ID: 990795982

View in Genome Browser
Species Human (GRCh38)
Location 5:59541582-59541604
Sequence TATTCCCTATATAAAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990795982_990795988 23 Left 990795982 5:59541582-59541604 CCTCCCCCTTTATATAGGGAATA 0: 1
1: 0
2: 0
3: 12
4: 161
Right 990795988 5:59541628-59541650 ATAATTGTGCAGAAAGCACATGG 0: 1
1: 0
2: 4
3: 39
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990795982 Original CRISPR TATTCCCTATATAAAGGGGG AGG (reversed) Intronic
900033493 1:388123-388145 AATTCCCTATCTAAAGGGTCTGG + Intergenic
900054329 1:618012-618034 AATTCCCTATCTAAAGGGTCTGG + Intergenic
909051314 1:70772002-70772024 TATGCCCTATGTAAATGGAGAGG + Intergenic
911103980 1:94115928-94115950 TGCTCCATATATAAAGAGGGAGG + Intronic
912863974 1:113240343-113240365 AATTACCTATAGAAAAGGGGTGG - Intergenic
914768850 1:150664973-150664995 TATTCCCTATACAAAGGGAAGGG - Intronic
916784714 1:168078146-168078168 TGTTCCCTCTCTAAAGGGGGTGG + Intergenic
917867060 1:179206325-179206347 AATTGCTTATAGAAAGGGGGTGG - Intronic
918629830 1:186703453-186703475 TATGCCCTATGTAAATGGAGAGG - Intergenic
922255849 1:223892279-223892301 AATTCCCTATCTAAAGGGTCTGG + Intergenic
922505752 1:226124491-226124513 TATGCCCTATATAAACAGAGAGG - Intergenic
924337049 1:242995146-242995168 AATTCCCTATCTAAAGGGTCTGG + Intergenic
1063052852 10:2471843-2471865 AATTCTCTTTATAAAGCGGGAGG - Intergenic
1065153587 10:22847412-22847434 TATGCCCTATGTAAATGGAGAGG + Intergenic
1065428478 10:25630300-25630322 TATACCCTATGTAAATGAGGAGG - Intergenic
1070485913 10:76931420-76931442 TATTAGCTATTTAAAGGGGTAGG + Intronic
1071011699 10:80947800-80947822 TACGCCCTATATGAAGGGAGAGG + Intergenic
1071955691 10:90757024-90757046 TATTCCTCAGAAAAAGGGGGCGG + Intronic
1072213573 10:93269106-93269128 TATGCCCTATGTAAATGGAGAGG + Intergenic
1075190080 10:120299233-120299255 TATGCCCTATGTAAATGGAGAGG - Intergenic
1076356151 10:129855192-129855214 TATTCCCGATACGAAGGAGGCGG - Intronic
1077787338 11:5398628-5398650 TAATCCCTATATGTCGGGGGAGG + Intronic
1081139028 11:39474887-39474909 TATGCCCTATATAAATGAAGAGG + Intergenic
1084995954 11:72978567-72978589 TAATCCCCATATATCGGGGGAGG + Intronic
1085479697 11:76810946-76810968 TATGCCCTATGTAAATGGAGAGG + Intergenic
1085845414 11:80059270-80059292 TCTTCCTTATTTAAAAGGGGAGG + Intergenic
1087191136 11:95255826-95255848 TATTTCCAGTTTAAAGGGGGTGG - Intergenic
1087465271 11:98495888-98495910 TATGCCCTATGTAAATGGAGAGG + Intergenic
1087766171 11:102156835-102156857 TATTCCCTAAGGAAAGGGTGAGG - Intronic
1089837392 11:121383199-121383221 TCTTCCCTCTATGAAGGGGCAGG + Intergenic
1092273415 12:7040835-7040857 TATTCACTACATAAAAGGAGGGG + Intronic
1092333156 12:7603959-7603981 TATTCCCTATAGAGAAGGAGGGG - Intergenic
1097436137 12:59553118-59553140 TACTCCCAATATCACGGGGGGGG + Intergenic
1104258545 12:127161428-127161450 TACACCCTATATAAATGGGGAGG + Intergenic
1107002943 13:35572144-35572166 GAATACCTATATAAATGGGGTGG - Intronic
1107530531 13:41278447-41278469 TATGCCCTATGTAAACGGAGAGG + Intergenic
1108488227 13:50950348-50950370 CATTCCCTGTATAAAGGTGGTGG + Intronic
1108893284 13:55290642-55290664 TATTCCCTGTAAAAATGGTGAGG - Intergenic
