCTGG - Intergenic
968108143 3:196017996-196018018 ATGACAATCATTAAAAAGTCAGG + Intergenic
969208469 4:5667244-5667266 ATTACATTCAAATAAAATTCTGG - Intronic
971107978 4:23548031-23548053 TTGTCATTTAATGAAAATTCAGG - Intergenic
971776000 4:30965788-30965810 TTGAAATACTATAAAACTTCAGG - Intronic
971808878 4:31397353-31397375 TTTACAGTCAATAAAAGGTCGGG + Intergenic
971991469 4:33901800-33901822 ATGACATTTAGTAAATATTCTGG + Intergenic
972058678 4:34838215-34838237 ATGACAATCATTAAAAAGTCAGG - Intergenic
972623516 4:40772950-40772972 TTCTCATTCATTAAAAATTTGGG + Intronic
972705651 4:41539927-41539949 TAGACACTCAATAACAATTTGGG + Intronic
972811490 4:42592422-42592444 TTAAAATTAAATACAAATTCAGG + Intronic
972817928 4:42665378-42665400 TTGATTTTTAATAAAAATTCTGG - Intergenic
972850143 4:43038756-43038778 TTGACAAGCTATAATAATTCTGG + Intergenic
973065330 4:45783030-45783052 ATGGCATTCATTAAAAAGTCAGG + Intergenic
974321986 4:60362376-60362398 TTGGCATTCCATAACAATACAGG + Intergenic
974682522 4:65181922-65181944 ATGGCAATCAATAAAAAGTCAGG + Intergenic
974854009 4:67437869-67437891 ATGAGATTCAATAACAATCCTGG + Intergenic
974962572 4:68722140-68722162 ATGGCAATCATTAAAAATTCAGG + Intergenic
975519185 4:75280328-75280350 ATGGCATTCATTAAAAAGTCAGG + Intergenic
975767720 4:77686664-77686686 ATGACAGTCATTAAAAAGTCAGG + Intergenic
975791928 4:77962237-77962259 ATGACAATCATTAAAAAGTCAGG - Intergenic
975944096 4:79683584-79683606 TTGAGATAAAATAAAAATCCAGG + Intergenic
976010018 4:80475690-80475712 TTGAAACTCAATATAAAGTCAGG + Intronic
976029650 4:80736635-80736657 ATGGCATTCATTAAAAAGTCAGG + Intronic
976295512 4:83467189-83467211 CTGATATTCAATAATAATTTGGG + Intronic
976411609 4:84719878-84719900 TTGTCATTCAATATTAATTAGGG + Intronic
976627082 4:87197393-87197415 CTGACAGTCAATAAAAAGCCAGG + Intronic
976847423 4:89505781-89505803 TTAACATGTACTAAAAATTCTGG + Intergenic
978157301 4:105504721-105504743 TTGCCATTCAAGATAAATTTGGG - Intergenic
978995032 4:115140131-115140153 TTCACATTCAATCACATTTCTGG - Intergenic
979063049 4:116091126-116091148 TTGACATTCAATAAAATTTTAGG + Intergenic
979130472 4:117038467-117038489 ATGACAATCATTAAAAAGTCAGG + Intergenic
979177357 4:117680819-117680841 ATGACAATCATTAAAAAGTCAGG - Intergenic
979460850 4:120981526-120981548 TTGACATTATATAAAAATCAAGG - Intergenic
979698422 4:123640244-123640266 ATGACAATCATTAAAAAGTCAGG - Intergenic
980080253 4:128336747-128336769 TTGACATGTAATAAAAATGTTGG + Intergenic
980185814 4:129460086-129460108 TTGACACTTAAAAAAATTTCAGG + Intergenic
980316686 4:131209983-131210005 ATGACAATCATTAAAAAGTCAGG + Intergenic
980402568 4:132310763-132310785 TTCACATTGAATAAAAACTTTGG + Intergenic
980933172 4:139200793-139200815 TTGACATGACATAAAGATTCTGG - Intergenic
981200157 4:141971168-141971190 ATGACAATCATTAAAAAGTCAGG + Intergenic
