ID: 990805953

View in Genome Browser
Species Human (GRCh38)
Location 5:59662094-59662116
Sequence CAGGGTAAAGAGCAAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 410}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990805953_990805961 20 Left 990805953 5:59662094-59662116 CCAGCCTCTTGCTCTTTACCCTG 0: 1
1: 0
2: 2
3: 33
4: 410
Right 990805961 5:59662137-59662159 AGTTCCAACCAGCTGTACTCTGG 0: 1
1: 0
2: 0
3: 5
4: 62
990805953_990805964 26 Left 990805953 5:59662094-59662116 CCAGCCTCTTGCTCTTTACCCTG 0: 1
1: 0
2: 2
3: 33
4: 410
Right 990805964 5:59662143-59662165 AACCAGCTGTACTCTGGGCAAGG 0: 1
1: 0
2: 1
3: 20
4: 178
990805953_990805962 21 Left 990805953 5:59662094-59662116 CCAGCCTCTTGCTCTTTACCCTG 0: 1
1: 0
2: 2
3: 33
4: 410
Right 990805962 5:59662138-59662160 GTTCCAACCAGCTGTACTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990805953 Original CRISPR CAGGGTAAAGAGCAAGAGGC TGG (reversed) Intronic
900197508 1:1384227-1384249 CAAGGGAGTGAGCAAGAGGCAGG - Intergenic
900518973 1:3096549-3096571 CCGGCAAAAGAGGAAGAGGCAGG - Intronic
900632242 1:3643475-3643497 CACGTTAAAATGCAAGAGGCAGG + Intronic
900955184 1:5882450-5882472 AAGGAGAAAGAACAAGAGGCGGG - Intronic
901755204 1:11437299-11437321 CAGAGTAAGGTGGAAGAGGCAGG - Intergenic
902785502 1:18730489-18730511 CAGGGTGCAGAGGAAGAGGGAGG - Intronic
902837808 1:19058165-19058187 GAGGGGGAAGAGAAAGAGGCTGG + Intergenic
903192268 1:21663402-21663424 CAGGGGAAGACGCAAGAGGCTGG + Intronic
903442800 1:23401137-23401159 CAGGCCAAACAGCAAGAGGTGGG - Intronic
903514606 1:23902147-23902169 CAAGGCAGAGTGCAAGAGGCAGG - Intronic
903765154 1:25729272-25729294 CAGGGTGGAGAGCAACAGGGGGG - Intronic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
905069914 1:35216579-35216601 AAGAGAAAAGAGAAAGAGGCGGG - Intergenic
905471632 1:38196567-38196589 CAGGGCAAAGAGGAAGACACAGG - Intergenic
907363998 1:53945366-53945388 CAGGGTCTAGAGGAAAAGGCGGG + Intronic
909154174 1:72049832-72049854 CAGGCTAAACAGCAAAATGCTGG + Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911259825 1:95672479-95672501 CATGGTAAAGTAAAAGAGGCTGG + Intergenic
911374670 1:97037401-97037423 AAGGGGAAAGAGCAAGCGGGAGG - Intergenic
911971238 1:104440516-104440538 CTGGGTAAAAAGCAAGTGGATGG - Intergenic
912449746 1:109761564-109761586 AAGGGCACAGAGCAAGGGGCGGG + Intronic
912451526 1:109770460-109770482 CAGGGCAATGAGGAAAAGGCAGG - Intronic
912463355 1:109852298-109852320 CAGGTTAGAGAACAAGAGGCTGG - Intergenic
912491412 1:110064766-110064788 CCGGGGAAAGAGGAAGATGCAGG + Exonic
912641264 1:111347832-111347854 AAGGGCAGAGAGCAAGAGGGGGG + Intronic
913389033 1:118290207-118290229 CAGGCTCAAGGGCAAGAGTCCGG - Intergenic
914514568 1:148362882-148362904 GAGGGAAAAGAGGGAGAGGCAGG - Intergenic
915289817 1:154875984-154876006 CAGGACACAGAGCAAGAGGTGGG - Intergenic
915588678 1:156858927-156858949 CAGGGTTCTGAGCAAAAGGCAGG + Exonic
915591773 1:156874937-156874959 CAGCGTAGAAAGGAAGAGGCAGG - Exonic
915785570 1:158607509-158607531 CAGGGGGAAGGGCAAGAGGCAGG - Intergenic
916502205 1:165396681-165396703 CAGGGTATACAGCGAGAGGGAGG - Intergenic
916698842 1:167269610-167269632 TATGGTAAAGAGCAAGAGTTGGG + Intronic
917176559 1:172242292-172242314 CAGGGTGAACAGCAAGGGGTGGG - Intronic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917452885 1:175161862-175161884 AAGGGTAATGAGGAAGAGGAAGG - Intronic
917652694 1:177094743-177094765 TTGGGTAATGAGTAAGAGGCTGG + Intronic
918330021 1:183449968-183449990 CAGGGTAAAGGGATAGGGGCTGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919867441 1:201793038-201793060 CAAGGTAAAGGGAATGAGGCCGG - Intronic
919920671 1:202164797-202164819 CAGAGGAGAGAGCAAGGGGCAGG - Intergenic
920006471 1:202836911-202836933 TAGGAGAAAGAGCAAGAGGTGGG + Intergenic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
921906601 1:220501997-220502019 CAGGAACAAGAGCAAGAGGCAGG - Intergenic
