ID: 990807387

View in Genome Browser
Species Human (GRCh38)
Location 5:59680921-59680943
Sequence CTGAATATACCCATGGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990807385_990807387 1 Left 990807385 5:59680897-59680919 CCTAGGTTTAATGTATACAAATA 0: 1
1: 1
2: 2
3: 19
4: 259
Right 990807387 5:59680921-59680943 CTGAATATACCCATGGATATAGG 0: 1
1: 0
2: 2
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990807387 Original CRISPR CTGAATATACCCATGGATAT AGG Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904567907 1:31438999-31439021 ATAAATATACACATTGATATGGG - Intergenic
905032401 1:34895580-34895602 TTGCATATACACATGGATTTTGG - Intronic
905117604 1:35655854-35655876 ATGAATATACAAAGGGATATGGG + Intergenic
909404969 1:75278064-75278086 CTGAATAGACACATGGGTAGTGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919352898 1:196482285-196482307 GTGAATAAACCCAGAGATATAGG + Intronic
919500705 1:198334849-198334871 CTCAATATTCCCATTAATATGGG + Intergenic
921759750 1:218899460-218899482 CTGAATACATCCATGTACATAGG + Intergenic
921863029 1:220058961-220058983 AAGAACATTCCCATGGATATCGG + Exonic
1064274106 10:13891344-13891366 CTGAATCTACCCGGGGAGATAGG - Intronic
1064853126 10:19733202-19733224 ATGAATATTGCCATGAATATTGG - Intronic
1068290023 10:54989642-54989664 CTGTATTTACCCATTGAAATGGG + Intronic
1068298373 10:55106218-55106240 TGGAGTATACACATGGATATTGG + Intronic
1069101741 10:64330830-64330852 CTGATTCTTCCCATGGAAATGGG - Intergenic
1071593059 10:86894828-86894850 CTGAGTGTACCCAGGGATATGGG - Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075331516 10:121577640-121577662 CTGGGTATATCCATGGATACAGG - Intronic
1086186478 11:84023071-84023093 CTGAAGATACCCATGGTCTTTGG + Intronic
1087522103 11:99251820-99251842 CTCCATATAGCCATGGATAAAGG - Intronic
1092333200 12:7604238-7604260 CTGAAAATACACATGGCCATTGG + Intergenic
1092985462 12:13840965-13840987 CTTAATAAACACATGGCTATAGG - Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094704712 12:32903308-32903330 CTGTATATATTGATGGATATAGG + Intergenic
1095150858 12:38795362-38795384 TTGAATATACACATGGAAGTGGG - Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1098759963 12:74410989-74411011 CTGAAAATATCCATGGACAATGG - Intergenic
1099755402 12:86840554-86840576 CTGAATAAACACAAGGAGATTGG + Intergenic
1100271347 12:93028392-93028414 GTGAATATCGACATGGATATAGG + Intergenic
1100518926 12:95354904-95354926 CTCCGTATACCCATAGATATAGG + Intergenic
1100761826 12:97815892-97815914 CTGCCTATACCTGTGGATATTGG - Intergenic
1103127595 12:118437549-118437571 CTTCAGATACACATGGATATTGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107098123 13:36558773-36558795 CTGGATTTACACATGGAAATGGG + Intergenic
1107525136 13:41222970-41222992 CTGCATATATACATGGGTATTGG - Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1109573757 13:64226655-64226677 CTGAAAATTCCCATGTATACAGG - Intergenic
1110666572 13:78124230-78124252 ATAAATATACACATAGATATAGG + Intergenic
1111275498 13:85940218-85940240 CTGAATATACCCTAGAATAGTGG - Intergenic
1112459557 13:99591476-99591498 CTGAATATTCTCATGTGTATGGG + Intergenic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114157584 14:20122488-20122510 CACTATATACCCATGGATATAGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1118078927 14:62335751-62335773 CTGAATGTACTCATAGAGATTGG + Intergenic
1118132276 14:62980261-62980283 CTGAATATATTTGTGGATATTGG - Intronic
1123134393 14:106013506-106013528 ATGAACATACCCTTGGGTATGGG + Intergenic
1123584420 15:21743947-21743969 ATGAACATACCCTTGGGTATGGG + Intergenic
1123621067 15:22186558-22186580 ATGAACATACCCTTGGGTATGGG + Intergenic
1133455683 16:5940495-5940517 CTTAATATCCCCATAGATCTGGG - Intergenic
1133889567 16:9866493-9866515 CTGAAGAAGCCCTTGGATATTGG + Intronic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1138854770 16:60676937-60676959 CAGAATATACTCATGGTAATAGG - Intergenic
1140112832 16:72018307-72018329 ATGAAGAAACCAATGGATATGGG + Intronic
1143932944 17:10449987-10450009 GTGAATACATCCATTGATATAGG + Intronic
1144134749 17:12282802-12282824 CCCAATAAACCCATGGTTATTGG - Intergenic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1144604144 17:16649523-16649545 CTAAATAGACCCATGAAAATTGG - Intronic
1146308345 17:31747892-31747914 ATGATTATTCCCATGGATAGAGG - Intergenic
1148667169 17:49383366-49383388 CTGAATATTCCCATGGAAACTGG - Intronic
1148966506 17:51440433-51440455 CTGAAGAAACCCATGGAGAGAGG + Intergenic
1149333908 17:55614786-55614808 CTGCATATCCCCATGTATTTTGG + Intergenic
1151416741 17:73971243-73971265 CTGTAAATACCCATGAATCTGGG - Intergenic
1157051081 18:44165985-44166007 CTAAATATAGATATGGATATAGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157609198 18:48945697-48945719 CTGGATCTGCCCATGGATACTGG + Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159728248 18:71991115-71991137 CTGAATATATACACGGTTATGGG + Intergenic