981355037 4:143780039-143780061 ATGAAATTAAATAAAAATTGTGG - Intergenic
981355161 4:143781490-143781512 TTGTCTTACAATAAAAAATCTGG + Intergenic
981395589 4:144244811-144244833 ATGACAATCATTAAAAAGTCAGG - Intergenic
982525303 4:156470485-156470507 TTGACCTTCAATAATATCTCAGG - Intergenic
983005345 4:162477642-162477664 ATGGCAATCATTAAAAATTCAGG - Intergenic
983425338 4:167576806-167576828 TTGATATTAAATGAAAATACAGG + Intergenic
984146981 4:176073773-176073795 ATGACAATCATTAAAAAGTCAGG - Intronic
984485176 4:180359035-180359057 ATGACAATCATTAAAAAGTCAGG - Intergenic
984607379 4:181800875-181800897 TTGACATTCAAGAAATACACCGG - Intergenic
984627970 4:182029897-182029919 TTTATATTGAATAAATATTCAGG + Intergenic
986376076 5:7132497-7132519 TTCACTTTCAACAAATATTCTGG + Intergenic
986645979 5:9916349-9916371 GTTACATTTAAAAAAAATTCTGG + Intergenic
986765951 5:10926742-10926764 ATGGCAATCAATAAAAAGTCAGG + Intergenic
987372266 5:17204083-17204105 GTCACAATCAATAAAACTTCTGG + Intronic
987513314 5:18871827-18871849 TTGATATTCCAGGAAAATTCTGG + Intergenic
988135563 5:27166099-27166121 ATGACAGTCATTAAAAAGTCAGG - Intergenic
988280337 5:29137570-29137592 TTGACATTCAAACCAAATTTTGG - Intergenic
988438420 5:31203916-31203938 CTGACAATCATTAAAAAATCAGG - Intronic
989332111 5:40272042-40272064 ATTAGATTCAATAGAAATTCAGG + Intergenic
989544411 5:42656382-42656404 TTGAAATTAAATAAAAATAGAGG - Intronic
989659421 5:43783599-43783621 TTGACATTCTATAAAATATTTGG - Intergenic
989660941 5:43797087-43797109 ATGACAATCAGTAAAAAGTCAGG + Intergenic
989675784 5:43970743-43970765 TTGGCAATCAGTAAAAAGTCAGG + Intergenic
989798488 5:45504768-45504790 ATGACAATCATTAAAAAGTCAGG - Intronic
989837223 5:46008038-46008060 ATGACAATCATTAAAAAGTCAGG + Intergenic
990706599 5:58536821-58536843 ATGACAATCATTAAAAAGTCAGG - Intergenic
990794254 5:59522011-59522033 TTGAGATTTAAAAAAAACTCAGG + Intronic
990795549 5:59535908-59535930 TTGACATTCAATAAAAATTCTGG + Intronic
991094408 5:62724122-62724144 TTGACAGTCAAACAAAATTGAGG + Intergenic
991119901 5:63000477-63000499 TTGACATGTAATATAAATTTAGG + Intergenic
991726465 5:69540647-69540669 CAGACCTTCAAAAAAAATTCTGG - Intronic
991744715 5:69724745-69724767 ATGACAGTCAATAATAATTGAGG - Intergenic
991752989 5:69830488-69830510 ATGACAGTCAATAATAATTGAGG + Intergenic
991802608 5:70387215-70387237 ATGACAGTCAATAATAATTGAGG + Intergenic
991824095 5:70600059-70600081 ATGACAGTCAATAATAATTGAGG - Intergenic
991832308 5:70705607-70705629 ATGACAGTCAATAATAATTGAGG + Intergenic
991868492 5:71087227-71087249 CAGACCTTCAAAAAAAATTCTGG + Intergenic
991888664 5:71304028-71304050 ATGACAGTCAATAATAATTGAGG - Intergenic
992259138 5:74952657-74952679 TGGAAATCAAATAAAAATTCAGG + Intergenic
992478176 5:77123943-77123965 ACGACATTCAGTAAAAATCCTGG + Intergenic
992756118 5:79907762-79907784 ATGACAATCATTAAAAAGTCAGG + Intergenic