921958084 1:221004623-221004645 CTGGGAAAAGAAGAAGAGGCAGG - Intergenic
922368298 1:224886350-224886372 CAGGCTAAGGAGGAAGAGGGAGG - Intergenic
922894342 1:229088771-229088793 CAAGGTAAGGAGAAAGAGGAGGG + Intergenic
923276546 1:232401680-232401702 GAGGGTGAAGAGCAAGTGGGTGG - Intronic
924196805 1:241616164-241616186 AAGGGAATAGAGGAAGAGGCAGG - Intronic
1063577555 10:7275337-7275359 CACGGTGAAGAGAAAGGGGCAGG + Intronic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1063821282 10:9839269-9839291 CAGGGGAAAGGGCAAGAGTGGGG + Intergenic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1066601366 10:37110957-37110979 AAGGGTAGAGAGGAAGAGGCAGG + Intergenic
1067060682 10:43076676-43076698 CAGCGGAAAGGGCAAAAGGCAGG + Intergenic
1067237074 10:44460086-44460108 CTGGGGAGAGAGCATGAGGCTGG - Intergenic
1067769395 10:49112387-49112409 CTGGGTAGAGAGCCAGGGGCTGG + Intronic
1067828272 10:49595275-49595297 CAGTGTGAGAAGCAAGAGGCAGG - Intergenic
1067837883 10:49652791-49652813 CAGGGCAAAGGTCAGGAGGCAGG - Intronic
1070442682 10:76462454-76462476 CTGGGTGAAGAGGAAGAGGATGG - Intronic
1070671364 10:78379840-78379862 CAGGGTAAAGTTCAGGAGCCAGG - Intergenic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071270924 10:84006608-84006630 AAGGAGAAAGAGCAAGAGGGAGG - Intergenic
1071361615 10:84851804-84851826 CAGGGTACTGAGCAAGGGGAAGG - Intergenic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072873681 10:99148864-99148886 CAGAGGGAAGGGCAAGAGGCAGG + Intronic
1074540985 10:114364991-114365013 CAGGATGAAGAGCCAGAGTCCGG + Intronic
1074567649 10:114595811-114595833 CCTGGGAAAGAGCAAAAGGCAGG - Intronic
1074614545 10:115054103-115054125 GAGGGCAAAGAGGAAGAGGAGGG - Intergenic
1075116244 10:119629519-119629541 CAGAGTAAGAAGCAACAGGCTGG - Intergenic
1077225245 11:1436678-1436700 CTGGGTGTAGAGGAAGAGGCTGG + Intronic
1078031154 11:7752623-7752645 CAGAGAAAAAAGCCAGAGGCTGG - Intergenic
1078580900 11:12539026-12539048 CTGGGTAGAAAGCTAGAGGCAGG + Intergenic
1078696111 11:13633721-13633743 CAGGAGAAAGAGCAAGAGTGGGG + Intergenic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079164331 11:18024830-18024852 CTGGGGAAACAGCAAGAAGCTGG - Intronic
1079601425 11:22316346-22316368 CAGGGGAGAGAGAGAGAGGCGGG - Intergenic
1079601533 11:22316748-22316770 CAGGGGAGAGAGAGAGAGGCAGG - Intergenic
1081019158 11:37921823-37921845 GAAGGTAAACAGAAAGAGGCAGG - Intergenic
1081462105 11:43281426-43281448 CAAGGGATAGAGCAGGAGGCAGG - Intergenic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081660761 11:44886944-44886966 CTGTGTGTAGAGCAAGAGGCTGG + Intronic
1085232199 11:74981925-74981947 GAGGCTAAGGAGCAAGAGGTAGG + Intergenic
1085658284 11:78337533-78337555 CAGGGAAAAGAGAAAGAAGGTGG + Intronic
1085777276 11:79378295-79378317 CAGGATAAAGAGCCAGAGAAGGG - Intronic
1086000236 11:81974766-81974788 AAGAGAAAAGAGCAAGAGGGAGG - Intergenic
1088762995 11:112949857-112949879 GAGGGTAAGGAGCAAGAGGTGGG + Intergenic
1088765599 11:112972929-112972951 CACGGAAAAGAGCCAGAGGGAGG + Intronic
1089257862 11:117203481-117203503 GAAGGTAGAGAGGAAGAGGCTGG + Exonic
1089574314 11:119430847-119430869 CAGGGCAAAGAACCACAGGCAGG - Intergenic
1089605225 11:119637854-119637876 CAGGGTACAGAGCTGGAGGTGGG + Intronic
1090659242 11:128870245-128870267 TGGGGGAAAGAGCAACAGGCGGG + Intergenic
1090668740 11:128931324-128931346 TAGTGGAAAGAGGAAGAGGCGGG + Intergenic
1091241186 11:134053544-134053566 AAGAATAAACAGCAAGAGGCAGG + Intergenic
1091284942 11:134403291-134403313 CAGGGATGAGAGCAGGAGGCTGG + Intronic
1091650476 12:2305388-2305410 CAGGGGAAGGAGCACCAGGCTGG - Intronic
1092265543 12:6977803-6977825 CAGGGTGAGGACCCAGAGGCAGG - Intronic
1092755043 12:11755472-11755494 GAGGGCAAACAGCAAGAGCCTGG - Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093691189 12:22111197-22111219 CAGGGCAAAGAAAAAGAGTCAGG - Intronic
