ID: 990813944

View in Genome Browser
Species Human (GRCh38)
Location 5:59761839-59761861
Sequence CTTAATAATAACTATGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990813944_990813948 30 Left 990813944 5:59761839-59761861 CCAGCAACATAGTTATTATTAAG 0: 1
1: 0
2: 4
3: 38
4: 237
Right 990813948 5:59761892-59761914 TATGGGACTGACAGCATGGTAGG No data
990813944_990813947 26 Left 990813944 5:59761839-59761861 CCAGCAACATAGTTATTATTAAG 0: 1
1: 0
2: 4
3: 38
4: 237
Right 990813947 5:59761888-59761910 TGTTTATGGGACTGACAGCATGG 0: 1
1: 0
2: 1
3: 13
4: 212
990813944_990813945 12 Left 990813944 5:59761839-59761861 CCAGCAACATAGTTATTATTAAG 0: 1
1: 0
2: 4
3: 38
4: 237
Right 990813945 5:59761874-59761896 CTATATATGCTATATGTTTATGG 0: 1
1: 0
2: 3
3: 25
4: 366
990813944_990813946 13 Left 990813944 5:59761839-59761861 CCAGCAACATAGTTATTATTAAG 0: 1
1: 0
2: 4
3: 38
4: 237
Right 990813946 5:59761875-59761897 TATATATGCTATATGTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990813944 Original CRISPR CTTAATAATAACTATGTTGC TGG (reversed) Intronic
902034007 1:13443323-13443345 AATAATAATAATAATGTTGCAGG + Intergenic
904874733 1:33645437-33645459 GCTAGTAATAATTATGTTGCAGG - Intronic
907567231 1:55446749-55446771 CATAATAATAACTAGGTTGAAGG - Intergenic
907677136 1:56528555-56528577 GTTAATAATATCTATGTGGCAGG + Intronic
909091232 1:71228567-71228589 ATTAATAACAACTCTCTTGCAGG - Intergenic
909120233 1:71594097-71594119 CTTACTAATGCCTATGTTGGGGG - Intronic
910037998 1:82812021-82812043 TTTAATGATAACCATGTTCCAGG + Intergenic
912469738 1:109898311-109898333 CTTAATATTTACTATGTGCCTGG - Intergenic
912885727 1:113471625-113471647 GATAATAAAAACTATGTTACTGG - Intronic
917138701 1:171813077-171813099 ATTAATAATACCTATCTTGCAGG + Intronic
917408018 1:174729781-174729803 TTTAATAATAGCCATGTTGATGG - Intronic
919918638 1:202154599-202154621 CATAATAATATCTATCTTGTAGG + Intronic
920599142 1:207304750-207304772 CATAATATTAAATATATTGCAGG - Intergenic
921944032 1:220874324-220874346 TTTCATCATAACAATGTTGCTGG + Intergenic
924480442 1:244427205-244427227 CTTAAAAATTATTAAGTTGCTGG - Intronic
1063444738 10:6104331-6104353 CTTAAAAAAAATTATGATGCTGG + Intronic
1066763511 10:38781542-38781564 ATTAATAATTAGTCTGTTGCTGG - Intergenic
1066958302 10:42194105-42194127 ATTAATAATTAGTCTGTTGCTGG + Intergenic
1069636776 10:69929905-69929927 TTTAATTCTAACTGTGTTGCTGG - Intronic
1071382592 10:85083025-85083047 CTTAATAAGAACAATGTGGAAGG - Intergenic
1071674468 10:87642095-87642117 CTTCATAACAACTATGAAGCAGG - Intergenic
1071920980 10:90349995-90350017 TTTAATAATAATTATGTCTCTGG + Intergenic
1072325158 10:94290792-94290814 AATAATAATAAATATGTTACTGG - Intronic
1073807185 10:107110373-107110395 CTTAATAGAAAGTATGGTGCAGG + Intronic
1077761789 11:5108330-5108352 CTTTATAATAACTATGCTATAGG - Intergenic
1077777782 11:5290708-5290730 CTTATTAATAACTATGAAGCAGG + Intronic
1078155184 11:8794024-8794046 GTTAACAATAACTATTTTTCTGG + Intronic