992909203 5:81378805-81378827 ATGACAATCATTAAAAAGTCAGG + Intronic
993773267 5:91958723-91958745 CTGACTTTAAAAAAAAATTCTGG + Intergenic
994225246 5:97244609-97244631 ATTACATTTAATAAAAAGTCAGG + Intergenic
994434396 5:99709062-99709084 ATGGCATTCATTAAAAAGTCAGG - Intergenic
994495507 5:100507364-100507386 ATGACAATCATTAAAAAGTCAGG + Intergenic
994504714 5:100628152-100628174 TTCATATTCAATATATATTCTGG + Intergenic
994830905 5:104783093-104783115 ATGCCAATCATTAAAAATTCGGG + Intergenic
995057054 5:107771588-107771610 TTAACTTTAAATAAAAAGTCAGG - Intergenic
995257396 5:110062793-110062815 TTGACATTAAATGATAACTCTGG + Intergenic
995263063 5:110127981-110128003 ATGACAATCATTAAAAAGTCAGG - Intergenic
996414578 5:123196408-123196430 TTGAAATTCAATAAAAAGTTCGG - Intergenic
996609243 5:125359670-125359692 ATGACAATCATTAAAAAGTCAGG - Intergenic
997304477 5:132827650-132827672 TTGACATTCAGCAAATATTTGGG - Intronic
997903786 5:137794457-137794479 TTCACATTTAATATAAATTTTGG - Intergenic
998675032 5:144397596-144397618 ATGACAATCATTAAAAAGTCAGG - Intronic
998749034 5:145296860-145296882 ATGACAATCATTAAAAAGTCAGG - Intergenic
998751616 5:145328453-145328475 TTGGCAATCATTAAAAAGTCAGG - Intergenic
999471815 5:151861395-151861417 ATGACAATCAATAAAAAGTCAGG - Intronic
999573228 5:152944272-152944294 ATGACAATCATTAAAAAGTCAGG - Intergenic
1000555856 5:162724941-162724963 ATGACAATCATTAAAAAGTCAGG - Intergenic
1000672447 5:164079027-164079049 TTGAATTTCAATAAAAACTCTGG + Intergenic
1000875341 5:166631020-166631042 TTGACATCCAATAAAAAAAAAGG - Intergenic
1001393708 5:171401727-171401749 TTCACAATCACAAAAAATTCAGG - Intronic
1001499042 5:172214246-172214268 TTGACATTAAACACAAATACCGG - Intronic
1001687637 5:173606367-173606389 TTAACATTCTGTGAAAATTCGGG + Intergenic
1003119125 6:3305691-3305713 ATGACTTTCAACAAAAAATCAGG + Intronic
1003286320 6:4736987-4737009 TTGATATTCACAAAATATTCTGG + Intronic
1003988043 6:11457269-11457291 ATGACAATCATTAAAAAGTCAGG + Intergenic
1004260934 6:14107158-14107180 TTGAGCTGCAATAAAAACTCTGG + Intergenic
1004530686 6:16452260-16452282 CTGGCATTCAATAAATATTTAGG + Intronic
1007357289 6:41330946-41330968 TTGACATTAATTCTAAATTCAGG + Intergenic
1007977428 6:46115698-46115720 TTGACATTCATTAAAAATAAAGG - Intergenic
1008229623 6:48969318-48969340 CTGACAGTCAATTAAATTTCAGG - Intergenic
1008580854 6:52905404-52905426 CTAACATTCAATCAATATTCAGG + Intronic
1008942335 6:57060769-57060791 TTCCCATTCAATAACAATTTTGG - Intergenic
1009210971 6:60862929-60862951 ATGACAATCATTAAAAAGTCAGG + Intergenic
1009376993 6:62984875-62984897 ATGGCATTCATTAAAAAGTCAGG - Intergenic
1009695796 6:67100861-67100883 ATGACAATCATTAAAAAGTCAGG + Intergenic
1009717781 6:67423114-67423136 GTGACAATCAGTAAAAAGTCAGG - Intergenic
1009830617 6:68927456-68927478 TTCACTTTTAATAAAAATTTAGG - Intronic
1010039428 6:71363643-71363665 TACACATTTAATAAAATTTCAGG + Intergenic
