ID: 990798133

View in Genome Browser
Species Human (GRCh38)
Location 5:59567274-59567296
Sequence CACCTTTAGCAACTGGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990798133 Original CRISPR CACCTTTAGCAACTGGACAT TGG (reversed) Intronic
901970127 1:12901796-12901818 CTCCTTCACCAACTGGAAATAGG + Intronic
902015044 1:13299985-13300007 CTCCTTCACCAACTGGAAATAGG - Intergenic
902383013 1:16061430-16061452 CACCTGAAGCAGCTGGGCATGGG - Intronic
903784237 1:25847144-25847166 TACATTTAGCAGCTGGAAATTGG - Intronic
905744992 1:40408004-40408026 CAACTTTAGCAACTGGATTTGGG - Intronic
907037638 1:51230213-51230235 CACCTTTCGCAGCTGGGCTTAGG - Intergenic
1065271843 10:24041080-24041102 CACATTTATCAACTGTAAATGGG + Intronic
1070864032 10:79695089-79695111 CACCTTTAGAACCTGGGCCTGGG - Intergenic
1071630929 10:87217315-87217337 CACCTTTAGAACCTGGGCCTGGG - Intergenic
1071992095 10:91109476-91109498 CATCTTTTGCATCAGGACATTGG - Intergenic
1075324402 10:121519201-121519223 CTCCATGAGCAACTAGACATGGG + Intronic
1079277165 11:19052043-19052065 CATCCTTAGCAAATGAACATGGG + Intergenic
1079385159 11:19972272-19972294 CACCTTCAGAAACTGTACACAGG - Intronic
1082760676 11:57124131-57124153 CCCCTCTATCAACAGGACATGGG + Intergenic
1085424660 11:76393398-76393420 CACCTACTGCAACTGGACAGGGG + Intronic
1086793725 11:91073532-91073554 CAACTTCAAGAACTGGACATTGG + Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1089041992 11:115460805-115460827 CACTTATATCAACTGGACACTGG + Intronic
1090256131 11:125285936-125285958 CACATTCAGCAACTTCACATTGG + Intronic
1090277854 11:125432228-125432250 CTCCTTTAACAACAGGACAATGG + Exonic
1091697305 12:2636570-2636592 CACCTTTAGCATCAGCAAATTGG - Intronic
1095871505 12:47033346-47033368 CACCTATTGTAACTGGTCATTGG + Intergenic
1097091600 12:56509831-56509853 CAACTTTAGAAGCTGGGCATGGG - Intergenic
1098190301 12:67941043-67941065 CTCCTTTTGCAAATGGACAGTGG - Intergenic
1098626549 12:72678178-72678200 AACCATTTGCAACTGGATATAGG + Intergenic
1100651147 12:96590279-96590301 CACCATTGGCAACTGCAAATAGG + Intronic
1104593532 12:130103935-130103957 CAGCTTTGACAAATGGACATGGG - Intergenic
1105461215 13:20589845-20589867 GACCTATAGCTACTGGATATGGG + Exonic
1112242795 13:97698681-97698703 CAACTTTAGCAACTAGACTGTGG - Intergenic
1113022747 13:105906364-105906386 CACCTGAAGCAACTGGAGCTGGG + Intergenic
1114567540 14:23643682-23643704 CACCCTTAGGAACTGGCCAGGGG + Intronic
1125923717 15:43543572-43543594 CTCCTTTAGCAACTAGATTTTGG - Intronic
1126430724 15:48581070-48581092 CACTTTTTGCAATAGGACATGGG - Intronic
1126935815 15:53706587-53706609 CATCTTTAGCATCAAGACATGGG - Intronic
1133331348 16:4976607-4976629 CACAATTAGCATCTGGAGATGGG - Intronic
1139515399 16:67449704-67449726 CAGCTTTAGCAAATGGAACTGGG - Intronic
1143264694 17:5627551-5627573 CAGCTTCAGCCACTGGACATGGG + Intergenic
1163724211 19:18913335-18913357 CACCTCTAACCTCTGGACATGGG + Intronic
1163871885 19:19828623-19828645 AAACTTTAGCAACTGGACCGAGG - Intergenic
1164028652 19:21380054-21380076 GAACTTTAGCAACTGGACTGAGG + Intergenic
1164094036 19:21988928-21988950 CATATTTATCAACTGGACATGGG + Intronic
1164236627 19:23342917-23342939 CATATTTAGCAAATGGCCATGGG + Intronic
1164288324 19:23842506-23842528 CATATTTAGCAAGTGGTCATGGG - Intergenic
1167099981 19:47398855-47398877 CACATTCAGCAACAGGACACGGG + Intergenic
927966338 2:27271930-27271952 CACCTTTCGCATCTTGACAGAGG - Intronic
929302640 2:40323671-40323693 CCCCCTTAGGAACTGGGCATTGG - Intronic
932270022 2:70401121-70401143 CACCCTATGGAACTGGACATGGG - Intergenic
932322102 2:70829847-70829869 CAGCTTCAGCCACTGGACTTGGG + Intergenic
932322713 2:70833962-70833984 ACCTTTCAGCAACTGGACATTGG + Exonic
936267994 2:111024999-111025021 CACCACTAGCATCTGGATATAGG + Intronic
936327834 2:111520912-111520934 CAACTTTAGAATCTGGATATTGG + Intergenic
938103999 2:128517641-128517663 GAACTTTAGCAACTGGACCAAGG + Intergenic
943700441 2:190983541-190983563 CTCCCTTAACAACTGGCCATTGG + Intronic
1170016645 20:11789338-11789360 CACCCTTATCAACTGTACTTTGG + Intergenic