1093785967 12:23192660-23192682 TAGGGGAAGGAGGAAGAGGCAGG - Intergenic
1093878545 12:24377636-24377658 CAGTGGAAGGAGCACGAGGCTGG - Intergenic
1094086679 12:26600877-26600899 CAAGGTAAATAGCAAAAGGAAGG - Intronic
1097182544 12:57179603-57179625 CAGGGTTGGGAGCAAGGGGCGGG - Intronic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1098701635 12:73635897-73635919 CAGGGTAAAGAACAAAAGATGGG + Intergenic
1100274307 12:93058019-93058041 CAGGGTCAAGGGCAGGAGGGAGG + Intergenic
1100804521 12:98267579-98267601 GAGGGAAAAGAGCAAGAGAAAGG + Intergenic
1102195396 12:111021752-111021774 CAAGTTCAAGATCAAGAGGCAGG + Intergenic
1103420161 12:120774272-120774294 CATGGGAAAGAGTAAGAGGGAGG - Intronic
1103561353 12:121794703-121794725 CAGGGTGAGGAGTAAGAGGAGGG - Intronic
1104368843 12:128204276-128204298 CTGGGGGAAGAGGAAGAGGCAGG + Intergenic
1104602775 12:130164126-130164148 CAGGGGAATGAGCACGAAGCCGG - Exonic
1106174797 13:27321014-27321036 CAGGGCTGAGAGCAGGAGGCTGG + Intergenic
1106913889 13:34490864-34490886 CCAGGTAAAGAGAAAGAGGAAGG - Intergenic
1107254858 13:38412464-38412486 CTGGGAAAAGAGCCAGAGGTTGG + Intergenic
1107582700 13:41808447-41808469 CAGGAGAAAGAGAGAGAGGCAGG + Intronic
1107649125 13:42526524-42526546 CAGATCAAAGAGAAAGAGGCAGG + Intergenic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1109175199 13:59146468-59146490 CAGAGAAAAGAGCAAGATGATGG + Intergenic
1110787559 13:79548589-79548611 CAGTGTAAAGAGTCAGTGGCGGG + Intronic
1112034797 13:95487040-95487062 CATGCTAAAGAGCAACAGGCTGG - Intronic
1112330642 13:98474749-98474771 CAGGCTAAAGAACAAAAGGCGGG + Intronic
1113522965 13:110953652-110953674 AAAGGTAAAGGGGAAGAGGCTGG + Intergenic
1114366662 14:22034294-22034316 CAGTGTGAACAGGAAGAGGCAGG + Intergenic
1116789628 14:49326745-49326767 CTGGGTAATGGGCCAGAGGCTGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118107172 14:62673027-62673049 GAGCATAAAAAGCAAGAGGCTGG + Intergenic
1118319470 14:64744615-64744637 TGGGGAAAAGAGCAAAAGGCTGG - Exonic
1118509354 14:66453958-66453980 GAGGGTAGAGAGCAAGGGGAGGG + Intergenic
1118583170 14:67325242-67325264 GAGGGTGAAGAGGAAGAGGAAGG - Intronic
1119188743 14:72664086-72664108 CAAGGGAAGGAGCTAGAGGCAGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1121325485 14:93017340-93017362 CAGTGTGAAGTGCAAGTGGCTGG - Intronic
1122406375 14:101503513-101503535 GAGAGAAAAGAGCAAGAGGCCGG - Intergenic
1122982266 14:105197090-105197112 CAGGGTCAGGTGCAAGGGGCAGG - Intergenic
1122999595 14:105286173-105286195 CAGGGTGACGAGGAAGTGGCAGG + Intronic
1123905797 15:24920148-24920170 GAAGGTAAGGAGGAAGAGGCTGG - Intronic
1124843024 15:33262526-33262548 CAGAGGAGATAGCAAGAGGCAGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125359369 15:38849532-38849554 CAAGGTAAAGGCCAAGAGGCAGG + Intergenic
1126097755 15:45101276-45101298 TAGAGAAAAGAACAAGAGGCAGG + Intronic
1127377082 15:58394755-58394777 CAGAGTTGAGAGCAAGGGGCTGG + Intronic
1128054609 15:64690355-64690377 AAGGGTAAAGAGCCAAATGCTGG - Exonic
1128678809 15:69631398-69631420 CAGGCAAAAGGGCCAGAGGCAGG - Intergenic
1128715363 15:69903823-69903845 CAGGGCAGAGAGCAAGATGAAGG - Intergenic
1128870956 15:71154835-71154857 AAGGGAAAATAGCAACAGGCAGG - Intronic
1128877824 15:71216482-71216504 CCAGGTAAAGAGCATGTGGCTGG - Intronic
1130513986 15:84611798-84611820 CAGGCTTATGAGTAAGAGGCTGG - Intronic
1130692212 15:86092560-86092582 CAGGGAAAAGAGCAAAACTCTGG + Intergenic
1131441642 15:92464141-92464163 CAGGGTATACATCAAGAGGCCGG - Exonic
1131692129 15:94838586-94838608 CAGGGTAGAGAGAGAGAGGTGGG + Intergenic
1132020093 15:98353474-98353496 CATGTTGAAGAGCTAGAGGCTGG + Intergenic
1133924094 16:10180433-10180455 CAAGGTGAAGAGTGAGAGGCAGG + Intronic
1134008808 16:10836021-10836043 CAGAGTAATGGGCAAGAGGCTGG - Intergenic
1134097645 16:11429266-11429288 CAGGATTAAGAGAAAGAGGGGGG - Intronic