1010313961 6:74423122-74423144 ATGACAATCATTAAAAAGTCAGG + Intergenic
1010321506 6:74515450-74515472 TTGGCAATCATTAAAAAGTCAGG - Intergenic
1010608895 6:77928457-77928479 ATGACAATCATTAAAAAGTCAGG + Intergenic
1010821914 6:80424258-80424280 TTCAAATGCAATAAGAATTCTGG - Intergenic
1011075359 6:83431827-83431849 TTGACATTCAAATACAATTCCGG - Intergenic
1011302856 6:85894518-85894540 ATGGCAATCATTAAAAATTCAGG - Intergenic
1011386834 6:86807330-86807352 ATGACAATCATTAAAAAGTCAGG - Intergenic
1011486427 6:87846600-87846622 TTGACATTCAAACCAAATTTTGG - Intergenic
1011971567 6:93230889-93230911 TTGACATTCAAATTATATTCTGG + Intergenic
1012111276 6:95238075-95238097 TTGACATAAATTAAAAAATCAGG - Intergenic
1012123393 6:95395319-95395341 ATGGCAATCAATAAAAAGTCAGG - Intergenic
1012596452 6:101046841-101046863 ATGGCATTCATTAAAAATTCAGG - Intergenic
1012607301 6:101173549-101173571 ATGCCATTCCATTAAAATTCTGG - Intergenic
1012692446 6:102331418-102331440 TTGAGATATAATAAAAATTATGG + Intergenic
1012762052 6:103314982-103315004 ATGACAATCATTAAAAAGTCAGG - Intergenic
1013021185 6:106221375-106221397 TTGACATTTGATAAAAGTTTAGG - Intronic
1013136506 6:107287819-107287841 TTAAAATACAATAAAAATTTGGG - Intronic
1013441239 6:110172005-110172027 ATGACAATCATTAAAAAGTCAGG + Intronic
1013632571 6:111999507-111999529 TTGACATTGAAGAAGAATGCTGG - Intergenic
1013715796 6:112959976-112959998 ATGACAATCATTAAAAAGTCTGG + Intergenic
1014277731 6:119405419-119405441 ATGGCAATCATTAAAAATTCAGG + Intergenic
1014352905 6:120366199-120366221 ATGACAATCATTAAAAAGTCAGG + Intergenic
1014421523 6:121252045-121252067 ATGACAATCATTAAAAAGTCAGG + Intronic
1014585070 6:123187937-123187959 ATGACAATCATTAAAAAGTCTGG + Intergenic
1014590165 6:123256500-123256522 ATGACAATCATTAAAAAGTCAGG - Intronic
1014884264 6:126760471-126760493 TTGATATTAAAAAAAAATACAGG + Intergenic
1015038963 6:128693038-128693060 ATCACATTCAAGAAAAATTCTGG - Intergenic
1015087959 6:129318704-129318726 CACACATTCAATTAAAATTCAGG - Intronic
1015289890 6:131526842-131526864 ATGACAATCATTAAAAAGTCAGG - Intergenic
1015386232 6:132627117-132627139 ATGACAATCATTAAAAAGTCAGG - Intergenic
1015466559 6:133554661-133554683 ATGACGATCAATAAAAATCCGGG - Intergenic
1015647918 6:135415482-135415504 TTGGCAATCATTAAAAAGTCAGG - Intronic
1016269860 6:142276177-142276199 TTGCTCTTCAAGAAAAATTCAGG - Intergenic
1016659209 6:146556620-146556642 ATGACAATCATTAAAAAGTCAGG - Intergenic
1016805604 6:148209163-148209185 TTCACACTGAATCAAAATTCAGG - Intergenic
1016985555 6:149892376-149892398 ATGACGTTCATTAAAAAGTCAGG - Intronic
1017405948 6:154118537-154118559 TTGACATTTAAGAAAAACTGAGG + Intronic
1017410638 6:154164185-154164207 TTGAAAATTAATAAAAATTGGGG + Intronic
1018789241 6:167133590-167133612 TTGAATTTCTATAAAAATTTTGG + Intronic