1078996335 11:16704503-16704525 CATAACAATACCTATTTTGCAGG - Intronic
1080290693 11:30667765-30667787 AATAATAATAACTATGATGATGG - Intergenic
1081191401 11:40106415-40106437 ATTAATAATAACTTTATTGTTGG + Intergenic
1081239837 11:40691450-40691472 CATAATAATACCTAACTTGCTGG - Intronic
1082101661 11:48177884-48177906 CTTATTACTTACTATGTTCCAGG - Intergenic
1082228114 11:49732049-49732071 CTTAATAATAACTGTATGTCTGG - Intergenic
1087029022 11:93683488-93683510 GGTAATATTAACAATGTTGCAGG - Intronic
1091345490 11:134850411-134850433 CTTAGTAACAAGCATGTTGCAGG + Intergenic
1092480660 12:8856405-8856427 CTGAATGTCAACTATGTTGCAGG - Intronic
1094365825 12:29680009-29680031 TTTAATAATCACTTTGTTTCTGG + Intronic
1095575167 12:43728756-43728778 CTTAACAATAACTAAGTGCCAGG + Exonic
1096436551 12:51595628-51595650 AATAATAATACCTACGTTGCAGG + Intronic
1098261110 12:68671871-68671893 ATTAATAAAAATTATGGTGCTGG + Exonic
1098410471 12:70177519-70177541 CTTAATAATAACAATGGGCCAGG + Intergenic
1099020318 12:77395570-77395592 CTTGATTATAACCATGTGGCTGG + Intergenic
1101147960 12:101859088-101859110 CTTAAAAATTAATATCTTGCTGG - Intergenic
1101198023 12:102405535-102405557 CTTAATAATATCTATTTTGCGGG - Intronic
1101658387 12:106744585-106744607 AGTAATAATATCTATCTTGCAGG - Intronic
1102557482 12:113737040-113737062 CTTAATAAGAACTATTTTGATGG + Intergenic
1105575825 13:21650663-21650685 CTTGATAATAACAATGGTGGTGG - Intergenic
1106705726 13:32277325-32277347 GGTAATAATAACTAATTTGCAGG + Intronic
1107262126 13:38505511-38505533 GTAAATAATAACTAAGTTACTGG + Intergenic
1108060369 13:46527027-46527049 CTTCATAATAACTATGTCATTGG + Intergenic
1108233697 13:48378653-48378675 CTTAATAATGAACATGTTACTGG - Intronic
1109058199 13:57580227-57580249 CTTTATAATATCTATTTTTCTGG + Intergenic
1109067198 13:57712125-57712147 CTTTAAAATAAATATGTTACTGG + Intronic
1109328104 13:60894764-60894786 ATTAATAAGAACTATGTCTCTGG - Intergenic
1110878934 13:80546005-80546027 CTTAATATTAACTAGGTTCGTGG - Intergenic
1111293402 13:86197579-86197601 GTAAATAATAAATATGTTGGAGG + Intergenic
1111423002 13:88042275-88042297 TTGAATAATTACTATGTTCCTGG + Intergenic
1111747532 13:92289590-92289612 GTTAATAATAACTATGTATCAGG + Intronic
1114064042 14:19045159-19045181 ATTAATAATAACAATGTTGAGGG + Intergenic
1114098217 14:19354837-19354859 ATTAATAATAACAATGTTGAGGG - Intergenic
1114143017 14:19938212-19938234 GTTAAAAATAGCTATTTTGCAGG + Intergenic
1114834581 14:26188550-26188572 ATTAATATTTAATATGTTGCAGG - Intergenic
1115332986 14:32217999-32218021 CATAAAAATAACTATTTTGTGGG - Intergenic
1116914817 14:50514425-50514447 CTTAATACTTACTATGTGCCAGG + Intronic
1117205304 14:53436458-53436480 CTGAATGCTTACTATGTTGCAGG - Intergenic
1118515446 14:66523437-66523459 CAAAATAATAACTATTTTGGAGG - Intronic
1118782849 14:69021366-69021388 ATTAAAAATAACTATGTTGTTGG + Intergenic
1120436446 14:84488620-84488642 TTTAATAAGTACTATGTTCCAGG - Intergenic
1121990784 14:98554810-98554832 TTTCATAATTACTATTTTGCTGG + Intergenic
