ID: 990801713

View in Genome Browser
Species Human (GRCh38)
Location 5:59611481-59611503
Sequence AGGTTGTGATGAGTGTTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990801713_990801715 25 Left 990801713 5:59611481-59611503 CCTTGTAACACTCATCACAACCT 0: 1
1: 0
2: 0
3: 14
4: 191
Right 990801715 5:59611529-59611551 TGAATGCCCGTCTCCACACTAGG 0: 1
1: 0
2: 0
3: 8
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990801713 Original CRISPR AGGTTGTGATGAGTGTTACA AGG (reversed) Intronic
902933904 1:19750667-19750689 AGGAAGTGATGAGTGTTAGAGGG - Intronic
904357609 1:29951003-29951025 GGGTTTTGAGGAGGGTTACAAGG - Intergenic
906388140 1:45389777-45389799 AGGTTGTTATGAGAATTAAATGG + Intronic
907383697 1:54111657-54111679 GGGTTGTCGTGAGGGTTACATGG - Intronic
907396306 1:54192597-54192619 AGGTTGTTATGAGAATTTCATGG - Intronic
907777091 1:57526971-57526993 AGGTTGAGGTGAGTATTAAATGG - Intronic
907965089 1:59321246-59321268 AAGTTGTGATGAGTGCTGTAAGG - Intronic
908301556 1:62765919-62765941 AGGCTGTGATGTGCCTTACAGGG - Intergenic
908811881 1:67989839-67989861 AGTTTGAAATGAGTCTTACAGGG - Intergenic
909664572 1:78118869-78118891 AGGTTGGTATGAGTATTAAATGG + Intronic
913105728 1:115612537-115612559 AGGTGGTGCAGAGTATTACATGG - Intergenic
914853794 1:151335218-151335240 AGATTTTAATGAGTGTTACGGGG - Intergenic
918915719 1:190634344-190634366 AGGTTGTGGTGAATGTTGCTAGG + Intergenic
921257517 1:213355962-213355984 AGGTTGTTATGAGGATTAAATGG + Intergenic
1065103487 10:22355250-22355272 GGATTGTAATGAGGGTTACATGG + Intronic
1065330386 10:24590906-24590928 ACCTTGTGATGACTATTACATGG + Intronic
1066605090 10:37157879-37157901 AAGTTGTGATGAGAGTTCAAAGG - Intronic
1066605797 10:37169017-37169039 AAGTTGTGATGAGAGTTCAAAGG - Intronic
1066606580 10:37180809-37180831 AAGTTGTGATGAGAGTTCAAAGG - Intronic
1066607357 10:37192551-37192573 AAGTTGTGATGAGAGTTCAAAGG - Intronic
1067520949 10:47004918-47004940 AGGGAGAGATGAGTGTTAGAAGG - Intergenic
1067879736 10:50032957-50032979 AGGTTCTGCTGAGAGTAACAAGG - Intergenic
1067892153 10:50146416-50146438 AGGTTCTGGTGAGAGTAACAAGG + Intergenic
1069193427 10:65519365-65519387 AGCTTGTGGTGAATGTTACCAGG + Intergenic
1069853214 10:71423926-71423948 TGCTTGTGATGAGTGCAACAAGG + Intronic
1075658692 10:124178391-124178413 AGGTGGTGCAGGGTGTTACATGG + Intergenic
1078795467 11:14587762-14587784 GGGTTGCTATGAGTGTTAAATGG + Intronic
1078870265 11:15336731-15336753 AGGTTGTGGTGGTAGTTACATGG - Intergenic
1083186757 11:61022135-61022157 AGGTGGTGGTGAGGGTTAGAGGG + Intergenic
1084003351 11:66310710-66310732 AGGTTGTTATGAATCTTACATGG + Intergenic
1085590942 11:77759822-77759844 AGGTTGTGGTGAGAATTAAATGG + Intronic
1087476306 11:98639380-98639402 TGGTTGTGATAAGTTCTACATGG - Intergenic
1091225491 11:133954579-133954601 AGGTGGACATGAGTGTTATAAGG - Intronic
1092908335 12:13122739-13122761 AGGTGGTGATGGGTGCTTCAAGG + Intronic
1094365983 12:29681636-29681658 AGATTGTGGGAAGTGTTACAAGG + Intronic