1018985710 6:168635448-168635470 TAGACATGAAATAAAAATGCTGG - Intronic
1020486487 7:8727004-8727026 ATGACAATCATTAAAAAGTCAGG - Intronic
1020614252 7:10438744-10438766 TTAACATCCAATAAAAATACGGG - Intergenic
1020649442 7:10856286-10856308 GTGACATTAAATAAATATTTAGG + Intergenic
1020924441 7:14307594-14307616 TTGACATTCAATACAATATGTGG - Intronic
1020932519 7:14415939-14415961 ATGACAATCATTAAAAAGTCAGG - Intronic
1020998946 7:15303273-15303295 CTGACATTTAATTAAAATTTAGG - Intronic
1021563152 7:21988817-21988839 TGGGCATCCAATAAATATTCAGG + Intergenic
1022618620 7:31958587-31958609 TAGTCATTCAATAAATGTTCTGG + Intronic
1023536020 7:41211897-41211919 TTCACAGTCAATAATAATTTAGG + Intergenic
1023568671 7:41550250-41550272 ATGACAATCATTAAAAAGTCAGG - Intergenic
1024854157 7:53757458-53757480 TTAAAATTTAAGAAAAATTCAGG + Intergenic
1025570253 7:62553351-62553373 ATGGCAATCAATAAAAAGTCAGG + Intergenic
1027019799 7:74803865-74803887 CTGACATTAAAGAAAAATCCTGG - Intronic
1027456932 7:78403668-78403690 ATGACAATCATTAAAAAGTCAGG - Intronic
1027576841 7:79941756-79941778 ATGGCATTCATTAAAAAGTCAGG - Intergenic
1027578033 7:79955604-79955626 TTTACATTCCTTATAAATTCTGG - Intergenic
1027892045 7:83989986-83990008 ATGACAATCATTAAAAAGTCAGG - Intronic
1027914685 7:84301039-84301061 AAAAAATTCAATAAAAATTCAGG + Intronic
1028068116 7:86413849-86413871 ATGGCATTCATTAAAAAGTCAGG + Intergenic
1028410280 7:90523035-90523057 ATGACAATCATTAAAAAGTCAGG - Intronic
1028704072 7:93817333-93817355 TTGACATTCAAACCAAATTTTGG - Intronic
1028789227 7:94834609-94834631 TTTACATTAAATAAAAAGTCTGG - Intergenic
1028822858 7:95232841-95232863 ATGACAATCATTAAAAAGTCAGG + Intronic
1029819781 7:103135375-103135397 TTCACATTCAATAAGATTCCAGG + Intronic
1029859043 7:103549466-103549488 GTGAATTTCAACAAAAATTCAGG + Intronic
1029869064 7:103669341-103669363 TTTGCATTTATTAAAAATTCAGG + Intronic
1029910605 7:104142972-104142994 TTCCCATTCATTAAAATTTCAGG - Intronic
1029910794 7:104145171-104145193 TTCCCATTCATTAAAATTTCAGG - Intronic
1030576152 7:111288740-111288762 ATGGCAATCAATAAAAAGTCAGG + Intronic
1030578655 7:111323463-111323485 ATGACAATCATTAAAAAGTCAGG + Intronic
1030842574 7:114374447-114374469 TTAACATACAATAAATATTAAGG - Intronic
1031139245 7:117923562-117923584 ATGACAATCATTAAAAAGTCAGG + Intergenic
1031314111 7:120235494-120235516 ATGACAATCATTAAAAAGTCAGG - Intergenic
1031501806 7:122527153-122527175 TTCACATTAAGTTAAAATTCAGG - Intronic
1031590790 7:123589988-123590010 ATGACAATCATTAAAAATTCAGG - Intronic
1031700124 7:124914326-124914348 TTGAAATTCCATACAAATTTGGG + Intronic
1031901063 7:127411519-127411541 TTAACATTCAATTATAGTTCTGG - Intronic
1032310002 7:130776880-130776902 TTGACTTTCCATATAAATTTTGG + Intergenic
1033530967 7:142263730-142263752 TTGAAATTAAAAAAAAACTCTGG + Intergenic
1033915975 7:146326404-146326426 CTGACATGGAATAAAGATTCAGG - Intronic