1109758578 13:66795993-66796015 TATTGCCTATAAAATGGAGGAGG - Intronic
1110489092 13:76081489-76081511 TTTTCCCTACATATAGGGTGGGG + Intergenic
1111175156 13:84584890-84584912 TATTCCAGGTGTAAAGGGGGAGG + Intergenic
1111515418 13:89324874-89324896 TATTGTCTATATAAAAGGAGAGG - Intergenic
1111594739 13:90396864-90396886 TATACCCTATGTAAAGGAAGAGG - Intergenic
1112051431 13:95647143-95647165 TATTCACTATAGCAAGGGCGTGG - Intergenic
1114919854 14:27312696-27312718 TATGCCCTATGTAAATGAGGAGG - Intergenic
1115544001 14:34448549-34448571 TATGCCCTATGTAAATGGAGAGG - Intronic
1118963219 14:70555001-70555023 TATGCCCTATGTAAATGGAGAGG + Intergenic
1120232670 14:81856795-81856817 TACTCCCTATATAAATAGAGAGG + Intergenic
1123137304 14:106040099-106040121 TGTTCTATATATAAAGGGGTAGG + Intergenic
1125092343 15:35809045-35809067 TATTGCAAATATAAAGGAGGTGG + Intergenic
1126183966 15:45812283-45812305 TATGCCCTATGTAAATGGAGAGG + Intergenic
1127773630 15:62249543-62249565 TATGCCCTATGTAAATGGAGAGG - Intergenic
1128834169 15:70795621-70795643 TAATCCCTATAGAACAGGGGTGG - Intergenic
1129230799 15:74196217-74196239 TATTCCATAAATCAAGGAGGTGG + Intronic
1131468752 15:92676767-92676789 TATTACAGATATGAAGGGGGAGG - Intronic
1131564024 15:93469553-93469575 TATTCCTTTTTTAAAGGGGTGGG + Intergenic
1132843997 16:1991670-1991692 TATTCTCTTTATAAATGCGGGGG - Intronic
1135690995 16:24537720-24537742 CATTCAGTATATAAAGGGGTCGG + Intronic
1138521436 16:57573664-57573686 TATGCCCTATGTAAATGGAGAGG + Intronic
1142874684 17:2844469-2844491 TTTTCCTTATGGAAAGGGGGTGG + Intronic
1146517704 17:33502191-33502213 GATTCTCTATAAAAAGGGGATGG + Intronic
1147764499 17:42824467-42824489 TATTCTCTAAATTCAGGGGGCGG + Intronic
1149009316 17:51838686-51838708 TATTTGCTATGTAAAGGGGAAGG - Intronic
1149178639 17:53906029-53906051 CATGTTCTATATAAAGGGGGTGG - Intergenic
1151797663 17:76357219-76357241 TATGCCCTATGTAAATGGAGAGG - Intronic
1152130596 17:78473997-78474019 TACTCCATGTATAAAGGGGCCGG - Intronic
1153832151 18:8933360-8933382 TATGCCCTATGTAAATGGAGAGG - Intergenic
1155723557 18:29050195-29050217 TATTCCCTATTTAATAGTGGTGG - Intergenic
1160109355 18:76011299-76011321 TGTTCCCCATATTAAGGGGTAGG + Intergenic
1160507379 18:79434656-79434678 CATTCCCTAAATAACGGGGCTGG - Intronic
1168402464 19:56093258-56093280 TATTCCATAGATACAGGGGATGG + Intronic
925569657 2:5295542-5295564 TATTGCCTTTAAAAAGGGGGAGG + Intergenic
927534067 2:23838218-23838240 CATTCAAGATATAAAGGGGGTGG + Intronic
931328342 2:61251874-61251896 TATACAGTATATCAAGGGGGCGG - Intronic
943377897 2:187103414-187103436 TATTCCCTACAGATAAGGGGGGG - Intergenic
1170006433 20:11674862-11674884 TATAAACTATATAAAGGTGGTGG + Intergenic
1171505077 20:25626691-25626713 TTTTCCCTATCTATAGGAGGAGG - Intergenic
1171593195 20:26634677-26634699 TATCCTTTATATAAAGGAGGAGG - Intergenic
1173984983 20:47254115-47254137 TATTCCCGATATAGAAGGGCAGG - Intronic
1177365701 21:20133045-20133067 TATGCCCTATGTAAATGGAGAGG - Intergenic
1177534250 21:22403316-22403338 TATGCCCTATGTAAATGGAGAGG - Intergenic
1178018202 21:28376885-28376907 TATTCCCTACATAAATGGAGAGG - Intergenic
949340662 3:3027084-3027106 TATTCTCAACGTAAAGGGGGTGG - Intronic