1095099489 12:38165777-38165799 AGGTTGTGATGAATGTTGCCTGG + Intergenic
1095273008 12:40242915-40242937 AGATTGTGATGATAGTTATATGG + Intronic
1095874600 12:47066981-47067003 AGGTTGTTAGGAGGATTACATGG + Intergenic
1099282943 12:80675915-80675937 AGTTTGTGAAAAGTGTAACAGGG - Intronic
1100202245 12:92311955-92311977 AGGTTGTTATGAGGTTTAAATGG - Intergenic
1102896488 12:116602383-116602405 AGGATGTGATGTGGGTGACATGG - Intergenic
1104584659 12:130038261-130038283 TGGTAGTGATGAGTGCTACCAGG - Intergenic
1104792144 12:131490050-131490072 TGATTGTGATGATGGTTACATGG + Intergenic
1107364401 13:39655224-39655246 AGGTTGTGATGAGTGCTCAGGGG - Intergenic
1107984391 13:45762948-45762970 TAAATGTGATGAGTGTTACAGGG + Intergenic
1108255918 13:48611215-48611237 AGTTTGTGATGAATGTTCCCTGG + Intergenic
1109227838 13:59718072-59718094 AGGTTGTGATAAGTCTGAAACGG - Intronic
1109649993 13:65312052-65312074 AAGTTGTGATAAGTGTTTCATGG - Intergenic
1111925671 13:94460984-94461006 AGGTTGTGCTAAGTGTAGCATGG + Intronic
1113056928 13:106278262-106278284 AGGTGGTGATGGGTGCTACGTGG - Intergenic
1113265208 13:108609038-108609060 AGATTGTGAAGAGTGTTGCTGGG - Intronic
1117688855 14:58284450-58284472 AGGTTGGAATTAGTATTACATGG - Intronic
1118161605 14:63296465-63296487 AGAATCTGATCAGTGTTACAGGG + Intergenic
1120274797 14:82358888-82358910 AGTTTGTAATGAATTTTACACGG + Intergenic
1121568757 14:94930612-94930634 GGGCTGTGGTGAGTGCTACACGG + Intergenic
1123687946 15:22812987-22813009 AGGTTGGGATGAATAATACACGG + Intronic
1130223157 15:82038458-82038480 AGGCAGTGTTGAGTGTTAGAAGG + Intergenic
1131754690 15:95546928-95546950 AGTGTGTGATGAGACTTACAGGG - Intergenic
1132624394 16:883624-883646 AGGATGTGAGGAGGCTTACACGG - Intronic
1133622734 16:7542112-7542134 AGATTGTGATGAATGCAACAAGG + Intronic
1133740308 16:8646372-8646394 TGGTTGTGATGTGTGCTCCAGGG + Exonic
1139120661 16:64012444-64012466 AATTTGTAATAAGTGTTACATGG + Intergenic
1139390132 16:66602073-66602095 TGATTGTCATGAGTGGTACAAGG + Intergenic
1140168233 16:72576733-72576755 AGATAGTTATGAGTGTTATAAGG + Intergenic
1141844256 16:86596378-86596400 AGGTGGTGGTGAGGGTTAAATGG + Intergenic
1203138064 16_KI270728v1_random:1742269-1742291 ATGCTGTGATGAGCCTTACAGGG - Intergenic
1142791887 17:2273072-2273094 AGGCTGTGATGTGTTTTACAGGG + Intronic
1143233934 17:5381757-5381779 TGGTTGGGAAGAGTCTTACATGG - Intronic
1143806583 17:9433538-9433560 AGATTGTGATGATGGTTTCATGG + Intronic
1147899622 17:43775448-43775470 AGGTTGTTATGAGTATTAAATGG + Intronic
1148182126 17:45613743-45613765 AGGGTGTGATGAGTGTTGATGGG - Intergenic
1148266733 17:46231953-46231975 AGGGTGTGATGAGTGTTGATGGG + Intergenic
1149866249 17:60152557-60152579 AGGCTGTGAGGCGAGTTACAGGG + Intronic
1152189204 17:78878351-78878373 AGGTCGTGGTGACTGTTAGAGGG + Intronic
1152496009 17:80672197-80672219 AGGTTTGGCTGAGAGTTACAGGG + Intronic
1152886488 17:82854073-82854095 AGGGTGTGCTGTGTGTTACTTGG - Intronic
1153099650 18:1451903-1451925 AGCTTGTGATGAATGTTGCCTGG - Intergenic
1154114116 18:11596125-11596147 AGGTTGTGATGGGTTTTAAATGG + Intergenic