1033922909 7:146417064-146417086 TTGACATTTGATAGAAATTAGGG + Intronic
1033965522 7:146970533-146970555 ATGGCAATCAATAAAAAGTCAGG + Intronic
1034006059 7:147473502-147473524 CTTACATTAAAAAAAAATTCAGG - Intronic
1034370942 7:150595980-150596002 TTAAATTTCAATAACAATTCTGG - Intergenic
1036978537 8:13442677-13442699 ATGACAATCATTAAAAAGTCAGG + Intronic
1037063175 8:14541800-14541822 ATGACAATCATTAAAAAGTCAGG - Intronic
1037073853 8:14687863-14687885 ATGACAATCATTAAAAAGTCAGG - Intronic
1037076015 8:14719522-14719544 ATGACAATCATTAAAAAGTCAGG - Intronic
1038968259 8:32601189-32601211 TTGCAATTCAATAGAAATTTAGG - Intronic
1039539318 8:38350354-38350376 ATGACAATCATTAAAAAGTCAGG - Intronic
1039616739 8:38961106-38961128 TAGAATTTCAAAAAAAATTCTGG - Intronic
1041031556 8:53741526-53741548 TTGGCATTTAATAGAATTTCAGG - Intronic
1041282766 8:56228265-56228287 TTTAGATTAAATAAAAGTTCTGG + Intergenic
1041336648 8:56792873-56792895 TTGTCAGTTAATAGAAATTCTGG - Intergenic
1041424030 8:57700567-57700589 TTGGCAATCAATAAAAAGTCAGG + Intergenic
1042170784 8:65989150-65989172 TTATCATTAAATAATAATTCAGG + Intergenic
1042198970 8:66260609-66260631 TTAAAATTAAATAGAAATTCTGG + Intergenic
1042242782 8:66681600-66681622 TTGACGTTTTATAAAAATACAGG + Intronic
1042479306 8:69285648-69285670 ATGACAATCATTAAAAAGTCGGG + Intergenic
1043630304 8:82322913-82322935 ATGACAATCATTAAAAAGTCAGG + Intergenic
1043713619 8:83452481-83452503 ATGACAATCATTAAAAAGTCAGG + Intergenic
1043743677 8:83845842-83845864 ATGACAATCATTAAAAAGTCAGG - Intergenic
1043748258 8:83903229-83903251 TTGGCAGTCATTAAAAAGTCAGG + Intergenic
1043756939 8:84015538-84015560 TTGGCAATCATTAAAAAGTCAGG - Intergenic
1043785390 8:84391950-84391972 CAGTCATCCAATAAAAATTCTGG - Intronic
1043812985 8:84765701-84765723 GTTCCATTGAATAAAAATTCAGG - Intronic
1044292285 8:90486620-90486642 TTGACAATCATTAAAAAGTCAGG - Intergenic
1044766233 8:95578057-95578079 ATGACAATCATTAAAAAGTCAGG - Intergenic
1044905549 8:96997571-96997593 TTGACATAAAAAAAAATTTCAGG + Intronic
1045614495 8:103892808-103892830 TTCACTTTCAATTAAAATTTGGG - Intronic
1045805513 8:106156315-106156337 TTGTCATTCAATAATACTACAGG + Intergenic
1045811681 8:106228404-106228426 TTGGCATTCAATAAATATCAAGG - Intergenic
1046022265 8:108679416-108679438 ATGACAATCATTAAAAAGTCAGG - Intronic
1046474408 8:114722666-114722688 CTGACATTAAAGAAAAATCCAGG - Intergenic
1046880781 8:119306105-119306127 ATGACAATAATTAAAAATTCAGG - Intergenic
1046885141 8:119358617-119358639 TTTACATTCAATAGAAGTTCTGG - Intergenic
1047161687 8:122387618-122387640 ATGAAATTAAATAAAAATTCAGG - Intergenic
1047359227 8:124152596-124152618 TTTACATTAAATAAAAAGACTGG - Intergenic
1049136211 8:140902628-140902650 ATGGCAATCATTAAAAATTCAGG - Intronic
1050583689 9:7087629-7087651 CTTACATTCAGTTAAAATTCTGG + Intergenic