949904144 3:8844381-8844403 TACTTCCTTTATCAAGGGGGAGG + Intronic
950824154 3:15798593-15798615 TATTCCCTATCCAAATGGGAAGG - Intronic
951842012 3:27044388-27044410 TATGCCCTATTTAAATGGAGAGG + Intergenic
953086382 3:39672039-39672061 TAATGCCTAAATAAAGGGAGGGG + Intergenic
954197345 3:49004608-49004630 TTTCCACTAAATAAAGGGGGCGG - Intronic
955628969 3:60951826-60951848 TTTTCCCTAAATAAAGGGAAAGG + Intronic
957402153 3:79730243-79730265 TAGTCCCTAAATGAAGGGAGGGG + Intronic
958044619 3:88268389-88268411 TTTTCTCTATATAAAAGGAGTGG - Intergenic
958627985 3:96650755-96650777 TATGCCCTATGTAAATGGAGAGG + Intergenic
958783138 3:98566666-98566688 TTTGCCCTTTATAAAGTGGGTGG + Intronic
960840492 3:121954105-121954127 TATGCCCTATATAAATGGAGAGG + Intergenic
962272094 3:133984761-133984783 TATTGCCTAAATAATGGGGAAGG - Intronic
966404963 3:179587247-179587269 TATACTGTATATAAAGGGGGAGG + Intronic
968386050 4:139494-139516 TATGCCCTATGTAAATGGAGAGG - Intronic
968772068 4:2513801-2513823 TACTTCATATATAAATGGGGTGG - Exonic
970785029 4:19784972-19784994 TAATCCCTATATGTTGGGGGAGG - Intergenic
972238133 4:37158043-37158065 TATGCCCTATATAAATGAAGAGG - Intergenic
972822223 4:42714789-42714811 TATGCCCTATGTAAATGAGGAGG + Intergenic
973183034 4:47291823-47291845 TATTTCCTAGATACAGTGGGGGG - Intronic
975104714 4:70554558-70554580 TATCCAATATATACAGGGGGTGG - Intergenic
977349624 4:95865306-95865328 TATTCTCTTTATAAAGTGGAGGG + Intergenic
977399479 4:96513801-96513823 TATTCCAAACATAAAGGAGGAGG + Intergenic
978073431 4:104498928-104498950 TATTCCTTCTATAAAGGATGTGG - Intergenic
979240073 4:118440158-118440180 AATTCCCTATCTAAAGGGTCTGG - Intergenic
979756953 4:124352710-124352732 TATTCCACATATAGAGGGTGTGG - Intergenic
980301878 4:131006652-131006674 TATGCCCTATGTAAATGGAGAGG + Intergenic
981341185 4:143623500-143623522 TATTCCCTAAATGGTGGGGGGGG - Intronic
981696654 4:147565529-147565551 TATGCCCTATATAAATGAAGAGG + Intergenic
981716746 4:147759585-147759607 TGTTTCCTTTTTAAAGGGGGGGG - Intronic
981780113 4:148419894-148419916 TATTCCCTATTTAAATAGGTTGG - Intronic
981989638 4:150902496-150902518 TATGCCCTATGTAAATGGAGAGG - Intronic
983369928 4:166844260-166844282 CATACCCTATTTAAAGGTGGGGG - Intronic
984029152 4:174581829-174581851 TATACCCTATATAAATGTGATGG - Intergenic
985101688 4:186464320-186464342 AATTTCCTTTATAAAAGGGGAGG + Intronic
985226430 4:187765957-187765979 TATGCCCTATGTAAATGGAGAGG - Intergenic
986369847 5:7068983-7069005 TATGCCCTATGTAAATGGAGAGG + Intergenic
987870852 5:23614878-23614900 TATGCCCTATGTAAATGGAGAGG + Intergenic
989488516 5:42021702-42021724 TTTTCCCTTTATAAAGGGACTGG + Intergenic
990795982 5:59541582-59541604 TATTCCCTATATAAAGGGGGAGG - Intronic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
993321690 5:86477511-86477533 TATACCCTATATAAATGAAGGGG + Intergenic
994224385 5:97235497-97235519 GATTCCCTATTTAATGGTGGTGG - Intergenic
994521381 5:100841463-100841485 TATGCCCTATGTAAATGGAGAGG - Intronic
996596100 5:125204454-125204476 TATGCCCTATGTAAATGGAGAGG - Intergenic
1002740327 5:181430745-181430767 AATTCCCTATCTAAAGGGTCTGG - Intergenic
1002784176 6:389046-389068 AATTCACTCTTTAAAGGGGGGGG - Intergenic