1158375433 18:56857992-56858014 AGGTAATGATGAGTGTAACAAGG - Intronic
1159630733 18:70746507-70746529 ATGTTGTGATGAGCCTTACATGG + Intergenic
1165098286 19:33422287-33422309 AGATGGTGGTGAGGGTTACAGGG - Intronic
925979210 2:9163769-9163791 AGGTTGTTTTGAGGGTTACCTGG - Intergenic
927176385 2:20411747-20411769 AGGTGGTGATGAGGGTTGCTGGG + Intergenic
931315502 2:61127015-61127037 AGGATGTGATGAGAGTGACTTGG - Intronic
932868905 2:75376394-75376416 ATGTTGTGTTGAGTCTCACATGG - Intergenic
933412031 2:81938609-81938631 CAGTTGTTATTAGTGTTACAAGG + Intergenic
934110573 2:88738498-88738520 ATGTTGTGCTGTGTGTTACAGGG + Intronic
935437832 2:103055950-103055972 AGCTTGTGGTGAATGCTACAAGG + Intergenic
937586423 2:123557103-123557125 AGATTGTGATGATAGTTTCAGGG - Intergenic
938606860 2:132903081-132903103 AGGTTGTTGTGAGGGTCACATGG + Intronic
938975941 2:136479311-136479333 AGGTTGTGATGAAGTTTACCTGG + Intergenic
938998542 2:136706795-136706817 AGGTTAAGGTGAGTGTTATATGG - Intergenic
939561349 2:143736004-143736026 ATGTGCTCATGAGTGTTACATGG - Intronic
942225152 2:173808368-173808390 AAGTTGTGCTGATTGTTTCAAGG - Intergenic
942735805 2:179111437-179111459 AGGAAGGTATGAGTGTTACATGG + Intronic
944358733 2:198825421-198825443 AGGTTCTGATGAGTGTTTGTAGG - Intergenic
947947825 2:234121522-234121544 AGGTTGTGGTGAGTGATAGCTGG + Intergenic
1171939070 20:31307106-31307128 AGATTGTGATGATGGTTTCATGG - Intronic
1172419032 20:34798110-34798132 AGGTTGTGATGAATGCTGCCAGG - Intronic
1173771032 20:45658128-45658150 AGATTGTGATGATGATTACATGG - Intronic
1174540981 20:51289062-51289084 AGGTTGTGTGGAGTGTTGCAGGG + Intergenic
1177872356 21:26589065-26589087 AGATAGTGATAAGTGTTATATGG - Intergenic
1178440488 21:32594196-32594218 ACGTTGTGATGAGGATGACAAGG + Intronic
1180826402 22:18865183-18865205 AGGTATAGATGAGTGTTCCAGGG + Intergenic
1181317690 22:21981406-21981428 GTGTAGTGATGAGTGCTACAAGG - Intronic
1184548940 22:45193864-45193886 AGGTTCTGATGAGTGATAGGTGG - Intronic
950798487 3:15530630-15530652 AGGTTGGGGTGAGTGTGACCTGG - Intergenic
950889512 3:16390960-16390982 AGGTTGTCATGGGGGGTACAGGG - Intronic
952999454 3:38918831-38918853 AAAGTGTGATGAGTGTTATAAGG - Intronic
954681436 3:52348122-52348144 AGCTTGTGATGAGGATTAAATGG - Intronic
958843735 3:99240504-99240526 AGGGAGTGATAAGTGATACAAGG + Intergenic
959215798 3:103448575-103448597 AGCTTGTGGTGAGTGTTGCCAGG - Intergenic
959868501 3:111299918-111299940 AGTTTGTGATGAGTGCTGCCAGG + Intronic
960202212 3:114850486-114850508 AGGTTGTTATGAAGGTTAAATGG - Intronic
964961086 3:162427625-162427647 AGCTTGTGATGAATGTTTCCAGG - Intergenic
965344131 3:167526534-167526556 GGCTTGTGATGAGTGAGACAGGG - Intronic
966558123 3:181286573-181286595 AGGTTCTGAAGAGAGTTAAAGGG + Intergenic
968826277 4:2899997-2900019 AGGATGTGTTCTGTGTTACAGGG + Intronic
968874203 4:3256734-3256756 AGGTTGTGATAAGTGCTGGAAGG + Intronic
969854033 4:9984830-9984852 GGGTTGAGATGAATGTGACATGG - Intronic