1051452293 9:17210723-17210745 ATGACAATCATTAAAAAGTCAGG - Intronic
1051714097 9:19963691-19963713 ATGACAATCATTAAAAAGTCAGG + Intergenic
1051940824 9:22503543-22503565 ATGACAATCATTAAAAAGTCAGG - Intergenic
1052052221 9:23861280-23861302 ATGACAATCATTAAAAAGTCAGG - Intergenic
1052252571 9:26416198-26416220 TTGATATTCAACAACAGTTCAGG + Intergenic
1052426251 9:28308904-28308926 ATGGCATTCATTAAAAAGTCAGG + Intronic
1052429990 9:28353475-28353497 ATGGCATTCATTAAAAAGTCAGG + Intronic
1052554191 9:29992580-29992602 ATGACAATCATTAAAAAGTCAGG - Intergenic
1052604473 9:30681547-30681569 ATGACAATCATTAAAAACTCAGG + Intergenic
1052888465 9:33672799-33672821 ATGGCAATCAATAAAAAGTCAGG + Intergenic
1053568530 9:39279267-39279289 ATGACAATCATTAAAAAGTCAGG + Intronic
1054128616 9:61339740-61339762 ATGACAATCATTAAAAAGTCAGG - Intergenic
1054898511 9:70341711-70341733 ATGGCATTCATTAAAAAGTCAGG + Intronic
1054999582 9:71433846-71433868 ATGACATTCTATGATAATTCAGG - Intronic
1055177420 9:73336914-73336936 ATGACAATCATTAAAAAGTCAGG + Intergenic
1055352227 9:75401592-75401614 TTGTCATTTAAAAATAATTCAGG + Intergenic
1055389667 9:75806725-75806747 TGGAAATTCAACAAGAATTCAGG + Intergenic
1055421248 9:76145270-76145292 TTTACATTCAACAAAAATGATGG + Intronic
1056028764 9:82528737-82528759 ATGACAATCATTAAAAAGTCTGG + Intergenic
1056040231 9:82658192-82658214 TTGGCCTTAATTAAAAATTCAGG - Intergenic
1057279742 9:93701140-93701162 TTGACACTCAAGAAACATTTGGG - Intergenic
1057883720 9:98812288-98812310 TTGTCATTAAAAAAAAATCCAGG + Intronic
1058353253 9:104052220-104052242 ATGGCATTCATTAAAAAGTCAGG + Intergenic
1059893222 9:118829184-118829206 TAGACAATCAACAAAAATACAGG - Intergenic
1060037928 9:120274230-120274252 CTGACAATCATTAAAAAGTCAGG + Intergenic
1186119232 X:6340841-6340863 TTGTCATTTAATAAGAATTCTGG + Intergenic
1187146409 X:16641397-16641419 TTGGTATTCAAGAAATATTCTGG + Intronic
1187521294 X:20016644-20016666 TTGTCATTCAATAAGAATGATGG - Intronic
1188189153 X:27152977-27152999 TTGACATTCAGTAATGGTTCTGG - Intergenic
1188337069 X:28949607-28949629 ATGACAATCATTAAAAAGTCAGG - Intronic
1188455920 X:30365713-30365735 TGAACATTCAACAAAAATTTAGG - Intergenic
1188958802 X:36465863-36465885 ATGACAGTCATTAAAAAGTCAGG - Intergenic
1189942255 X:46136836-46136858 TTGATATTCAATAAATATTTTGG - Intergenic
1190600098 X:52082938-52082960 TTTATATTCCATATAAATTCTGG + Intergenic
1191024646 X:55900461-55900483 ATGACAATCATTAAAAAGTCAGG + Intergenic
1191647469 X:63497561-63497583 ATGGCAATCATTAAAAATTCAGG + Intergenic
1191935059 X:66418449-66418471 ATGACAATCATTAAAAAGTCAGG - Intergenic
1192009998 X:67259160-67259182 ATGACAATCATTAAAAAGTCAGG + Intergenic
1192255965 X:69459208-69459230 ATGACAATCATTAAAAAGTCAGG - Intergenic
1192521200 X:71802900-71802922 ATGACAATCATTAAAAAGTCAGG + Intergenic
1192532950 X:71904981-71905003 ATGGCAATCATTAAAAATTCAGG - Intergenic