1134482672 16:14632751-14632773 CTGGGTGAAGAGGAAGGGGCGGG + Intergenic
1136983721 16:35081709-35081731 CAGGGCACAGAGCAAGAGGCTGG - Intergenic
1137952467 16:52796749-52796771 AAGAGAAAAGAACAAGAGGCAGG - Intergenic
1138053687 16:53810493-53810515 CAGGATAAGGAGCAAAAGGAAGG - Intronic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1140022530 16:71252125-71252147 AAGAATAAATAGCAAGAGGCAGG + Intergenic
1140492090 16:75346280-75346302 CAGTGTAAAGAGCACCAGGTAGG + Intronic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1141039760 16:80663052-80663074 AGGGGAAAAAAGCAAGAGGCTGG + Intronic
1142850841 17:2704056-2704078 GAGGGCACAGAGCAAGAGGCTGG + Intronic
1143040692 17:4034035-4034057 CAGGCTAAAGAGCAGGTGGGTGG + Exonic
1143060323 17:4195243-4195265 AAGGGTAAAGAGAAAGAACCAGG - Intronic
1143284198 17:5777038-5777060 GAGGGGAAAGAGCACCAGGCTGG - Intronic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143593998 17:7903246-7903268 CAGGGGCAAGAGAAAGTGGCGGG - Intronic
1145787814 17:27605431-27605453 CAGGCTGAGGAGCCAGAGGCTGG + Exonic
1145915307 17:28570601-28570623 CAGGGTATAGGGGAAGAGGTGGG - Intronic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1146916856 17:36683481-36683503 CAGATTACAGAGCAGGAGGCTGG - Intergenic
1147694699 17:42342700-42342722 AAGGTTACAGAGCAAGTGGCAGG + Intronic
1147975656 17:44246889-44246911 CAGGGCAAAGAGAGAGTGGCTGG - Intergenic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148194313 17:45702308-45702330 CAGGGGGTAGGGCAAGAGGCTGG - Intergenic
1148202384 17:45757896-45757918 AAGAGTAAAGAGAAAGAGCCAGG + Intergenic
1148443120 17:47721910-47721932 CAAGGTGAAAAGCAAGAGGGAGG + Intergenic
1148749395 17:49935810-49935832 CAGGGGAAAGAGCCAGAAGCTGG + Intergenic
1149910971 17:60566404-60566426 AAGGGTAAACACCAGGAGGCAGG - Intronic
1151261758 17:72921176-72921198 CATGGGAAGGAGCAAGATGCTGG - Intronic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151700910 17:75742166-75742188 CAGGGTAAAGGGTATGGGGCTGG + Intronic
1152343735 17:79739156-79739178 CAGGGGAAAGAGCCAGGGACAGG + Intronic
1153503333 18:5770602-5770624 TAGGGTAAAGAGGATGAGGGGGG + Intergenic
1155450415 18:25957520-25957542 CAGGGCAAAGAGAAATAGGAAGG - Intergenic
1156196609 18:34781120-34781142 CAGGGGCAGGAGAAAGAGGCAGG + Intronic
1157660786 18:49441774-49441796 AAGGCTAAAGAGCGAGAGACAGG + Intronic
1158823366 18:61186830-61186852 CAGGATGAAGATCTAGAGGCAGG - Intergenic
1159141858 18:64406304-64406326 CAGGGTAGAAAGCAAAATGCTGG - Intergenic
1159949459 18:74471477-74471499 GAGGAGAAGGAGCAAGAGGCAGG - Intergenic
1160094820 18:75861774-75861796 CAGGGTAATGAGTCAGAGGTGGG + Intergenic
1160397535 18:78583395-78583417 CAAGGTCAGGAGCACGAGGCTGG - Intergenic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1162911623 19:13850767-13850789 AAGAGTCAAGAGTAAGAGGCAGG - Intergenic
1164564303 19:29314921-29314943 CAGGGTGGAGAGGAGGAGGCTGG + Intergenic
1164709269 19:30343864-30343886 GAGGGAAAACAGCAAGAGGTTGG + Intronic
1165213550 19:34254094-34254116 GAGGGGAAAGAGTAAGAGGGAGG - Intergenic
1165735748 19:38174376-38174398 CAGGGTGAAGGCCAAGTGGCTGG + Intronic
1165795804 19:38518494-38518516 CAGGGTAAGGGGCCAGAGGCTGG + Intronic
1166632196 19:44416414-44416436 CAGTGTTAAGAGCATGGGGCTGG - Intergenic
1166866150 19:45838623-45838645 GAGGGAAAAGAACAAGATGCTGG + Intronic
1166981381 19:46634268-46634290 GAGGGGACAGGGCAAGAGGCGGG - Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167496678 19:49823331-49823353 GTGTGTAAATAGCAAGAGGCTGG + Intronic
1167564797 19:50249463-50249485 CAGGGGACAGAGCCAGAGACAGG - Intronic
1167749360 19:51370641-51370663 CAGGGTGAAGGGCAAGAAGAAGG - Intergenic
1167978985 19:53256561-53256583 CATTGAAAAGAGAAAGAGGCTGG - Intergenic
1168703004 19:58452637-58452659 CAGGGGAAAGATCAAGAGTCTGG + Intronic
1168705495 19:58468155-58468177 CAGGGGAAAGATCAAGAGTCTGG + Intronic