970313899 4:14811015-14811037 AGGTTGTCATGAGGATTAAATGG - Intergenic
970642616 4:18084219-18084241 CGATTGTGATCAGTGCTACAAGG + Intergenic
970646229 4:18123340-18123362 AGGTTGTTTTGTGTGTTAAATGG + Intergenic
971010286 4:22426630-22426652 AGATTGTGATAACTGCTACAAGG + Intronic
972021663 4:34323410-34323432 AGCTTGTGATGAATGCTACCTGG - Intergenic
972522738 4:39876164-39876186 AGTTTTTGATGAGTTTTTCAAGG - Intronic
973307170 4:48665816-48665838 ACTTTGTGATGAGTGCTTCATGG - Intronic
975321336 4:73012183-73012205 AAGTTGTGCTGATTGTTCCATGG - Intergenic
976041127 4:80885997-80886019 AGCTTGTGGTGAATGTTACCAGG - Intronic
977863207 4:101991911-101991933 AGGTGGTGGTGAGTATTTCATGG - Intronic
978079206 4:104571370-104571392 AGTTTGTCATGTTTGTTACAGGG - Intergenic
978472142 4:109080651-109080673 GGGTTCTAATGAGTATTACATGG + Intronic
981296248 4:143135255-143135277 AGGATGTGATGAGTATTAAATGG + Intergenic
981809506 4:148757763-148757785 AGGTTTTGATAAGTTTTATAAGG + Intergenic
982892322 4:160871051-160871073 AGGCTGAGGTGAGTGATACAGGG + Intergenic
984946339 4:184971528-184971550 AGGATGTGATGATTTTTAAAAGG + Intergenic
986447308 5:7832460-7832482 AGGTAGTGATGAGTGGTATGAGG - Intronic
987118160 5:14742708-14742730 ATGTTGTGCTGAGTGATTCAAGG - Intronic
987911729 5:24155371-24155393 AGCTTGTGATGAATGCTACCTGG - Intronic
988265289 5:28941708-28941730 AGCTTGTGATGACTGTTACCAGG + Intergenic
990103229 5:52219492-52219514 ATGTCATGTTGAGTGTTACAAGG - Intergenic
990801713 5:59611481-59611503 AGGTTGTGATGAGTGTTACAAGG - Intronic
990827237 5:59914645-59914667 AGGTTTTGAGAAGTGTGACATGG + Intronic
992350851 5:75927739-75927761 TGGTTGTGATGATGGTTTCATGG + Intergenic
992706204 5:79395811-79395833 GGGTTATTATGACTGTTACATGG + Intronic
992838497 5:80664114-80664136 AGACTGTGATGAGTGCCACAGGG + Intronic
992928138 5:81612072-81612094 TGGTTGTGATGATGGTTTCATGG + Intronic
993489462 5:88528539-88528561 TGGTTGTGGTGATTGTTTCATGG - Intergenic
993955959 5:94233583-94233605 AAGTTGTCATGATAGTTACAAGG + Intronic
994971949 5:106750674-106750696 AGATTGTGATGATAGTTATATGG + Intergenic
995667339 5:114557472-114557494 AGGTTATGATCAGTGTAATAAGG + Intergenic
996142835 5:119934207-119934229 AGGTTGTAGTCAGTGTAACAAGG - Intergenic
999756924 5:154671398-154671420 AGGTTGTGATGAGAATTAAGTGG + Intergenic
1000275718 5:159733167-159733189 AGGTGGTGTTGAGTGGAACAAGG - Intergenic
1003258948 6:4498625-4498647 AGCTTGTGATGATGGTTTCATGG + Intergenic
1003259170 6:4501059-4501081 TGGTAGTGATGATGGTTACATGG - Intergenic
1005205818 6:23403326-23403348 AGGATGTGATAAGTGTTATGGGG + Intergenic
1005972217 6:30770257-30770279 TAGTTGTGGTGAGTGCTACAAGG - Intergenic
1008868470 6:56244122-56244144 ATGTTCTGATGAGAGTTACCTGG - Intronic
1012207621 6:96480119-96480141 AGGTTGTTTTGAGTATTACTAGG - Intergenic
1012624001 6:101384179-101384201 AGGTTGAGATGATAGTGACATGG + Intergenic
1012757883 6:103255505-103255527 AAGTTGTGATGAGTATTATACGG + Intergenic
1012814894 6:104010796-104010818 AGTTTGAAATGAGTGTTACTGGG - Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1015870340 6:137769800-137769822 AGGTTGTTATGAGGATTAGATGG + Intergenic
1016143455 6:140642341-140642363 AGGTTGTGCTGAATGTTGTATGG - Intergenic
1016810322 6:148254699-148254721 AGATAGTGATGAGTGTTAGCAGG + Intergenic
1017601263 6:156084319-156084341 TGGTTGTGATGATGGTTTCATGG - Intergenic
1017924781 6:158901477-158901499 AGCTTGTGGTGAATGTTACCAGG + Intronic
1018673446 6:166198303-166198325 AGGTTTTGCTGAGCGTTAGACGG + Intergenic
1020492667 7:8808066-8808088 AGGTTATGATGTGTGTTATGTGG - Intergenic
1021131820 7:16921121-16921143 AGCTTGAAATGAGTCTTACAGGG + Intergenic
1021634134 7:22674655-22674677 AGAGTGTGAAGAGTGATACAGGG + Intergenic
1021923077 7:25506318-25506340 AGCTTGTGTTGAATGTTGCAAGG - Intergenic
1024558723 7:50626296-50626318 AGTTTGAGTTGAGTCTTACATGG - Intronic
1026681919 7:72473339-72473361 AGGTTGTCATGAGGATTAAAGGG - Intergenic
1027227974 7:76256661-76256683 AGATGGTGATGAGAGTGACATGG - Intronic
1027412992 7:77942249-77942271 AAATTGTGATGAGTGCTAAAAGG - Intronic
1028388811 7:90291390-90291412 TGGTTTTGATGAGTTTTACCTGG + Intronic
1030672572 7:112353283-112353305 AGCTGGTGCTGAGTGATACATGG + Intergenic
1031580157 7:123464355-123464377 ACTTTGTGATAAGTGTTATAAGG + Intronic
1033875434 7:145811255-145811277 AGCTTGTGGTGAGTGCTGCATGG - Intergenic
1034852468 7:154507795-154507817 AGCCAGTGATGATTGTTACATGG + Intronic
1037553770 8:20002529-20002551 AGGTGGTTATGATTGGTACATGG - Intergenic
1038337090 8:26654165-26654187 AGGTTGTTGTGAGGGTTAAATGG + Intronic
1039110500 8:34036313-34036335 AGATTGTGGTGATGGTTACATGG - Intergenic
1039636267 8:39169386-39169408 AGTTTGTTTTGAGTGTTAAATGG + Intronic
1047055127 8:121155529-121155551 AGGCTGTTGTGAGGGTTACACGG - Intergenic
1047578109 8:126180806-126180828 ATGTTGTGTTGTGTGTTCCATGG + Intergenic
1047911563 8:129535605-129535627 AGGTTGTTATGAGAATTAAATGG + Intergenic
1053254821 9:36607666-36607688 AGATTATGGTGAGTATTACAAGG + Exonic
1059905777 9:118984201-118984223 CTCTTGTGATTAGTGTTACATGG + Intergenic
1189175633 X:38954701-38954723 AGGTTGTTGTGAGAGTTAAATGG - Intergenic
1193204816 X:78736206-78736228 AGCTTGTGATGAATGCTACCTGG + Intergenic
1194323162 X:92477453-92477475 AGCTTGTGATGATTGATACCTGG + Intronic
1194873634 X:99161872-99161894 AGGTTGGGATGAGGGGTGCAGGG + Intergenic
1196176186 X:112641458-112641480 AGTCTGGGATGAGAGTTACAGGG + Intronic
1196297389 X:114014434-114014456 ATGTTGTGGTGAGGATTACATGG - Intergenic
1197804121 X:130383130-130383152 AGGTTTTGGAGAGGGTTACAGGG + Intergenic
1198956452 X:142136685-142136707 AGATTGTGTTGAATGCTACATGG - Intergenic
1199455156 X:148020246-148020268 AGCTTGTGGTGAATGTTACCTGG + Intronic
1199862439 X:151814031-151814053 GGGTTGTGATGAGGATTACCTGG - Intergenic
1200631259 Y:5590610-5590632 AGCTTGTGATGATTGATACCTGG + Intronic
1200766627 Y:7085674-7085696 AGCTGGTGATGTGTGGTACAGGG + Intronic
1202182790 Y:22153770-22153792 AGGTTGAGATCAGTGTCTCAGGG + Intergenic
1202208569 Y:22432631-22432653 AGGTTGAGATCAGTGTCTCAGGG - Intergenic