ID: 990804091

View in Genome Browser
Species Human (GRCh38)
Location 5:59638421-59638443
Sequence TGTTAGGCATAGAACTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990804091_990804093 9 Left 990804091 5:59638421-59638443 CCTGAGCAGTTCTATGCCTAACA 0: 1
1: 0
2: 0
3: 4
4: 97
Right 990804093 5:59638453-59638475 GTAATACCACCATTAAAAAAAGG 0: 1
1: 0
2: 6
3: 42
4: 538
990804091_990804094 10 Left 990804091 5:59638421-59638443 CCTGAGCAGTTCTATGCCTAACA 0: 1
1: 0
2: 0
3: 4
4: 97
Right 990804094 5:59638454-59638476 TAATACCACCATTAAAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990804091 Original CRISPR TGTTAGGCATAGAACTGCTC AGG (reversed) Intronic
901913455 1:12479411-12479433 TCTTAGGCAGACACCTGCTCGGG + Intronic
909727424 1:78852068-78852090 GGCTAGGCATAGATCTGCTGTGG + Intergenic
921250654 1:213294658-213294680 GGTTGGGCATGGAACTGTTCTGG - Intergenic
921285900 1:213609111-213609133 TGTTAGGAATGGACCTGCTTTGG - Intergenic
1064627658 10:17277736-17277758 TGTTGGGAATAGAACTGGTAAGG - Intergenic
1071436395 10:85651689-85651711 TCCTAGGCAAGGAACTGCTCAGG + Intronic
1076914172 10:133412975-133412997 TGTTAGGTACAGAAACGCTCAGG + Intronic
1088182290 11:107126581-107126603 TGTTAGGAGTACAAATGCTCAGG + Intergenic
1095195162 12:39305757-39305779 TGATAGGCATAGGACTGATTAGG + Intronic
1098418948 12:70270768-70270790 TGTTAGGCATATAACTAACCTGG - Intronic
1100410860 12:94317875-94317897 TGTTTGGCATAGGATTGCTGTGG + Intronic
1103538615 12:121650978-121651000 TGTTAGGCTGAGAAGTGGTCAGG + Intergenic
1103606709 12:122092015-122092037 TGTTTGCCACAGAACGGCTCTGG + Intronic
1107287680 13:38814440-38814462 TGTAATCCAGAGAACTGCTCTGG - Intronic
1107719598 13:43234039-43234061 TGGTAGGGACAAAACTGCTCTGG - Intronic
1108040778 13:46337834-46337856 TGTTTGAAATAGAACTACTCAGG - Intergenic
1117452809 14:55867222-55867244 TGATAGTCATAGAACTATTCTGG + Intergenic
1120560573 14:85987410-85987432 TGTTAGAGATAGAAGTGGTCAGG + Intergenic
1125479128 15:40068633-40068655 TGTTGGACACAGAATTGCTCTGG + Intergenic
1126705446 15:51401371-51401393 TGGTAGGCATTGAACTGGCCTGG - Intronic
1127909433 15:63404062-63404084 TTTTATGCATAGAACGGCTCTGG + Intergenic
1128695033 15:69755383-69755405 TGGTAAGCAAAGAACTGCTTAGG - Intergenic
1131690286 15:94820091-94820113 TGTTGGGCACAGAACTGGTAGGG - Intergenic
1131737268 15:95347044-95347066 TGTTTGGCTTGGAAGTGCTCTGG - Intergenic
1132794754 16:1714271-1714293 TGTTGGGCCAAGCACTGCTCTGG + Intronic
1135013946 16:18908059-18908081 TGTTTGGCATTTAACTGGTCGGG - Intronic
1136485038 16:30566268-30566290 TGTCAAGCATAAAGCTGCTCTGG - Intergenic
1140785230 16:78335045-78335067 TGTTAGACATAGAAATTCTTGGG + Intronic
1144750540 17:17645263-17645285 TGTTAGGAATAATACTGCTATGG - Intergenic
1148174191 17:45549947-45549969 TGTGAAGCCAAGAACTGCTCTGG + Intergenic
1148275071 17:46295500-46295522 TGTGAAGCCAAGAACTGCTCTGG - Exonic
1148297178 17:46513079-46513101 TGTGAAGCCAAGAACTGCTCTGG - Exonic
1148361734 17:47017559-47017581 TGTGAAGCCAAGAACTGCTCTGG - Intronic
1150240207 17:63625152-63625174 TCTTGGGCTTAGAACAGCTCAGG - Intronic
1150405409 17:64896869-64896891 TGTGAAGCCAAGAACTGCTCTGG + Exonic
1151387169 17:73762120-73762142 TGTTAGGAATACAAATTCTCTGG - Intergenic
1155516212 18:26626016-26626038 TGTGAAGCCTGGAACTGCTCTGG + Intronic
1155522422 18:26682221-26682243 TCTGAAGCAAAGAACTGCTCAGG + Intergenic
1159084076 18:63767841-63767863 TGATAGGTATAGAACTATTCAGG + Intronic
1159382435 18:67678486-67678508 TGTCAGGCAGCGAACTGTTCTGG + Intergenic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1166826705 19:45614301-45614323 CGGCAGGCACAGAACTGCTCAGG + Intronic
1166985346 19:46656894-46656916 TGTTAGCCATACAACTACTTGGG - Intronic
928694515 2:33835786-33835808 TGTTAAGCCTATAAATGCTCTGG - Intergenic
930550710 2:52831448-52831470 TATTATGAATAGAACTGCTATGG + Intergenic
931182679 2:59918692-59918714 GGCTAGGCATTGAACAGCTCAGG + Intergenic