925094415 2:1184614-1184636 CAGGAGGAAGAGCAAGAAGCAGG + Intronic
926122669 2:10253435-10253457 CAGAGCAAGGAGCGAGAGGCAGG - Intergenic
926541109 2:14182594-14182616 CAGGGTCCAGAGCGAGGGGCTGG + Intergenic
927785675 2:25972838-25972860 GAGGGGAAAGAGAAAGAGGTGGG - Intronic
928015299 2:27650597-27650619 CAGGGTCAAGAGCAAGAAGCTGG - Exonic
928194140 2:29202160-29202182 CAGTGTGAACAGCCAGAGGCAGG - Intronic
928793305 2:34984900-34984922 AAAGCAAAAGAGCAAGAGGCTGG - Intergenic
929345923 2:40884656-40884678 CAGGCAAGAGAGCATGAGGCAGG - Intergenic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
930296048 2:49555299-49555321 CAGAATAAAGAGTAAGTGGCAGG - Intergenic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
933085380 2:78048414-78048436 CAGGGGAAAGGGTGAGAGGCGGG - Intergenic
935654780 2:105412734-105412756 GAGGAGAAAGAGCCAGAGGCGGG + Intronic
935931987 2:108136922-108136944 AAGTGAAATGAGCAAGAGGCTGG + Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
938666710 2:133546269-133546291 CAGGAGAAAGAGAAAGAGTCAGG + Intronic
939176253 2:138751037-138751059 CAGGGTAATGAGAAAGAGATGGG - Intronic
940079727 2:149787527-149787549 CAGGGAAAAGAAGAAGGGGCAGG + Intergenic
940472598 2:154117415-154117437 CAGGGTAAAGGGTGAGAGGAGGG - Intronic
940908718 2:159191479-159191501 GGGGGTAAAGACCATGAGGCCGG + Intronic
941736318 2:168980923-168980945 CAGGGTAGAGAGGAGGAGACTGG - Intronic
942522334 2:176817489-176817511 CAGTCTGAGGAGCAAGAGGCTGG + Intergenic
942602708 2:177657870-177657892 CAGGGTGAAGAGAAAGTAGCTGG + Intronic
942613048 2:177761998-177762020 TAGGGTCAACAGCAGGAGGCGGG + Intronic
943685489 2:190813344-190813366 CAGCCTGAAGATCAAGAGGCTGG - Intergenic
944316332 2:198289370-198289392 GAGGGGAAAGAGAAAGAGACAGG - Intronic
945660652 2:212681496-212681518 GAGGGTAAACATCATGAGGCAGG + Intergenic
946006554 2:216530073-216530095 CCTGGGAAAGTGCAAGAGGCAGG - Intronic
946872591 2:224097698-224097720 AAGGAGAAAGTGCAAGAGGCTGG - Intergenic
947282407 2:228469976-228469998 CAGGGCAGAAAGCAAGAGGTGGG - Intergenic
947948220 2:234124765-234124787 CAGGGACAGCAGCAAGAGGCTGG - Intergenic
947982953 2:234425720-234425742 CAGGTGAAAGAGGAAGAGGCAGG - Intergenic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
1168818967 20:760947-760969 CAGGTCACAGAGCAAGGGGCAGG - Exonic
1170184385 20:13571870-13571892 CAGGGTGAAGACCCTGAGGCTGG - Intronic
1171249115 20:23635373-23635395 CATGTGAAAGAGCAGGAGGCAGG + Intronic
1172602941 20:36196124-36196146 CAAGGTAAAGGGCCAGAGACTGG + Intronic
1173179795 20:40797178-40797200 CAGGGCTAAGAGCATGAGGGAGG + Intergenic
1174043149 20:47714321-47714343 CAGGGCGAAAATCAAGAGGCCGG - Intronic
1174450746 20:50618591-50618613 CAGGGTAAGCAGGCAGAGGCAGG - Intronic
1174834091 20:53839800-53839822 CAGGGTGAGGAGCAGGATGCAGG - Intergenic
1175748292 20:61477027-61477049 CAAGGGAAAGAGCCAGGGGCCGG + Intronic
1177112136 21:17041431-17041453 CAGGGTAAAGTGTAGGAGGGGGG - Intergenic
1177542689 21:22516270-22516292 CAGAGGAAAGAGTTAGAGGCTGG + Intergenic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1178570190 21:33728718-33728740 CAAGGTAAAGGGAAAGAGGTGGG - Intronic
1178742153 21:35211491-35211513 GAGGGTAAGCAGCAAGGGGCTGG - Intronic
1179896054 21:44364361-44364383 CTGGGGCAAGAGCAGGAGGCTGG + Intronic
1180192417 21:46172304-46172326 TGGGGTGGAGAGCAAGAGGCAGG + Intronic
1180854228 22:19036223-19036245 CAGGCTAAGGTGGAAGAGGCTGG - Intergenic
1182173410 22:28256623-28256645 CAGGGTAAAAAGAACAAGGCTGG + Intronic
1182620699 22:31616928-31616950 CAGGGTAAATAGCAAGTCCCAGG - Intronic
1183017364 22:35000167-35000189 CAGGCTGGAGAGCAATAGGCAGG - Intergenic
1184391358 22:44205338-44205360 CAGGGAAAGGAGCAAGGGCCTGG - Intronic
1184786331 22:46673718-46673740 CTGGGTAAAGAGGAGGACGCCGG + Exonic
1185330907 22:50251634-50251656 CAGGGCAAAGGCCACGAGGCGGG + Intronic
949113442 3:291166-291188 CAAGGTAAAGAGGAAGAGGTTGG + Intronic