929728151 2:44454981-44455003 CTTAATTTACCCATGGATAGAGG + Intronic
931496979 2:62818641-62818663 CAGAATATACCCAAGGAAAGTGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
935539558 2:104333650-104333672 CTGAATATACCTATGGCTGCAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938631409 2:133171863-133171885 ATAAATATATACATGGATATAGG + Intronic
938771411 2:134504394-134504416 ATGAATATACACATGGATGATGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939514060 2:143144218-143144240 ATGAATATACACATGCATAAAGG + Intronic
941306357 2:163873530-163873552 CTGACTATAGCCATAGAAATAGG + Intergenic
941871529 2:170390666-170390688 CTGTAGATACCCTTGGATTTTGG - Intronic
944626231 2:201571730-201571752 CTGGATATAGCCCTGGATAGAGG - Intronic
1169868154 20:10222491-10222513 CTGAAAATGCCCATTGATTTGGG + Intronic
1170975549 20:21160648-21160670 CTTAGTATAGCCATTGATATGGG + Intronic
1171796050 20:29567517-29567539 CGGAAGATGCCCATGGAGATGGG + Intergenic
1174746482 20:53068238-53068260 CTGAATAAACCCAGGGTTATGGG - Intronic
1175663161 20:60835004-60835026 CTGAATTTGCTCATGGAGATGGG - Intergenic
1177321169 21:19523032-19523054 ATGAATTTACCCATAAATATCGG - Intergenic
1178179952 21:30148412-30148434 GTGACTATACCCAAGGAAATGGG - Intergenic
1179160859 21:38897212-38897234 GTGAATATATTCATGGATACTGG - Intergenic
1183490985 22:38115542-38115564 CTGATTGTACTCATGGATCTCGG + Exonic
952204460 3:31166407-31166429 CTGAATAGACCCTTGGTAATAGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
966208005 3:177424343-177424365 CTCTATAGACCCATGCATATGGG + Intergenic
970303288 4:14703757-14703779 CTAAATAGAACCATGGACATGGG - Intergenic
971743155 4:30545742-30545764 CTAATTATACCCTTTGATATGGG - Intergenic
971867044 4:32186042-32186064 TTGAATAAACCCATGGATCTTGG - Intergenic
974828191 4:67155833-67155855 CTGAATATGGCCCTGGAAATTGG + Intergenic
976761569 4:88554742-88554764 CTGACTCTACCCATGGAGCTAGG - Intronic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
980761512 4:137239581-137239603 CAGAAGATCCCCATTGATATAGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
983919086 4:173326019-173326041 CTGTATTAACCCATGTATATCGG + Intergenic
988233916 5:28514648-28514670 GTGAATATATCTATGGGTATTGG - Intergenic
989229631 5:39072234-39072256 CTGGAAATACCTATGGACATAGG + Intronic
990807387 5:59680921-59680943 CTGAATATACCCATGGATATAGG + Intronic
992226527 5:74624358-74624380 TTGAATATACCCATGGATAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
999732994 5:154489971-154489993 CTAAAAATACACATGGAAATAGG - Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1001884670 5:175278563-175278585 CTGTATATAGGCTTGGATATAGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1007705645 6:43789427-43789449 CTTAATATACACATGGCTAGTGG + Intergenic
1008188874 6:48429436-48429458 ATGAATACAACCATGGAGATGGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011793663 6:90928379-90928401 AAAAACATACCCATGGATATTGG - Intergenic
1014236408 6:118960864-118960886 CTGAACATACCCATGCACAAGGG + Intronic
1015346759 6:132169311-132169333 TTGAATATATCCTTGCATATAGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017335777 6:153258117-153258139 TTGAATAAACCAATGAATATAGG + Intergenic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1021155947 7:17209986-17210008 CTAAGTATACTCATTGATATTGG + Intergenic
1022569118 7:31434060-31434082 TTAAATTTACCCATGGAGATAGG - Intergenic
1023705922 7:42941723-42941745 CTGCATGTACCCAAGGATGTAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029455754 7:100671153-100671175 ATGAATGTACCCATGTACATGGG + Intergenic
1031814426 7:126415491-126415513 CAGAAAATACCCAGGGAGATTGG - Intergenic
1033465974 7:141590149-141590171 CTGAATATGCACAAGAATATGGG - Intronic
1037016312 8:13911263-13911285 CTCAATATACACAGGCATATTGG - Intergenic
1037336401 8:17796705-17796727 TTGAATTTACTCTTGGATATGGG - Intronic
1038599223 8:28922081-28922103 CTGCATAAATCCATGGATGTGGG - Intronic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044116990 8:88348152-88348174 GACAATATACCAATGGATATTGG + Intergenic
1044433204 8:92133148-92133170 CTGTATATACCATTGGAAATGGG - Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1050153360 9:2639707-2639729 CTGAAGTTTCCCCTGGATATTGG + Intronic
1051581419 9:18680211-18680233 CTGATTATACCAATAGACATGGG + Intronic
1052792338 9:32887203-32887225 CTGAAGATACCCATAGATCCTGG - Intergenic
1058934533 9:109756068-109756090 CTATATATACCCATTGATTTAGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1187782235 X:22840066-22840088 CTGCATTTATCCATGGATAGTGG - Intergenic
1189914255 X:45841412-45841434 CTGTATATAGCCTTGGAAATTGG - Intergenic
1192291967 X:69807406-69807428 TTGAATTTACCCCTGGATACTGG + Intronic
1196809183 X:119615034-119615056 CAGAAAATATCCATGTATATAGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic