ID: 990798719

View in Genome Browser
Species Human (GRCh38)
Location 5:59574525-59574547
Sequence AATTCAACTCTGATGCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990798719_990798721 9 Left 990798719 5:59574525-59574547 CCAGTCAGCATCAGAGTTGAATT 0: 1
1: 0
2: 0
3: 9
4: 203
Right 990798721 5:59574557-59574579 TTCAATACAGCTTTAAAGCATGG 0: 1
1: 1
2: 1
3: 15
4: 224
990798719_990798722 10 Left 990798719 5:59574525-59574547 CCAGTCAGCATCAGAGTTGAATT 0: 1
1: 0
2: 0
3: 9
4: 203
Right 990798722 5:59574558-59574580 TCAATACAGCTTTAAAGCATGGG 0: 1
1: 0
2: 0
3: 13
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990798719 Original CRISPR AATTCAACTCTGATGCTGAC TGG (reversed) Intronic
901600874 1:10422506-10422528 AATTCACCACTGGTGCTGAGAGG - Intergenic
902525627 1:17055292-17055314 TATTCATCTCTGACGCTTACTGG + Intergenic
908522100 1:64954209-64954231 AATTCAAATCTGAGGCTCTCTGG - Intronic
909316921 1:74233396-74233418 AATTCAACTGAGTTGCTGATTGG + Intronic
909777463 1:79499779-79499801 AATTGAACTCTGACCCTCACTGG + Intergenic
910821655 1:91356992-91357014 AATTCAGTTGTGATGCTGTCTGG - Intronic
912300527 1:108511419-108511441 ACTTCACCTCTGTGGCTGACTGG + Intergenic
913383677 1:118236674-118236696 AATTCAGCTCTGAATCTGTCTGG - Intergenic
917111478 1:171553065-171553087 AATTCAGCTCTGAATCTGTCTGG + Intronic
918612503 1:186508998-186509020 AATTCAACTGTGAATCTGTCTGG + Intergenic
918616277 1:186547906-186547928 AATTCCACTCTGAATCTGTCTGG + Intergenic
922976151 1:229785158-229785180 AATTCAAGTCTGATGCACACTGG - Intergenic
923671019 1:236041421-236041443 AAACCAACTCTGAAACTGACGGG + Intronic
923999781 1:239537598-239537620 AATTCAATTCTGAACCTTACTGG - Intronic
924850471 1:247824135-247824157 CAGTGAACTCTGATGCTGGCTGG - Intergenic
924877840 1:248125280-248125302 AATTCAACTGTGAACCTGTCTGG + Intergenic
1063665210 10:8056516-8056538 AATGGAATTCTGATGCTGAAGGG + Intronic
1063912704 10:10848639-10848661 ATTTCCTCTCTGATGCTGAAAGG - Intergenic
1068741750 10:60481399-60481421 AATTCCATTCTGCTGCTGCCAGG - Intronic
1068853859 10:61776503-61776525 AATTAAACACTGCTTCTGACTGG + Intergenic
1070052812 10:72905569-72905591 AAAGCATCTGTGATGCTGACAGG - Intronic
1070465183 10:76714840-76714862 AATTCAGCTGTGAATCTGACTGG - Intergenic
1072438445 10:95434158-95434180 GATTCGCCTCTGATGCTCACCGG - Intronic
1073805145 10:107089685-107089707 GATTTAAGTCTGATGCTGTCAGG + Intronic
1078798973 11:14623827-14623849 CATTGATCTCTGTTGCTGACAGG - Intronic
1078906719 11:15694455-15694477 AATTTAACCATGATGCTGGCTGG + Intergenic
1079310737 11:19363631-19363653 AATTCAATTCTGATGCTATCTGG + Intronic
1079725537 11:23876224-23876246 AAGTGAACTTTGATGGTGACTGG - Intergenic
1080225337 11:29953795-29953817 AATTCAACTATGAATCTGTCTGG - Intergenic
1080263444 11:30375320-30375342 AATTCAATTCTGACACTGTCTGG - Intergenic
1080305331 11:30828892-30828914 AATTCATCTCCAATGCTGCCTGG - Intergenic
1080442693 11:32309983-32310005 AATTAGACTCAGATGCTGTCCGG + Intergenic
1081249211 11:40808999-40809021 TATTCCTCTCTGATGCTCACTGG + Intronic
1086050081 11:82579049-82579071 AATTCAACTGTGATTCTGTCTGG - Intergenic