931907054 2:66853939-66853961 TGTTACGGAAAGAACTGGTCAGG - Intergenic
932721614 2:74142857-74142879 TGCTATGCATGGAGCTGCTCGGG + Intronic
933752594 2:85612481-85612503 TGTGAGGCCTTGAAGTGCTCAGG + Intronic
937858127 2:126687388-126687410 TGTTAGAAATAGAAATTCTCAGG - Intronic
938794702 2:134707701-134707723 TGTCATGGATAAAACTGCTCTGG + Intronic
940918012 2:159279122-159279144 TGTTATGGATAGCACTGGTCTGG + Intronic
1170044438 20:12070780-12070802 TGGTAGGCATACAACACCTCTGG - Intergenic
1175656687 20:60776899-60776921 ATTTAGGAATAGAACTGCTGAGG + Intergenic
1181471965 22:23145998-23146020 TGTGAGGCATGGCACAGCTCAGG - Intronic
1184321173 22:43743284-43743306 TGAAAGGCACATAACTGCTCTGG + Intronic
949449570 3:4170384-4170406 TGTTAGAAATACAAATGCTCAGG - Intronic
950375114 3:12565058-12565080 TGTTATGCATAGTGCTGCTTTGG + Intronic
955817144 3:62856129-62856151 TGATAGGGACAGAAGTGCTCAGG + Intronic
960527257 3:118724027-118724049 TTTTATGCATACAACTCCTCTGG - Intergenic
962625172 3:137219032-137219054 TGTTAGAAATACAACTTCTCAGG + Intergenic
965213530 3:165828885-165828907 TGTCAGCCATAAGACTGCTCAGG + Intronic
965400635 3:168208657-168208679 AGTTAGGCATGGCGCTGCTCAGG - Intergenic
966125207 3:176568358-176568380 TGTGAGGCATAGAGATGCTTAGG - Intergenic
966527370 3:180934186-180934208 TGTTAGGCAAAGATCTTTTCAGG - Intronic
967278931 3:187803955-187803977 TGGTAGGCATAGGACTCCCCTGG - Intergenic
973663041 4:53127564-53127586 TGTGAGGCATTGAGCTGGTCTGG + Intronic
973994784 4:56447301-56447323 TGTTAAGCATAGATCTGCTTGGG + Intronic
977656539 4:99527883-99527905 TATTAGGCATAAAACTGTTTAGG + Intronic
979408178 4:120340642-120340664 TGTTAGGCATGCAACTGATATGG + Intergenic
984017693 4:174445397-174445419 GGTCAGGCAAAGAACTGCTAGGG + Intergenic
986173948 5:5336149-5336171 TGTTAAGGACAGAACTGCTGAGG - Intergenic
987633026 5:20500582-20500604 TGTGAGGCTTAGATCTGCTTCGG + Intronic
988853835 5:35206390-35206412 AGATAACCATAGAACTGCTCAGG + Intronic
990804091 5:59638421-59638443 TGTTAGGCATAGAACTGCTCAGG - Intronic
990839960 5:60067171-60067193 TGAAAGATATAGAACTGCTCAGG - Intronic
1003144493 6:3498526-3498548 AGTAAGGCAGAGAACTGGTCAGG + Intergenic
1003805014 6:9718211-9718233 TGGTACTCATAGTACTGCTCAGG + Intronic
1005586357 6:27280013-27280035 TGTTCGGCAAAAAATTGCTCGGG + Intergenic
1008608366 6:53162878-53162900 TGTTAGGCATCACACTGATCAGG + Intergenic
1017551071 6:155508022-155508044 TATTAGCAATAGAACTGCCCTGG - Intergenic
1021889739 7:25175853-25175875 TGTTAGTGATGGAACGGCTCTGG - Intronic
1022069943 7:26903215-26903237 TGTAAGGCCTAGCACTGCTCAGG - Intronic
1023671328 7:42580057-42580079 TGTTAGGTATATAAATGCTTAGG + Intergenic
1024125427 7:46290102-46290124 TGTAAGGCATAGAAATCCTTTGG - Intergenic
1024239910 7:47426818-47426840 TGCTGGGGATAGAAATGCTCAGG + Intronic
1026026383 7:66747395-66747417 TGCTAGGCACAGAACAACTCAGG + Intronic
1031795334 7:126167522-126167544 TTTTAGGAATATAACTGCTGTGG - Intergenic
1033101578 7:138477742-138477764 CATTAGGCATAGAAATTCTCAGG + Intronic
1034936740 7:155204818-155204840 TGATAGGAATAGGGCTGCTCTGG + Intergenic
1035075501 7:156174879-156174901 TGGTAGGTAGAGAACTGCTGAGG - Intergenic
1039615391 8:38951216-38951238 TGTTCGGCACAGAACTGCACAGG - Intronic
1045069510 8:98486696-98486718 TTTTAGGCAAATAACTTCTCAGG + Intronic
1046376540 8:113389503-113389525 TGATATGCATAGAAATGCTTAGG - Intronic
1048568970 8:135634308-135634330 TGTTAGACATTTCACTGCTCGGG - Intronic
1050822540 9:9898690-9898712 TATTTGGCATAGAAATGCTATGG + Intronic
1051409117 9:16770584-16770606 TGTTAGATGTAGAACTTCTCAGG - Intronic
1052317940 9:27135791-27135813 AGATAGGCATAGCACTGCACAGG + Intronic
1057594682 9:96404971-96404993 TGTTGGCCATATAACTGCTTTGG - Intronic
1185678667 X:1870078-1870100 TGGTAGACATAGAACTATTCAGG - Intergenic
1187763850 X:22617590-22617612 TGTTAGGAAAAGAATTGATCAGG + Intergenic
1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG + Intronic