952062058 3:29522798-29522820 CAGGATACAGAGCATGAGACTGG + Intronic
952827354 3:37535538-37535560 TGGGGTAAAGTGGAAGAGGCTGG + Intronic
953214170 3:40902218-40902240 GAGGGCAGACAGCAAGAGGCAGG + Intergenic
953891154 3:46752527-46752549 AAGGGCAAAGGGCAAGAGGCTGG + Intronic
954099213 3:48356453-48356475 CAGAGGAAACTGCAAGAGGCTGG + Intergenic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
957801027 3:85081719-85081741 CAGGGCATCGAGGAAGAGGCCGG + Intronic
958687154 3:97413379-97413401 CAGGGGAAAGAGCAAGCAGGAGG + Intronic
960858520 3:122127530-122127552 CAGAGTATGGAGCAAGAAGCAGG + Intergenic
961511280 3:127405300-127405322 CAGGGTAAAGAGCCACTGCCTGG - Intergenic
961530006 3:127534828-127534850 CAGGAGAAAAAGCAAGTGGCAGG - Intergenic
962453817 3:135546961-135546983 CAGGGAAAGGTGCAAGAGGAGGG - Intergenic
962600858 3:136989989-136990011 CAGGGTGAAGAGGTAGAGGCAGG + Intronic
962629976 3:137265664-137265686 CAGGAAATAGAGCATGAGGCTGG + Intergenic
963471082 3:145742658-145742680 GAGGGGAAAGAGAAAGAAGCAGG - Intergenic
964718356 3:159746695-159746717 CAGGATATAGGGAAAGAGGCTGG - Intronic
965151729 3:164986230-164986252 GAGAGTAAGGAGCAAGAGACAGG - Intronic
966310231 3:178586084-178586106 CGAGGCAAAGAGCAAGAGACAGG - Intronic
967298752 3:187991320-187991342 CAGGTGAAAGAGCATGAAGCTGG - Intergenic
967380781 3:188855454-188855476 CAGGATAAAGAGACAGAGTCTGG + Intronic
967652978 3:192009135-192009157 CATGGAAATGAACAAGAGGCTGG + Intergenic
968715229 4:2153160-2153182 GAGAGCAAAAAGCAAGAGGCAGG + Intronic
969105709 4:4805668-4805690 CAGGCCAAAGAGTGAGAGGCTGG + Intergenic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
970017189 4:11525314-11525336 CAGGGCAAAGAGGACAAGGCTGG - Intergenic
970822848 4:20239214-20239236 AGGGGAAAAGAGCAAGAAGCAGG + Intergenic
971133851 4:23844966-23844988 CAGGGAAAAGAGTAAGAGTAAGG + Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
973635627 4:52859768-52859790 CAGATTAAAGATCAAGGGGCAGG - Intergenic
974857366 4:67476706-67476728 CAGGGTAGGCAGCAAGGGGCAGG + Intronic
975028718 4:69585712-69585734 CAAGTTAAAGATCAAGATGCTGG + Intergenic
975193133 4:71489936-71489958 CAGGGAAAAGAGCAGGAGAGAGG + Intronic
976744034 4:88385844-88385866 CAGCATAAAGAGCAAAGGGCTGG - Intronic
977334619 4:95681092-95681114 CAGGAGAAATAGCAAGACGCAGG - Intergenic
977711911 4:100135997-100136019 CATGGTAAAGGGCAGGAGGCAGG - Intergenic
978524631 4:109653023-109653045 TAGGGTAAAGAGCTAGGGGTGGG + Intronic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980714228 4:136611178-136611200 CAGGCTAAGGAGGAAGAGGGAGG - Intergenic
981091640 4:140738468-140738490 AAGGGGAAAGAGCAAGAAGGAGG - Intronic
982455034 4:155599318-155599340 CAGGGCAAATAGCAACAAGCTGG - Intergenic
983873611 4:172850887-172850909 CAGGGGACAGGGGAAGAGGCAGG + Intronic
986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG + Intergenic
986182214 5:5403822-5403844 CAGGCTAAGAAGCAAGAAGCAGG + Intergenic
989020754 5:37004426-37004448 CAGGGGACAGAGCAAGACCCTGG - Intronic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
991100702 5:62789347-62789369 AAGGGTACAAAGCAGGAGGCAGG + Intergenic
991469760 5:66955348-66955370 AAGTGCAAAGGGCAAGAGGCAGG + Intronic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
994514657 5:100755532-100755554 CAGGTTAAAGATAAAGAAGCTGG - Intergenic
994520968 5:100834745-100834767 CAGGGTCAAGAGAAAGAGCTGGG - Intronic
994773548 5:104014469-104014491 CAGGTTACAGAGCAAGAGAATGG - Intergenic
995008960 5:107236239-107236261 CAGAGTATAGAGCAAGAAGAGGG - Intergenic
996678831 5:126208024-126208046 CAAGGGAAAGGGCAGGAGGCAGG + Intergenic
999297080 5:150466377-150466399 CAGGCTACAGAGCCAGAGGGAGG - Intergenic
999363061 5:151002449-151002471 TAGGATAAAGAAAAAGAGGCTGG + Intergenic
1001044735 5:168363081-168363103 GAGGGTAGAGAACAAGAGGAAGG + Intronic
1002110700 5:176908898-176908920 CAGGGTACAGAGAAACAGCCAGG - Intronic