1122594713 14:102881635-102881657 CTTAATAATACCTAGGTGGTGGG + Intronic
1124449173 15:29769823-29769845 CTTGATAATGACTATGTTACTGG + Intronic
1125396316 15:39251970-39251992 TTGAATAATAACTATGATTCTGG - Exonic
1128505347 15:68266625-68266647 CTTTATAAAAACTATTTTGATGG + Intergenic
1129250147 15:74304279-74304301 CTTAATAGTCACTGTGTTCCTGG + Intronic
1129534125 15:76297473-76297495 CATAATAAAAAATATGATGCCGG - Intronic
1129687308 15:77694210-77694232 AATAATAATAACTATTATGCTGG - Intronic
1131701513 15:94942179-94942201 GATAATGATAACTATATTGCAGG + Intergenic
1133749941 16:8716987-8717009 CTTATTAATAACTATATTGATGG + Intronic
1134673433 16:16072743-16072765 CTTAATAATAAATATTAGGCCGG + Intronic
1135235084 16:20747591-20747613 CTAAATAATAAAACTGTTGCAGG - Intronic
1137306732 16:47207925-47207947 CTGAATAATTACTATGTACCAGG + Intronic
1137501923 16:49018429-49018451 CTTAATAGTCACTATCTCGCTGG - Intergenic
1138966672 16:62092999-62093021 CTTATTAATCACTATGTGCCAGG - Intergenic
1141914894 16:87088749-87088771 CCTACAAATAACTGTGTTGCAGG - Intronic
1146247210 17:31297745-31297767 CATAATAATCACCATGTTGGGGG - Intronic
1146426129 17:32741064-32741086 CTTAAATATAATTATATTGCTGG + Intronic
1146945662 17:36871598-36871620 AATAATAATAACTGTCTTGCAGG - Intergenic
1150159073 17:62879029-62879051 GGTAATAATAACTGTGTAGCAGG - Intergenic
1150953131 17:69824441-69824463 CTAGAGAATAACTATGCTGCTGG - Intergenic
1151103008 17:71577200-71577222 CATAATAAAACCTATCTTGCTGG + Intergenic
1152056263 17:78030076-78030098 GTTCATAATAACTATATTACTGG - Intronic
1153398125 18:4648720-4648742 TTTAATAATAACTATCTTGGTGG + Intergenic
1154089357 18:11343206-11343228 CTTCATATAAACTCTGTTGCAGG - Intergenic
1156796790 18:41055467-41055489 CATTATAATAATTATGTTTCAGG - Intergenic
1156885510 18:42131243-42131265 CTTAATAACAGCTCTGCTGCTGG - Intergenic
1159142332 18:64412974-64412996 CATAATAATAATTATGTTAATGG + Intergenic
1159205568 18:65246677-65246699 CATTATAATATCTATGTTGAAGG + Intergenic
1159253442 18:65912333-65912355 CTTTAAAATAATTATGTTACAGG - Intergenic
1159867446 18:73722948-73722970 CCTAATAATAACTATTTCTCTGG - Intergenic
1162912996 19:13859829-13859851 ATTAATAATCACTATGTTCCTGG - Intergenic
1163132709 19:15285768-15285790 CTGATTGATAACTATGTTGATGG - Intronic
1165220467 19:34311905-34311927 TTAAATAAGAACTATGTTGCCGG - Intronic
1166940692 19:46363085-46363107 TTTAATAAAAACTATGTCGGCGG - Intronic
925724769 2:6862279-6862301 TTAAATAATAACTGTTTTGCAGG - Intronic
926098489 2:10098178-10098200 CTTAATAACATCTATGGTACTGG + Intergenic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
931423098 2:62146205-62146227 CTTGATAATAAGTGTGTTACTGG + Intronic
931448701 2:62349437-62349459 CTTAATTATAACTATATTTCTGG - Intergenic
934465207 2:94256785-94256807 ATTAATAATTAGTCTGTTGCTGG - Intergenic
934929882 2:98413326-98413348 CTTAAGATTTACAATGTTGCAGG + Intergenic
935452281 2:103223715-103223737 CTTAATAAGAAATATGAGGCCGG + Intergenic
936998607 2:118440798-118440820 AATAATAATAACTATTTTGTGGG + Intergenic
937946531 2:127343625-127343647 AATAATTATAACTGTGTTGCTGG + Intronic
939632348 2:144540195-144540217 CTTAATCATATCAATGTTGCAGG + Intergenic
941041538 2:160628870-160628892 CTTTATGATACCTGTGTTGCAGG + Intergenic
943265167 2:185721256-185721278 ATAATTAATAACTATGTTACTGG + Intergenic
943619222 2:190129406-190129428 TTTAAAAATAAGTATGTTGAGGG - Intronic
943717727 2:191170733-191170755 GATAATAATAACTACGCTGCAGG - Intergenic
945078149 2:206060854-206060876 CTTAATAAGTACTAAGTTGCCGG - Intronic
946568386 2:220993687-220993709 CTTAATAATAACTTTCTTAGAGG - Intergenic
947840664 2:233205656-233205678 CTTAATAATAACAATGAGGCTGG - Intronic
947955910 2:234191210-234191232 ATTAAAAATAAATAAGTTGCTGG + Intergenic
1170243799 20:14198085-14198107 CTTTATAACAACTTTATTGCAGG + Intronic
1174727059 20:52873791-52873813 CTTAAAAAGAACTTTGGTGCAGG + Intergenic
1176596235 21:8699991-8700013 ATTAATAATTAGTCTGTTGCTGG - Intergenic
1176694145 21:9953392-9953414 TTTAATAATACCTATTATGCTGG + Intergenic
1176895548 21:14374431-14374453 GTTAAAAATAACTGTGTTGCTGG + Intronic
1177309489 21:19371286-19371308 TTTAATAATAACCATTCTGCTGG - Intergenic
1177700726 21:24635918-24635940 CTTTATAATAGTGATGTTGCCGG - Intergenic
1178120405 21:29464064-29464086 CCTAATAAGAAATATGTGGCCGG - Intronic
1178556384 21:33594121-33594143 CTTAATAATTACAATGTTATTGG + Intronic
1180279146 22:10677445-10677467 ATTAATAATTAGTCTGTTGCTGG - Intergenic
1180482534 22:15767793-15767815 ATTAATAATAACAATGTTGAGGG + Intergenic
1180586360 22:16895972-16895994 ATTAATAATTAGTCTGTTGCTGG - Intergenic
1182730308 22:32484425-32484447 CTGCATAATACCAATGTTGCTGG + Intronic
1184612014 22:45610285-45610307 CCTAATAATTACTACCTTGCAGG + Intergenic
951838740 3:27010756-27010778 CTTAATACTTACTATGTTCCAGG - Intergenic
952087716 3:29846873-29846895 TTTAAAAAGAACTATGTTGTGGG + Intronic
952620603 3:35336004-35336026 CTTAAAAATTACTTTGTTGTAGG + Intergenic
954975830 3:54693479-54693501 CTTGATGATAACTATGTTACTGG + Intronic
957515690 3:81247959-81247981 CTTGATAATAACTATGTTACTGG + Intergenic
957589766 3:82180822-82180844 CTTAATATGAACTATGCAGCTGG + Intergenic
957682358 3:83453092-83453114 ATTAATAAGAAGTATGATGCTGG - Intergenic
960129438 3:114039134-114039156 GATAATAACAACTATGTTACTGG + Intronic
962591282 3:136891722-136891744 TTTAATAATAACCATGGTGATGG + Intronic
962703548 3:138021967-138021989 AATAATAATAACAATGGTGCTGG + Intronic
963826663 3:149962720-149962742 TTTAATAATAATTATTTTGAAGG - Intronic
965832065 3:172802594-172802616 TTTAAAAATAACTATTTTTCAGG + Exonic
966218490 3:177527239-177527261 CTCAATATGAAATATGTTGCTGG + Intergenic
966626037 3:182018167-182018189 TTTAATAATATTTATGTTGTTGG - Intergenic
966842544 3:184101231-184101253 CTTAAAAATATCGATGTGGCCGG - Intronic
967429950 3:189370791-189370813 CTTACAAATAACTATTTTCCTGG + Intergenic
967543596 3:190697410-190697432 CATAAGAATTATTATGTTGCAGG - Intergenic
970550981 4:17180937-17180959 ATAAAAAATAACTATGTTACTGG + Intergenic
970632118 4:17959127-17959149 CTTAATAATAAATAGGTTGTAGG - Intronic
970892937 4:21067875-21067897 CTTGATAATATTTATGTTGATGG - Intronic
972959264 4:44432250-44432272 CTTAATTATATCTATGTTGTAGG - Intronic
973276107 4:48311364-48311386 TTTAAAAATACCTATGATGCTGG + Intergenic
973974318 4:56246866-56246888 ACTAATAATAACAATGTTGGGGG - Intronic
975114492 4:70663926-70663948 ATTAATAATAACAATGATGTTGG + Intronic
975486660 4:74941175-74941197 CTTAAAAATTACAATGTTGATGG + Intronic
977244777 4:94618479-94618501 TTTAATAACAACTATATTGTTGG + Intronic
977596686 4:98889978-98890000 CTTAATAATAACTACATTTAAGG - Intronic
977801378 4:101237508-101237530 CTTAAAAATACATATATTGCTGG - Intronic
978728879 4:112001598-112001620 ATTAATAATAAATATATGGCAGG + Intergenic
979700638 4:123663367-123663389 CTCAATAATAATTTTGTTGCTGG - Intergenic
979901684 4:126227914-126227936 TTTAATAATAACATTGTAGCTGG - Intergenic
980539391 4:134174356-134174378 CTTGATAATAAATATGTTACTGG - Intergenic
980743538 4:136984328-136984350 AGCAATAATAACTATGTAGCAGG - Intergenic
981173868 4:141657896-141657918 CTTGATTATAACTATGTTGCTGG - Intronic
982440507 4:155430454-155430476 ATTAATAAAAATTAGGTTGCAGG + Intergenic
982833989 4:160099472-160099494 CATAATAATATCTACCTTGCAGG + Intergenic
985097239 4:186425217-186425239 GTTAATAATGACTATGTAACTGG - Intergenic
987540986 5:19255662-19255684 CTTCATAATAAATCTGCTGCAGG + Intergenic
988278320 5:29112693-29112715 CTTTATAATATCTATTTTTCTGG + Intergenic
988371763 5:30379269-30379291 CTTAATAATAACTCTGAAGGAGG - Intergenic
988822251 5:34898854-34898876 CTTAATAGTAACTGTGTTTCTGG + Intronic
988842816 5:35099458-35099480 CTTGATAATAACTATGTTACTGG + Intronic
988997263 5:36726200-36726222 CTTAATATTAACCACGTGGCAGG + Intergenic
990027229 5:51208347-51208369 CTGAGTAATAGTTATGTTGCGGG - Intergenic
990229200 5:53692584-53692606 GATAATGATAACTATGTTACTGG - Intergenic
990813944 5:59761839-59761861 CTTAATAATAACTATGTTGCTGG - Intronic
990830002 5:59945685-59945707 CATAAAAATAACCATCTTGCTGG + Intronic
991319410 5:65353152-65353174 TTTAATATTAACAATGTTTCTGG - Intronic
991554615 5:67881389-67881411 TTTAAGAATAACTTTGTTGTGGG + Intergenic
993014185 5:82517095-82517117 CTTAATAATAAATTTGTTTCTGG + Intergenic
993278248 5:85890409-85890431 ATTAATAAATACTATGTTTCTGG + Intergenic
994062090 5:95489829-95489851 CTTCAAAATAACTATGTTATAGG + Intronic
995356981 5:111249962-111249984 GTTAATAATACCTATCTAGCAGG - Intronic
996499086 5:124196681-124196703 CTTAATAATTACTATCTCTCAGG - Intergenic
998439640 5:142146951-142146973 CTTAGTAATAATAATGTTGTAGG + Intronic
998491376 5:142550230-142550252 CTGAATACTTACTATGTTCCAGG + Intergenic
998956197 5:147440975-147440997 GTTAATAATAACTATGATCTCGG + Intronic
999580555 5:153033783-153033805 CCTAATAATGAATTTGTTGCAGG + Intergenic
1000323655 5:160155527-160155549 CATAAAAATACCTATGTTACAGG - Intergenic
1003996443 6:11545655-11545677 CTTGATAACAACTGTGTTACTGG + Intronic