1172221628 20:33278095-33278117 CACCTTCATCAACTGGACTGTGG + Intronic
1178484277 21:33007459-33007481 CACATTCAGCAACTTGAAATTGG - Intergenic
1181661720 22:24355309-24355331 CACATTTAGCACCTGGATCTTGG - Intronic
950949715 3:16985767-16985789 CACCTTTAGTAAGAGCACATGGG + Intronic
954192608 3:48974716-48974738 CACCATGAGCAACTGGGCACAGG + Intronic
959634566 3:108549688-108549710 CACTTTTAGCCACTGGCTATGGG + Intergenic
964051886 3:152403854-152403876 CAATTTTAGCAAATGGTCATAGG + Intronic
966119378 3:176505577-176505599 CAGTTTTAGCATCTGAACATGGG - Intergenic
967269182 3:187718968-187718990 CACCTTTAGCTGCGGGACCTTGG + Intronic
969134855 4:5021326-5021348 CACCTTTAGCAAGATGACATAGG + Intergenic
973015294 4:45130196-45130218 CACCTTTGGCCACTGGATCTAGG + Intergenic
975265022 4:72353438-72353460 CACAGCTAGCAACTAGACATAGG - Intronic
978493821 4:109337719-109337741 CACCTTTAGAAACTAGAAAAAGG - Intergenic
978668512 4:111216235-111216257 CACATTTAACTCCTGGACATGGG + Intergenic
989115543 5:37948992-37949014 CACCATGGGCAACTGGACCTTGG + Intergenic
989497723 5:42128670-42128692 CACTTTTAGCAAGTGAACATGGG - Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991099358 5:62775727-62775749 GAACTTTAGCAACTGGACCGAGG + Intergenic
991174900 5:63676211-63676233 CATCTTTTGCAATAGGACATCGG - Intergenic
993618684 5:90142972-90142994 CATCTTTAGCTCCTGGACCTTGG - Intergenic
995031945 5:107491136-107491158 CACCATTAGGGACAGGACATAGG + Intronic
997081260 5:130741419-130741441 CACCTTAAGACACTGGCCATTGG + Intergenic
997367829 5:133337043-133337065 CACCTCTGGCAACTGGGCACAGG + Intronic
997368232 5:133339327-133339349 CACCTCTGGCAACTGGGCACAGG + Intronic
998687270 5:144543133-144543155 CACCTTAAGAGACTCGACATTGG - Intergenic
1000301297 5:159958828-159958850 CACTTTTAGAAACTGAGCATTGG - Intronic
1004889849 6:20090049-20090071 CACCTTTAGTAACAGCACTTTGG - Intergenic
1005560474 6:27035266-27035288 CACATTGAGGAACTGGGCATGGG - Intergenic
1008411578 6:51186609-51186631 CATATTTAACAACTGGAGATTGG + Intergenic
1011767085 6:90633815-90633837 CACCTTTTGAATCTGTACATGGG + Intergenic
1012411625 6:98964990-98965012 CCACTTTAGCAACTGCAGATTGG + Intergenic
1013668102 6:112368055-112368077 CAGATTTTGTAACTGGACATTGG - Intergenic
1023506919 7:40909437-40909459 CACCTTCAGGAACTAAACATTGG - Intergenic
1024230655 7:47360985-47361007 CGCCCGTAGCAGCTGGACATTGG - Intronic
1025717985 7:63981490-63981512 CATATTTAGCAAATGGTCATAGG + Intergenic
1025764131 7:64426355-64426377 CATATTTAGCAAGTGGTCATGGG + Intergenic
1027726111 7:81808024-81808046 TACCTTTAGCAAGTGGACAGTGG - Intergenic
1034986340 7:155517734-155517756 CACTTTTATCCACTGGCCATGGG + Intronic
1036190237 8:6663371-6663393 CACCTTTAGCAACAAGAACTTGG - Intergenic
1038189625 8:25308104-25308126 CACTATAAGCAACTGCACATCGG - Intronic
1039678842 8:39706005-39706027 CATCTTTAGCAGTTGGAAATGGG + Intronic
1046511457 8:115209616-115209638 CATCTTCAGCAACTGTACTTTGG + Intergenic
1048830263 8:138469551-138469573 CACCTATTACAACTGGACAATGG + Intronic
1051715453 9:19978269-19978291 CATCTTTAGCAAAAGGACAGAGG + Intergenic
1056404975 9:86264900-86264922 GAACTTTAGCAACTGGACCGAGG + Exonic
1059114227 9:111586436-111586458 CACCTTGAGCCACAGGACAGAGG - Intronic
1060419158 9:123455167-123455189 CTCCTTTAAGAACAGGACATGGG - Intronic
1061568056 9:131457384-131457406 CCCCTGAAGGAACTGGACATTGG + Intronic
1186747000 X:12580202-12580224 GAGTTTTAGCCACTGGACATGGG - Intronic
1189523035 X:41790236-41790258 CAACTTTAGCACCTGGAGATGGG + Intronic
1193946868 X:87748448-87748470 CAGCTTTACAAACTGTACATCGG - Intergenic
1196044851 X:111246370-111246392 TACCTCCAGCAGCTGGACATGGG - Exonic
1197324868 X:125080571-125080593 CACCTTTAGCTAAGGGACTTAGG - Intergenic
1199790553 X:151151398-151151420 CACCATAAGCAACTGGAAGTTGG - Intergenic
1202261137 Y:22971677-22971699 CACCTTTAGCAACGTGACAGGGG + Intergenic
1202414125 Y:24605418-24605440 CACCTTTAGCAACGTGACAGGGG + Intergenic
1202456659 Y:25064668-25064690 CACCTTTAGCAACGTGACAGGGG - Intergenic