1086303547 11:85456079-85456101 AATTCAACTGTGAATCTGTCTGG + Intronic
1086383336 11:86282757-86282779 TATTCAACTCTGCTGCTGTAGGG + Intergenic
1086409822 11:86533532-86533554 AATTCAACAGTGAAGCTGTCTGG - Intronic
1086738616 11:90339324-90339346 AATATAACTCTAATGCTCACAGG - Intergenic
1087652360 11:100882701-100882723 AATTCAACTGTGAATCTGTCTGG + Intronic
1088520871 11:110698520-110698542 AATTCAACTGTGAATCTGTCTGG + Intronic
1089593942 11:119563644-119563666 AATTCAACTGTGAATCTGTCTGG - Intergenic
1090974591 11:131670804-131670826 AAACCACCTCTGATGCTGCCCGG + Intronic
1092593416 12:9973539-9973561 TATTCAACTCTGGGGCAGACTGG - Intronic
1094764546 12:33577325-33577347 AATTCAGCCCTGAAGCTGTCTGG - Intergenic
1096032159 12:48428706-48428728 AATTCCACTGTGATTCTGCCTGG - Intergenic
1096321642 12:50619362-50619384 AGTTGTACTCTGCTGCTGACTGG - Intronic
1098157786 12:67618173-67618195 AATTCAATTCTGACACTAACTGG + Intergenic
1098686795 12:73432943-73432965 AATTCAGCTGTGAATCTGACTGG + Intergenic
1100480172 12:94970308-94970330 AAGTCATCTCTGAGGCTCACTGG - Intronic
1101290665 12:103364870-103364892 AATTCAACTGTGAATCTGCCTGG - Intronic
1102216208 12:111163092-111163114 ATCTCAGCTCTGCTGCTGACTGG + Intronic
1105715623 13:23060791-23060813 ATTTCAAATATGTTGCTGACTGG - Intergenic
1110512335 13:76365829-76365851 AATTCACCTGTGATGCTATCTGG - Intergenic
1112607207 13:100918570-100918592 AACTCACTTCTGCTGCTGACAGG + Intergenic
1116498457 14:45591201-45591223 AATTCAACTGTGAATCTGTCTGG - Intergenic
1117511679 14:56457940-56457962 AATTCAACTGTGAATCTGTCTGG - Intergenic
1122526891 14:102392864-102392886 ATTCAAACTCTGATGCTGAATGG + Intronic
1130650230 15:85758272-85758294 ACTTCACCTCTGCTGCTGTCTGG + Intergenic
1133798558 16:9066312-9066334 AATGCAATTCTGATGCTGCCCGG - Intergenic
1135718073 16:24790281-24790303 AATGCAACTCTAATGCAGCCTGG + Exonic
1136508921 16:30723921-30723943 GAGTCAAGGCTGATGCTGACGGG - Exonic
1140602561 16:76495036-76495058 ACTGCAATTGTGATGCTGACCGG + Exonic
1141451500 16:84106635-84106657 ACTTCAGCTTTGATTCTGACTGG + Intronic
1141802394 16:86319727-86319749 AATTGAACTCTGCTCCTCACTGG - Intergenic
1142910508 17:3086121-3086143 AATTCAACTGTGAATCTGTCTGG + Intergenic
1144387310 17:14760873-14760895 AGCTCAACTCTGCTGCTGACTGG - Intergenic
1146055691 17:29579862-29579884 AAGTCATCTCTGCTGCTTACTGG - Intronic
1149810959 17:59671193-59671215 AATTCACCTCTAATCCTGGCTGG - Intronic
1154064672 18:11095942-11095964 AATTAAATTCAGATGCTGTCAGG + Intronic
1155637681 18:27975185-27975207 TACTCAAGTCTGTTGCTGACTGG - Intronic
1155641169 18:28017216-28017238 AATTCAACTGTGAATCTGTCTGG + Intronic
1155691674 18:28632455-28632477 AAAAACACTCTGATGCTGACTGG - Intergenic
1156117396 18:33802441-33802463 AATTTAACTCTGACTCTCACTGG - Intergenic
1156134743 18:34024258-34024280 AATTCAGGTCAGATGCTCACAGG + Intronic
1159630096 18:70739371-70739393 AATTCAGCTGTGAAGCTGTCTGG - Intergenic
1159813062 18:73040109-73040131 AATACAACTCAGAAGCTGAGGGG + Intergenic
1162711386 19:12597326-12597348 TTTTCAACACCGATGCTGACTGG + Intronic
1163075206 19:14884661-14884683 AATTCAGCTGTGAAACTGACTGG - Intergenic
1163976225 19:20855584-20855606 AATTCAGCTCTGAATCTGCCTGG - Intronic