1192674130 X:73176826-73176848 ATGACAATCATTAAAAAGTCAGG + Intergenic
1192826406 X:74701179-74701201 ATGACAATCATTAAAAAGTCAGG + Intergenic
1192870979 X:75183691-75183713 ATGGCAATCATTAAAAATTCAGG - Intergenic
1192933492 X:75833932-75833954 ATGACAATCATTAAAAAGTCAGG - Intergenic
1193009544 X:76660940-76660962 ATGACAATCATTAAAAAGTCAGG - Intergenic
1193263209 X:79435199-79435221 TTATAATTCAATAAAAACTCTGG + Intergenic
1193412391 X:81180522-81180544 ATGACAATCATTAAAAAGTCAGG + Intronic
1193415840 X:81222841-81222863 ATGACAATCATTAAAAAGTCAGG - Intronic
1193595532 X:83440130-83440152 TTTACATTCTTTAAAGATTCTGG + Intergenic
1193669534 X:84367323-84367345 ATGGCAATCATTAAAAATTCAGG + Intronic
1193720915 X:84986449-84986471 ATGGCATTCATTAAAAACTCTGG - Intergenic
1193910575 X:87301349-87301371 TGGAGACTCAGTAAAAATTCTGG - Intergenic
1194566707 X:95498123-95498145 TTTATATACAATAAAAATTAAGG + Intergenic
1194811753 X:98396147-98396169 ATGACAATCATTAAAAAGTCAGG + Intergenic
1194825724 X:98560759-98560781 ATGACAATCATTAAAAAGTCAGG - Intergenic
1195084179 X:101398708-101398730 TTGACATTCAAGGTAAATACAGG - Intronic
1195163216 X:102191728-102191750 ATGGCAATCATTAAAAATTCAGG - Intergenic
1196177398 X:112654601-112654623 TTTATATTTATTAAAAATTCTGG + Intronic
1196707593 X:118728973-118728995 TTGTCAGTCAATAATTATTCAGG + Intronic
1197142621 X:123133039-123133061 TTGGCAATCATTAAAAAGTCAGG + Intergenic
1197882807 X:131187108-131187130 ATGACATTAAATAAAAAATAAGG - Intergenic
1197931135 X:131697531-131697553 TTGGCAATCATTAAAAAGTCAGG - Intergenic
1198179618 X:134193589-134193611 ATGACAATCATTAAAAAGTCAGG + Intergenic
1198525568 X:137496961-137496983 TTGACACGCAATAAAGATTAGGG + Intergenic
1198622517 X:138529969-138529991 ATGGCATTCATTAAAAAGTCAGG - Intergenic
1199034619 X:143034959-143034981 TTGACATTCTACAGAAATGCTGG - Intergenic
1199073704 X:143507722-143507744 TTGACATTCTATAGAAATGCAGG + Intergenic
1199092708 X:143710989-143711011 TTGACATTCTATAGAAATGCTGG + Intergenic
1200355182 X:155541714-155541736 TTGGCAATCATTAAAAAGTCAGG - Intronic
1200379327 X:155818289-155818311 TTGACATTCCATAAAAAGAAGGG + Intergenic
1201164369 Y:11194737-11194759 ATGAAATTCAACAAAATTTCAGG + Intergenic
1201219754 Y:11757163-11757185 ATGACAATCATTAAAAAGTCAGG + Intergenic
1201490093 Y:14530822-14530844 TTGACTTTCAATAAATATGAAGG + Intronic
1201520348 Y:14866546-14866568 ATGGCAATCAATAAAAAATCAGG + Intergenic
1201521655 Y:14882040-14882062 ATGACAATCAATAAAATGTCAGG - Intergenic
1201561035 Y:15316971-15316993 ATGACTTTCATTAAAAAGTCAGG - Intergenic
1201740307 Y:17317038-17317060 ATGGCAATCATTAAAAATTCAGG + Intergenic
1202056777 Y:20842750-20842772 ATGGCAATCATTAAAAATTCAGG - Intergenic
1202318001 Y:23601495-23601517 ATGACAATCATTAAAAAGTCAGG + Intergenic
1202552765 Y:26068563-26068585 ATGACAATCATTAAAAAGTCAGG - Intergenic