1004597577 6:17114898-17114920 GTAAATAAAAACAATGTTGCAGG - Intronic
1008725723 6:54416134-54416156 CATTATAATAACTATGTTAAAGG - Intergenic
1008917298 6:56802048-56802070 CTTAATAATTATTATGTGGACGG - Intronic
1009360473 6:62804685-62804707 GTAATTAATAACTATGTTGAGGG - Intergenic
1010466575 6:76174062-76174084 AATAATAATAGCTATGTTTCAGG + Intergenic
1011998218 6:93620142-93620164 CTTATTAAAAAGTAAGTTGCTGG - Intergenic
1014501949 6:122202634-122202656 GATACTAATAACTATGTTACTGG - Intergenic
1014641274 6:123913934-123913956 CTTAATATTTACTATGTGCCTGG + Intronic
1017655867 6:156629074-156629096 CTTGATAATAAATATGTTACTGG + Intergenic
1017666200 6:156722235-156722257 CTTAAAAACAACTATTTTGCTGG - Intergenic
1018496454 6:164351312-164351334 TTTATTAATAACTTTGATGCTGG - Intergenic
1018862803 6:167723104-167723126 CGTAATAAAAACTTTCTTGCGGG - Intergenic
1021002514 7:15350106-15350128 ATTCATAATAACTGTGTTTCTGG + Intronic
1021174349 7:17433835-17433857 CTTAAAAATAAAAATGTTGTAGG - Intergenic
1021243216 7:18230844-18230866 CTAAAAAATAATTATGTTGTTGG - Intronic
1021254540 7:18375010-18375032 CTTGATAATAATTATGTTACTGG + Intronic
1022056504 7:26741218-26741240 TTTAAAAATAACTAAGTGGCCGG + Intronic
1022296378 7:29058374-29058396 ATTAATCATAACAAGGTTGCAGG - Intronic
1022430920 7:30319328-30319350 CTGAATACTTACTATGTTGCAGG + Intronic
1026240204 7:68567292-68567314 AATAATAATACCTATATTGCTGG + Intergenic
1028237190 7:88376406-88376428 GTTAATATTAAGTATCTTGCAGG - Intergenic
1028633971 7:92966626-92966648 CTTGATAAAAATTATGTTGGAGG + Intergenic
1030981950 7:116196564-116196586 AATGATAATAACTATGTTACTGG - Intergenic
1031273709 7:119689523-119689545 CATGATCAGAACTATGTTGCTGG + Intergenic
1031753607 7:125610673-125610695 ATTAATAAAAACTATGTGTCTGG + Intergenic
1032123204 7:129171684-129171706 CTTCATAATAAATATGTGCCTGG - Intergenic
1032598347 7:133265789-133265811 CTTAATGCTAACTATTCTGCAGG + Intronic
1032703256 7:134400259-134400281 CTTAAAAATAACAATGGGGCTGG + Intergenic
1033203812 7:139398945-139398967 CTTAATCATTACTATTTTGTTGG - Intronic
1033480614 7:141736654-141736676 ATTAATAATGACTATGTCACTGG + Intergenic
1033535327 7:142307058-142307080 GTAAATAGTAACTATTTTGCTGG + Intergenic
1034670298 7:152852660-152852682 CTTAAGAATTACTATCTTGGAGG - Intronic
1034915053 7:155031655-155031677 CTTAATATTAGCTATTTTGTTGG - Intergenic
1035934486 8:3821290-3821312 AATAATAATGACTGTGTTGCTGG - Intronic
1036089155 8:5646558-5646580 ATTAATAATAATTGTGTTTCTGG - Intergenic
1036935850 8:13002102-13002124 CTTAAAAATAACTATCTTTTAGG + Intronic
1037138568 8:15493100-15493122 GTTAATAATATCTACCTTGCAGG - Intronic
1037744688 8:21633329-21633351 CATAATAATATCTACTTTGCAGG - Intergenic
1038149118 8:24927022-24927044 CTTAATAATCACCATGTTCCTGG + Intergenic
1038979413 8:32740955-32740977 ATTAATAATAATTATGATGATGG + Intronic
1041705943 8:60846286-60846308 CTTAATATTACCTCAGTTGCTGG + Intronic
1042408526 8:68434639-68434661 GTTAATTATAATTTTGTTGCTGG - Intronic