1164072854 19:21785111-21785133 AATTCAAAACTGATACTGAAAGG + Intergenic
1168455719 19:56506901-56506923 AATTCAATTCTGACGCTACCTGG - Intergenic
926929200 2:18019665-18019687 AATTCAACTGTGAATCTGTCTGG + Intronic
930109314 2:47665097-47665119 TATTGAACTCTGATGGGGACAGG + Intergenic
932662376 2:73667101-73667123 AATTCAACTGTGAATCTGTCTGG + Intergenic
933296087 2:80492795-80492817 ACTTCCACTCTGATTCTGAAAGG - Intronic
935173608 2:100629285-100629307 AACTCTACTTTGATGCTGCCGGG + Intergenic
935347121 2:102118598-102118620 AATTCAATTCTGATACTAACTGG - Intronic
935565231 2:104599122-104599144 CAGTTAACTCTGATGCTGGCAGG - Intergenic
936430510 2:112458494-112458516 CATCCATCTCTGTTGCTGACAGG - Intergenic
936554425 2:113481530-113481552 ATTTCAACACTGATGGGGACAGG - Intronic
937481211 2:122261481-122261503 ACTCCATCTCTGCTGCTGACTGG + Intergenic
939135673 2:138290471-138290493 AATTCAACTGTGAATCTGTCTGG - Intergenic
941548689 2:166887119-166887141 AACTAAATACTGATGCTGACAGG + Intergenic
941885951 2:170527574-170527596 AATCAAACTCGGATGCTGGCAGG - Intronic
942451672 2:176112217-176112239 AATTCAACTCTGCTCAAGACCGG - Intronic
943537364 2:189169217-189169239 AACTAAACTCTGAAGCAGACAGG + Intronic
946773338 2:223111933-223111955 AGCCCAACTCTGATCCTGACAGG - Intronic
1168926621 20:1586957-1586979 GTTTTAACTCTGTTGCTGACTGG + Intronic
1171264259 20:23757925-23757947 AATTCAACTGTGAATCTGTCTGG - Intergenic
1171419686 20:25009636-25009658 ATCTCAGCTCTAATGCTGACTGG + Intronic
1172030773 20:31980522-31980544 GATGCAACTCTGATGCTTTCTGG + Intronic
1173239038 20:41276860-41276882 AAATCTATTCTTATGCTGACAGG - Intronic
1177076889 21:16587283-16587305 AAGCCAACTCTAATGCTGTCTGG - Intergenic
1179813775 21:43890067-43890089 AATTCAACTGAGATTCAGACAGG - Intronic
1180055021 21:45353099-45353121 AATCCTACCCTGAGGCTGACAGG - Intergenic
1181373630 22:22438661-22438683 AATTCAACTGTGAATCTGTCTGG + Intergenic
950096067 3:10331392-10331414 AGTGCAATTCAGATGCTGACTGG + Intronic
951883233 3:27499687-27499709 AATTCAATTCTGACACTAACTGG - Intergenic
951939071 3:28057809-28057831 ATTTCAACTCTGCTTCTGTCTGG + Intergenic
952324817 3:32311737-32311759 AATTCAATTCTGACACTAACTGG + Intronic
953837089 3:46356173-46356195 AATTCAACTCTAAGGCTTAGGGG + Intronic
955864374 3:63367322-63367344 AATTCAACAGTGATGCTTAGAGG - Intronic
956063031 3:65367874-65367896 AATTCATCTCTGATACTGCTTGG - Intronic
957640237 3:82844190-82844212 AATTCAGCTCTGAATCTGTCTGG - Intergenic
958703363 3:97621474-97621496 AATACAAATCTGATGCTCAGTGG + Intronic
958929634 3:100195322-100195344 AATTCACCTCTGAAGCTAAGTGG + Intergenic
958983614 3:100754626-100754648 AATGCCACTGTGTTGCTGACCGG + Exonic
959156800 3:102676572-102676594 AATTCAACTAAAATGCTGATGGG + Intergenic
959878070 3:111409993-111410015 AATTCAACTGTGATTCTGTCTGG - Intronic
962129707 3:132659987-132660009 CCTCCAACTCTGACGCTGACTGG - Exonic
962781612 3:138724053-138724075 AATTCAATTTTGATGCTACCTGG + Intronic
963303741 3:143626833-143626855 AATTCAACCCTCTTGCTGCCCGG - Intronic
963417904 3:145022384-145022406 TATTCAATTTTGATGATGACAGG - Intergenic
964289256 3:155157483-155157505 AGTCCAAATTTGATGCTGACTGG - Intronic