1003251177 6:4430318-4430340 TATTCCTTACATGAAGCGGGTGG - Intergenic
1004003293 6:11615393-11615415 TATTCCCTGTATCTAGGGTGGGG - Intergenic
1005846880 6:29788712-29788734 TAATCCCTATGTATCGGGGGAGG + Intergenic
1007098331 6:39228201-39228223 TAGTCCCTTTATGATGGGGGAGG - Intronic
1009365562 6:62855239-62855261 TATTCTCAATATACGGGGGGTGG + Intergenic
1014211719 6:118715337-118715359 TAATCCCCACATAAAGAGGGAGG - Intergenic
1014580737 6:123134383-123134405 TATTGCCTAGAGAAAGGGAGAGG + Intergenic
1017703888 6:157102498-157102520 TCTTCCATATTTAAAGGGGAAGG - Intronic
1019245438 6:170706346-170706368 AATTCCCTATCTAAAGGGTCTGG - Intergenic
1027414079 7:77955946-77955968 TAGCCCTTATATAATGGGGGTGG - Intronic
1028084080 7:86615760-86615782 TAATCCCTATATGTAGCGGGAGG + Intergenic
1031132629 7:117850210-117850232 TATTCCCCATAGATAAGGGGAGG - Intronic
1031668773 7:124518010-124518032 TATGCCCTATGTAAATGGAGAGG + Intergenic
1032208601 7:129891369-129891391 TAATCTCTAAACAAAGGGGGAGG + Intronic
1035502687 8:101857-101879 AATTCCCTATCTAAAGGGTCTGG + Intergenic
1039333646 8:36566501-36566523 TATTCCCTCTGTAAAGGGTGAGG + Intergenic
1045288541 8:100812377-100812399 TATTCCCTATGTAAATGAAGAGG + Intergenic
1045549690 8:103160322-103160344 TATGCCCTATGTAAATGGAGAGG + Intronic
1045925262 8:107574460-107574482 TACTCCCTATATTACAGGGGCGG + Intergenic
1047826063 8:128576882-128576904 TGTTTCCAATAAAAAGGGGGTGG + Intergenic
1048954735 8:139526369-139526391 TATTCCCAAGAAAAAGGGAGAGG - Intergenic
1050412405 9:5380856-5380878 TAATCCCTATGTATAGAGGGAGG + Intronic
1050685914 9:8169164-8169186 CCTTCCCTAAATAAAGGAGGAGG - Intergenic
1052511948 9:29433414-29433436 TAATCCCTACATATAGTGGGAGG - Intergenic
1052923701 9:33994477-33994499 TTTTCCCTAAACAAAGAGGGCGG + Intronic
1055344380 9:75319294-75319316 TATTACCTATATAAGATGGGTGG - Intergenic
1056726837 9:89126648-89126670 TATTCCCTGCATCAAGGGTGGGG - Intronic
1057592721 9:96386990-96387012 TTTTGCCTACATAAAGGAGGTGG + Exonic
1060435713 9:123591082-123591104 ACTTCCCTATACAAAGGAGGGGG + Intronic
1060571063 9:124641032-124641054 TATTATCTATAAAATGGGGGTGG - Intronic
1062468820 9:136693192-136693214 TATGCCCTATGTAAACGGAGAGG - Intergenic
1203605635 Un_KI270748v1:55553-55575 AATTCCCTATCTAAAGGGTCTGG - Intergenic
1187944154 X:24410141-24410163 TCTTCCCTGTATAAAGGGGTGGG + Intergenic
1188969979 X:36603268-36603290 TATTCACTATATGATGGGGAGGG - Intergenic
1190507031 X:51136445-51136467 TGTACCCTGTATAAAGTGGGTGG + Intergenic
1192983466 X:76371439-76371461 TATGCCCTATGTAAATGGAGAGG + Intergenic
1193225126 X:78973457-78973479 TATTCCAAAAATAAAGGAGGAGG - Intergenic
1194324679 X:92499365-92499387 TTTTGCCTAGATAAAGGTGGTGG + Intronic
1194351796 X:92830239-92830261 TATGCCCTATGTAAATGGAGAGG + Intergenic
1195256673 X:103097541-103097563 TATGCCCTATGTAAATGGAGAGG - Intergenic
1196400657 X:115312678-115312700 TACTCCCTGTATAAATGGGGAGG + Intergenic
1197894803 X:131301235-131301257 TATTCGTTATATAAATGGGGTGG - Intronic
1199772882 X:150984961-150984983 TCGTCACTATCTAAAGGGGGAGG - Intronic
1200633414 Y:5618562-5618584 TTTTGCCTAGATAAAGGTGGTGG + Intronic
1200660108 Y:5946932-5946954 TATGCCCTATGTAAATGGAGAGG + Intergenic