1002767606 6:256124-256146 TAGGGCAAAGAACAAGATGCTGG - Intergenic
1003414606 6:5896774-5896796 CAGGGTCGGGAGGAAGAGGCTGG + Intergenic
1004447017 6:15709866-15709888 CAGGAAACAGAGCAAGAGGTGGG - Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1005440251 6:25859868-25859890 CAGGGTAAAAAGTAAGGGGGAGG - Intronic
1005487000 6:26310085-26310107 CAGAGAAAAGAGCAAGAAGCGGG + Intergenic
1005987491 6:30884006-30884028 CAGGGCACAGAGGAAGAAGCAGG - Intronic
1006219858 6:32479579-32479601 CAGTGTAGAGAGCCAGAGGCTGG - Intergenic
1006433213 6:34011059-34011081 CAGAGAGCAGAGCAAGAGGCAGG + Intergenic
1006824328 6:36923321-36923343 GAGGGGAAATAGCAAGAGGAAGG - Intronic
1007014257 6:38447842-38447864 CAGGGTAAAGTTAAAGAAGCTGG + Intronic
1007694521 6:43723920-43723942 AAGGCTAATGAGGAAGAGGCTGG + Intergenic
1009413938 6:63395729-63395751 CTGGGGAAGGATCAAGAGGCTGG + Intergenic
1009488376 6:64254614-64254636 CAGGGAACAAAGCAAGAGGAAGG - Intronic
1009535581 6:64878863-64878885 CAGAGCAATGACCAAGAGGCTGG - Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012266173 6:97145976-97145998 CTGGCTAAAGAGCAAGAAGATGG + Exonic
1012961038 6:105621930-105621952 CAGGATAAAGAGAAAGCGCCAGG - Intergenic
1013231339 6:108164667-108164689 CCGGGGAAAGAGCAAGATGGGGG - Intronic
1013569994 6:111413007-111413029 AAGGGTGAAGAGTAAGAGGGAGG - Intronic
1014351355 6:120350049-120350071 CTGGATGAAGAGCAAGAGGAGGG + Intergenic
1014761990 6:125366640-125366662 TGGGGGAAAGAGCAAGAGGTAGG - Intergenic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015686664 6:135870829-135870851 CAATGTAAAGAGGAAGAGGGTGG + Intronic
1015994950 6:138987967-138987989 GAGGGTGCAGAGAAAGAGGCGGG + Exonic
1016015098 6:139175826-139175848 CATGGTGAATACCAAGAGGCTGG - Intronic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017001192 6:149999016-149999038 CAGGGTACAGAGCCAGGGGTAGG - Intergenic
1018002218 6:159589387-159589409 GTGTGTAAAGAGCAGGAGGCTGG - Intergenic
1018759829 6:166884310-166884332 CAGGGTATGGAGGAAGGGGCAGG - Intronic
1019034811 6:169045514-169045536 CACCAAAAAGAGCAAGAGGCCGG - Intergenic
1019088493 6:169503126-169503148 CAGAGTGACGAGAAAGAGGCAGG + Intronic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1019493202 7:1324571-1324593 TAGGGTTAGGAGCAAGAAGCGGG + Intergenic
1019923963 7:4180276-4180298 CAGGGCATAGAGCTAGAGCCGGG - Intronic
1020149863 7:5673541-5673563 CAGGGAAGAGAGCAAGTTGCAGG + Intronic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022624414 7:32019935-32019957 CAGGGAAAAGAGCAAGCTGGAGG + Intronic
1025202065 7:56968546-56968568 AAGGGTGAGGAGCCAGAGGCAGG - Intergenic
1025669882 7:63608382-63608404 AAGGGTGAGGAGCCAGAGGCAGG + Intergenic
1026285041 7:68955400-68955422 CAGAGAAAAGGGGAAGAGGCAGG + Intergenic
1026534544 7:71229101-71229123 CGGGGCAAAGAGGAAAAGGCAGG - Intronic
1026894059 7:73999964-73999986 CAAGGTCAACAGCACGAGGCGGG + Intergenic
1028676844 7:93474170-93474192 CTGGGTAAAGTGCATGAGGCTGG + Intronic
1030112451 7:106038423-106038445 CAGAGTGATGAGCATGAGGCTGG + Intergenic
1031101036 7:117479909-117479931 CGGGGGAAAGAGCAAAAGGAAGG + Intronic
1032653412 7:133903068-133903090 CAGGGCAAAGGCCAGGAGGCAGG + Intronic
1032663503 7:134011977-134011999 AAGGGTGAAGAGCCAGAGGGAGG + Intronic
1033953759 7:146817650-146817672 CAGGAACAAGAGCAAGAGGAAGG + Intronic
1036634362 8:10538738-10538760 CAGGGGACAGAGCAGGAGCCAGG - Exonic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036709145 8:11067223-11067245 CAGGGGCAAGGGCAAGAGCCTGG + Intronic
1036791729 8:11725636-11725658 CAGAGTGAAGAGCGAGGGGCAGG - Intronic
1037940428 8:22947120-22947142 CCCGGTGAAGAGCAAGAGCCTGG - Intronic
1037954287 8:23042135-23042157 CAGGGTCAAGACCAGGAAGCAGG - Intronic
1038163165 8:25059833-25059855 GAGGGTAAAGGGCAAGAAGATGG - Intergenic
1038375992 8:27041000-27041022 GTGGGTAAAGATCTAGAGGCAGG - Intergenic