966122670 3:176539972-176539994 AATTCAACTGTGAATCTGTCTGG - Intergenic
966726598 3:183114469-183114491 AATTCAATTCTGACACTGCCTGG - Intronic
972800818 4:42474113-42474135 AATACAACTCTGAAGATGTCAGG + Intronic
974373336 4:61045131-61045153 AATGCAAGTCTGATGCTCAGGGG + Intergenic
974728227 4:65824838-65824860 AAATCAGTTCTGATGCTGCCAGG + Intergenic
975536807 4:75459738-75459760 AATTCAATTCTGATGCTACCTGG - Intergenic
978942336 4:114451558-114451580 AATTCAGCTATGAAGCTGTCTGG - Intergenic
979005325 4:115287666-115287688 AATTCAGCTCTGAATCTGTCTGG + Intergenic
979197526 4:117938403-117938425 AATTCAGCTGTGAAGCTGTCTGG + Intergenic
983402785 4:167286562-167286584 AATTCAGCTGTGAAGCTGTCTGG + Intergenic
983487044 4:168344383-168344405 AATTCAACTGTGAATCTGTCTGG - Intergenic
983509057 4:168588031-168588053 AAGTCAAATCTGGTGCTAACTGG + Intronic
984063191 4:175017475-175017497 AATTCCACTCTGATGCAAAGTGG + Intergenic
984144159 4:176040887-176040909 AATTCAACTGTGAATCTGTCTGG + Intergenic
984913792 4:184701485-184701507 GATTCACCTCTGATGCTCAGAGG + Intronic
987932289 5:24417283-24417305 AATTTAACAGTGAAGCTGACAGG + Intergenic
990222124 5:53604411-53604433 AATTCACATCTTGTGCTGACTGG + Intronic
990318308 5:54605119-54605141 AAGTCAGCCCTCATGCTGACTGG - Intergenic
990798719 5:59574525-59574547 AATTCAACTCTGATGCTGACTGG - Intronic
993429762 5:87817188-87817210 AATTCAGCTCTGAATCTGTCTGG + Intergenic
994970802 5:106734129-106734151 AATTCAACTGTGAATCTGTCTGG - Intergenic
995318835 5:110807661-110807683 TATTCAACTCTGAGACTGAGAGG - Intergenic
996616145 5:125443431-125443453 AATTCAGCTGTGAATCTGACTGG - Intergenic
999030519 5:148285476-148285498 AATACAAATATGATGCTGAAAGG + Intronic
1001710761 5:173776119-173776141 GTTTCAACTCTGTTGCTGAGCGG + Intergenic
1004018420 6:11753880-11753902 AATTCAGCCCTGATGATAACAGG - Intronic
1004670004 6:17786724-17786746 AATTCAACTCTGGGGCTCCCTGG + Intronic
1006219207 6:32473667-32473689 TATTGAACTCAGATGCTGATTGG - Intergenic
1006225071 6:32530373-32530395 TATTGAACTCAGATGCTGATTGG - Intergenic
1006231380 6:32589890-32589912 TATTGAACTCAGATGCTGATTGG - Intergenic
1010412093 6:75572446-75572468 AATTCAACTCTGAATCAGTCTGG - Intergenic
1011225472 6:85100547-85100569 AATTCAGCTGTGATTCTGTCTGG - Intergenic
1012169472 6:96001209-96001231 AATTCAACTATGAATCTGCCTGG - Intergenic
1013523691 6:110955413-110955435 CTTTCAAAGCTGATGCTGACGGG + Intergenic
1015200101 6:130569977-130569999 AATTCAGCTCTGAATCTGTCTGG - Intergenic
1015329212 6:131957519-131957541 ACTTCAAATCTGATGATGTCAGG - Intergenic
1023657360 7:42437799-42437821 AATTCAGCTTTGAATCTGACTGG + Intergenic
1027493347 7:78857857-78857879 AATTCAACTGTGATTCCGTCTGG + Intronic
1028502157 7:91531032-91531054 AATTCAGCTCTGAATCTGTCTGG - Intergenic
1028776118 7:94678670-94678692 AATTCAGCTGTGAATCTGACTGG + Intergenic
1029047822 7:97649446-97649468 AATTAAACTGTGATTCTGGCTGG - Intergenic
1029791167 7:102844705-102844727 AATTCAACTCTGACATTAACTGG + Intronic
1030421590 7:109313102-109313124 AATTCAACTGTGAATCTGTCTGG - Intergenic
1030556988 7:111038500-111038522 AAATCAACTATGATCCTGAACGG + Intronic