1044439621 8:92208307-92208329 GTTAATACAAACTTTGTTGCAGG - Intergenic
1044957966 8:97501537-97501559 GATAATAACAACTATGTTACTGG - Intergenic
1045008982 8:97941469-97941491 CTTAATAATACCCATGTGGTGGG - Intronic
1045274058 8:100685801-100685823 CTTTATAATTACTATGTTGTAGG - Intronic
1046224786 8:111263606-111263628 CTTTATAATAGTTATGTTCCAGG + Intergenic
1049127175 8:140802011-140802033 CTGGATAATGACTATGTTACTGG + Intronic
1050846039 9:10220256-10220278 ATTTATACTTACTATGTTGCAGG + Intronic
1051305831 9:15708141-15708163 CTTAATAATCAGTATTTTGGGGG - Intronic
1051343587 9:16132733-16132755 GATAATAATAACTACTTTGCAGG + Intergenic
1051975882 9:22948002-22948024 CTTAATACTCACTATGTGCCAGG + Intergenic
1051990934 9:23152414-23152436 ATTCATAATATCTATGTTGAGGG - Intergenic
1052660875 9:31429431-31429453 CTTAATAATATCAAAGTTGGTGG + Intergenic
1053642496 9:40098741-40098763 CTTAATAATGAGTTTGTTGCCGG + Intergenic
1053695276 9:40633571-40633593 ATTAATAATTAGTCTGTTGCTGG - Intergenic
1053763656 9:41366757-41366779 CTTAATAATGAGTTTGTTGCCGG - Intergenic
1053942273 9:43264613-43264635 ATTAATAATTAGTCTGTTGCTGG - Intergenic
1054306520 9:63432797-63432819 ATTAATAATTAGTCTGTTGCTGG - Intergenic
1054323353 9:63696009-63696031 CTTAATAATGAGTTTGTTGCCGG + Intergenic
1054405261 9:64756785-64756807 ATTAATAATTAGTCTGTTGCTGG - Intergenic
1054438886 9:65242274-65242296 ATTAATAATTAGTCTGTTGCTGG - Intergenic
1054491519 9:65779671-65779693 ATTAATAATTAGTCTGTTGCTGG + Intergenic
1054542264 9:66277903-66277925 CTTAATAATGAGTTTGTTGCCGG - Intergenic
1055022551 9:71685683-71685705 CATAAAATTACCTATGTTGCTGG + Intronic
1055727057 9:79241828-79241850 ATTAATATCAACTATGTTGAGGG + Intergenic
1055832183 9:80393215-80393237 GATAATAAGAACTATGTTACTGG - Intergenic
1058263304 9:102864682-102864704 TTTAATAATAATTATGTCTCTGG - Intergenic
1058789328 9:108426001-108426023 CTTAATATTAACTATGTACTTGG - Intergenic
1059636693 9:116178406-116178428 GTTAATAATAAATATCTTTCCGG - Intronic
1060021171 9:120132593-120132615 CATAATAATAACAATGTAACAGG + Intergenic
1060677729 9:125530967-125530989 GGTAATAATACCTATCTTGCAGG - Intronic
1062589938 9:137269432-137269454 GTTATTTATAACTATGTTCCCGG - Intronic
1202777720 9_KI270717v1_random:7188-7210 ATTAATAATTAGTCTGTTGCTGG - Intergenic
1187611303 X:20946640-20946662 CTGAATATTAACTATGCTGTGGG + Intergenic
1187672674 X:21684351-21684373 CTTAATAAGCACAATGTTGGAGG + Intergenic
1188057177 X:25554698-25554720 CTTTATAATAACTCTCTTCCAGG - Intergenic
1189729241 X:44001575-44001597 CTAAATAATAAATGTGTTGTAGG - Intergenic
1190535849 X:51427107-51427129 CTAAATGATACCTATGCTGCTGG - Intergenic
1195387930 X:104330626-104330648 CTTGATAATAACTCTTTTCCAGG + Intergenic
1195635717 X:107113604-107113626 ATTAATAGTAGCTATGTTACAGG - Intronic
1196266225 X:113650304-113650326 CTTAATAATAATTACTTTGGTGG - Intergenic
1197409444 X:126097517-126097539 CTAATTAATCACTATGTTCCTGG - Intergenic
1197521752 X:127507216-127507238 TATAATAATAACTATATTTCAGG + Intergenic