1039580868 8:38666032-38666054 CGGGGTAAGGAGGCAGAGGCGGG - Intergenic
1040387157 8:46921322-46921344 CAGGGGAAGGAGGAACAGGCTGG + Intergenic
1041087278 8:54268549-54268571 CTGGGCAAAGTGGAAGAGGCTGG + Intergenic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1043372461 8:79611060-79611082 CTAGAGAAAGAGCAAGAGGCAGG - Intronic
1044365072 8:91335891-91335913 GAGGGAGCAGAGCAAGAGGCTGG - Intronic
1044965251 8:97568187-97568209 CAGGGAGAAGAGAGAGAGGCTGG + Intergenic
1045714230 8:105022690-105022712 CATGGTACAGCGCAAGAAGCCGG + Intronic
1046805280 8:118473245-118473267 CAGGGGACAGAGCAAGACCCAGG - Intronic
1048154284 8:131929254-131929276 GAAGGTAAAGAGGAAGAGACAGG - Intronic
1048301655 8:133255712-133255734 CAGGGGATGGGGCAAGAGGCAGG + Intronic
1049025132 8:139983223-139983245 CAGGTTCAAGATCAAGACGCTGG - Intronic
1049025137 8:139983263-139983285 CAGGTTCAAGATCAAGACGCTGG - Intronic
1049343945 8:142128579-142128601 CTGGGAAAAGAGCAGGAGGGTGG + Intergenic
1049836928 8:144742008-144742030 CAGAGTAAAAACCAAGAGGCCGG + Intronic
1050172471 9:2836198-2836220 CAGGGTAAAAAGCAAGCACCAGG + Intronic
1050185209 9:2965772-2965794 CAGGGTAAGGAGAGAGTGGCAGG + Intergenic
1050610611 9:7348903-7348925 CTGGGTATAGAGGCAGAGGCTGG + Intergenic
1050938717 9:11431067-11431089 CATGGTAAAAAGCCAGAGTCAGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052221797 9:26032944-26032966 CAGGGCAAAGAAATAGAGGCAGG - Intergenic
1053510969 9:38687475-38687497 CAGTGTGCAGAGCAGGAGGCGGG - Intergenic
1054740821 9:68804223-68804245 CAGGGTGAAGAGCCAGATGAGGG + Intronic
1055407542 9:75990226-75990248 CAGGCTAACGAGCTGGAGGCAGG - Intronic
1057414166 9:94846603-94846625 CTGGGCAAAGAGAAAGAAGCTGG + Intronic
1057936781 9:99246668-99246690 CAGGAAAAAGAGGAAGAGGTTGG + Intergenic
1058110627 9:101028348-101028370 CAGGGTAGAAAGCAAGAGAATGG + Intergenic
1058202004 9:102055424-102055446 CAAGGTAAAGATGAAGTGGCTGG - Intergenic
1059137506 9:111821263-111821285 CAGGGTAGAGACAAAGAAGCTGG - Intergenic
1059700426 9:116770550-116770572 CAAGGTATAGAGAAAGAGCCAGG - Intronic
1060442683 9:123656223-123656245 CAGGGAAGAGAGTGAGAGGCAGG + Intronic
1061359456 9:130131808-130131830 CAGGCACGAGAGCAAGAGGCGGG - Intronic
1061891933 9:133626537-133626559 CTGGGTAATGGGCAAGAGGTTGG - Intergenic
1062201895 9:135307492-135307514 CAGGGTAAATTCCTAGAGGCAGG + Intergenic
1062347588 9:136122522-136122544 CAGGGTACAGGGCAGGAGCCTGG + Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1185989429 X:4876462-4876484 CAGTGGAAAGAGGAAGAGGGTGG + Intergenic
1186390659 X:9155520-9155542 GTGGGGAAAGAGCAAGGGGCTGG - Intronic
1186810942 X:13187919-13187941 CAGGGTGGAGAGCAAAATGCTGG - Intergenic
1187135102 X:16540574-16540596 TAAGGAAAAGAGAAAGAGGCCGG + Intergenic
1187598185 X:20798056-20798078 CAGGGAAAAGGGCAAGAGAGGGG - Intergenic
1187607959 X:20906655-20906677 CAGGCTAAAGTCCAAGAGGGAGG - Intergenic
1189619812 X:42824170-42824192 CAGGGTAAAGAGGAAAAGAGAGG - Intergenic
1189907258 X:45774053-45774075 CAGGGTAAAGACAAACAGCCTGG + Intergenic
1190303914 X:49071876-49071898 CTGGGACAAGAGCAGGAGGCTGG - Exonic
1192239930 X:69320871-69320893 CAGGGGAAAGACCTGGAGGCTGG - Intergenic
1192510209 X:71716887-71716909 GAGGGTAAAGAGGGAGAGGAGGG + Intronic
1192516488 X:71764666-71764688 GAGGGTAAAGAGGGAGAGGAGGG - Intronic
1193078430 X:77380807-77380829 CAGGGTAAAGAGTCAGAGGTGGG + Intergenic
1195667285 X:107442869-107442891 CCCGGTAAAAAGCAATAGGCAGG + Intergenic
1196700629 X:118664063-118664085 CAGGGATAGGAGCTAGAGGCAGG + Intronic
1197798381 X:130322418-130322440 CAGGGGAAAGAGGAAGGGGTTGG - Intergenic
1198197015 X:134373404-134373426 GAGGGTAAAGAGAAAGAAGTCGG - Exonic
1198254032 X:134909425-134909447 CAGAGTAAACAGCAAGAGCCAGG - Intronic
1199462368 X:148098754-148098776 CAGAGAACAGAGCAAGAAGCAGG + Intergenic
1199559840 X:149150950-149150972 CCTGGTGAAGAGCAAGAGGGTGG + Intergenic