1030679190 7:112416297-112416319 AATTCCACGATCATGCTGACTGG - Intergenic
1036564518 8:9926907-9926929 AAGCCAACTCTGAGGATGACAGG + Intergenic
1036668626 8:10765135-10765157 AATTAAACTCTCTTGCTGAAGGG + Exonic
1038044187 8:23752395-23752417 AACTCAACCCTGATCCTGCCTGG + Intergenic
1038347321 8:26744384-26744406 AACTCAATTCTGATGCTACCAGG + Intergenic
1038866671 8:31445787-31445809 AATTCAACTCTGACACTAACTGG - Intergenic
1040899057 8:52399041-52399063 AATTCAGCTCTGAAGCCAACTGG + Intronic
1042644648 8:70973066-70973088 AATTCAACTGTGAATCTGTCTGG + Intergenic
1043877805 8:85506153-85506175 AAATCAAGTCTTATGCAGACTGG - Intergenic
1046476434 8:114750754-114750776 AATTCACATCTGCTGCTGATAGG + Intergenic
1047178390 8:122564083-122564105 ATTTCAGCTCTGCTGCTTACCGG + Intergenic
1047697772 8:127419877-127419899 AATTTAACTCTGGTGCTTCCTGG - Exonic
1048658176 8:136566656-136566678 AATTCAACTCTGAAGGCAACTGG - Intergenic
1049898582 9:135655-135677 ATTTCAACACTGATGGGGACAGG + Intronic
1050966119 9:11805087-11805109 AATTCAACTCTGAAGCCATCTGG + Intergenic
1051240724 9:15052974-15052996 AATTCAACTGTGAATCTGTCTGG - Intergenic
1052596716 9:30570842-30570864 AATTCAGCTGTGATTCTGTCTGG - Intergenic
1053554205 9:39118111-39118133 ACTGCAACTGTGATGCTGGCCGG - Exonic
1053741634 9:41145958-41145980 ATTTCAACACTGATGGGGACAGG + Intronic
1054108568 9:61081898-61081920 ACTGCAACTGTGATGCTGGCCGG - Intergenic
1054346846 9:63975440-63975462 ATTTCAACACTGATGGGGACAGG + Intergenic
1054444625 9:65302103-65302125 ATTTCAACACTGATGGGGACAGG + Intergenic
1054485646 9:65719397-65719419 ATTTCAACACTGATGGGGACAGG - Intronic
1054612289 9:67249227-67249249 ACTGCAACTGTGATGCTGGCCGG + Intergenic
1054686710 9:68285342-68285364 ATTTCAACACTGATGGGGACAGG - Intronic
1058029596 9:100180666-100180688 AATTCAACTGTGAATCTGTCTGG - Intronic
1058268703 9:102941491-102941513 AGTTCAACTCTGATCATAACAGG - Intergenic
1061357810 9:130119565-130119587 ATTCCAACTCTGCTGCTCACTGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1061840814 9:133357556-133357578 AATTCCACTCTGAAGCTGGGTGG - Intronic
1061951276 9:133937623-133937645 AATTCATCTCTGCTGCTTGCAGG + Intronic
1186140678 X:6568671-6568693 AAATAAAATCTGATGCTCACTGG - Intergenic
1186811522 X:13193939-13193961 TATTCAACTCTGCTGGTGTCAGG - Intergenic
1189339710 X:40195478-40195500 TATTCAACTCTGCTGCTGTAGGG + Intergenic
1189590950 X:42510569-42510591 AATTCAGCTATGAAGCTGTCTGG - Intergenic
1190092393 X:47450875-47450897 AAGTCAACTCTAATCCTGATGGG - Intronic
1191749336 X:64524512-64524534 AATTCAACTGTGAGTCTGTCTGG - Intergenic
1192135441 X:68594648-68594670 AATTCAGCAGTGAAGCTGACAGG - Intergenic
1193405960 X:81102631-81102653 AATTCAGCTGTGAAGCTGTCTGG + Intergenic
1194009176 X:88536956-88536978 AATTCAACTGTGAATCTGTCTGG + Intergenic
1194505143 X:94724971-94724993 AATTCAACTGTGAGTCTGTCTGG - Intergenic
1197142074 X:123129050-123129072 AATGCAGCTCTGAGTCTGACTGG - Intergenic
1197472477 X:126880596-126880618 AATTTAACTATGATGCTAATTGG + Intergenic
1198893882 X:141429614-141429636 AATTCAATTCTGATACTATCTGG + Intergenic
1199435617 X:147809446-147809468 GATTCAACTCATATGGTGACTGG + Intergenic