ID: 990817245

View in Genome Browser
Species Human (GRCh38)
Location 5:59799265-59799287
Sequence AGTTAACTGCAGAGAATGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 3, 3: 72, 4: 416}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990817245 Original CRISPR AGTTAACTGCAGAGAATGAC TGG Intronic
900434958 1:2625576-2625598 AGTTAACTGCAGAAGATAGCAGG - Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
902822772 1:18953654-18953676 AGTTAACTTCAGAAAATAAATGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904275677 1:29382741-29382763 AGATAACAGCAGAAAATGAAGGG - Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904461078 1:30680126-30680148 TGAGAGCTGCAGAGAATGACAGG + Intergenic
904610221 1:31721724-31721746 AGTTAGCTGGAGAGGATGATGGG - Intergenic
905254563 1:36671863-36671885 GGTTGTCTGCAGAGCATGACTGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
906256704 1:44355893-44355915 AGCTTACTGGAGAGACTGACTGG - Intergenic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
909831779 1:80201298-80201320 AATTAAATACAGATAATGACAGG - Intergenic
910017792 1:82548511-82548533 AGTTAGCTGCACAGCATGAAGGG + Intergenic
910146749 1:84088686-84088708 AGTTCAATTCATAGAATGACAGG + Intronic
910212904 1:84812133-84812155 AGGTAACTGAAGATAAGGACTGG + Exonic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911981900 1:104579264-104579286 AGTTATCTGCAAAGTATGGCAGG + Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
915527081 1:156482635-156482657 AGTCACCTGCAGAGAAGGATGGG + Exonic
917064486 1:171076743-171076765 AGTCATCTGCTGAGAATGAGTGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917684172 1:177399056-177399078 AATTAAGAACAGAGAATGACAGG - Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
921528130 1:216243663-216243685 AGTTCCCTGTAGAGAAGGACAGG + Intronic
921677606 1:217993649-217993671 AGCTCACTGCAGAGGATGAACGG - Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923302303 1:232652552-232652574 AGTTGACAGCAGAAAATCACAGG - Intergenic
923681289 1:236120908-236120930 AGGTCACTGCAGAGAAGGAAAGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1062791798 10:311429-311451 AGTTGAGTGCAGAGATTGGCCGG - Intronic
1063168410 10:3484512-3484534 AATTAACTGCAGGGCTTGACGGG + Intergenic
1063632474 10:7746877-7746899 CGTTAAATGCAAATAATGACTGG + Intronic
1064070570 10:12225570-12225592 AGTTAACTGAATATAAAGACAGG + Intronic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1066746891 10:38610035-38610057 AGTTCACAGCAGAGAGTGAGAGG + Intergenic
1066957621 10:42188051-42188073 AGTTAACTGGAGAAGATGACCGG - Intergenic
1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1067923016 10:50479039-50479061 AGGTAACTGCAGACAAAGAAGGG - Intronic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069851869 10:71410650-71410672 AGTTAACTTCAGAGGATGACGGG - Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082739916 11:56899529-56899551 AGTTAATTCTAGAGAAGGACAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1084992747 11:72943546-72943568 AGGAAATTGAAGAGAATGACAGG + Intronic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1087150440 11:94854898-94854920 TGTTACCAGCAGAGAAGGACAGG - Intronic
1087389223 11:97513284-97513306 AATTAAATGCAAAGAATGCCTGG + Intergenic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089015123 11:115159372-115159394 GGTTGACTGCAGAGAGTGACAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090436205 11:126688567-126688589 AGCTTTCTGCAGAGAATGATTGG + Intronic
1091682778 12:2539034-2539056 AGTAAATGGCAGAGAATGACAGG - Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092440755 12:8499845-8499867 ATTTAACTGCAGAGGAAGAAGGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093049672 12:14490990-14491012 AGTTACCTGCAAAAGATGACAGG + Intronic
1093495045 12:19747029-19747051 AGATAACTGCTGAGAAAAACTGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094819396 12:34212699-34212721 GGTTATCTGCAGATAATGGCAGG - Intergenic
1095095414 12:38145375-38145397 GGTTATCTGCAGATAATGGCAGG + Intergenic
1095121508 12:38424871-38424893 AGTTTTCTGCAGAAAATGCCAGG + Intergenic
1095368163 12:41433435-41433457 ATTTAACTGCAGAAAATGTTAGG + Intronic
1095394095 12:41742892-41742914 AGCTAGCTGCAGAGAGTCACAGG + Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097231795 12:57516899-57516921 AGCTAGCTGAAGAGAATGAACGG - Exonic
1097424903 12:59431902-59431924 TGTTTACTACAGAGAATGAAAGG - Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099821351 12:87715107-87715129 AGTCATCTGCAAAGAATGGCAGG + Intergenic
1099995069 12:89769557-89769579 AGTTATCTGAAGAGGATGGCAGG + Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100179540 12:92070496-92070518 AATTAACCGAAGGGAATGACTGG - Intronic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100702842 12:97166194-97166216 ACTGAACTGCTGAGAATCACTGG - Intergenic
1100912692 12:99383423-99383445 AGGTGACTGCAGAGATTGGCAGG - Intronic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102414984 12:112753469-112753491 GGTTAACTGCAGAGGGTGATGGG + Intronic
1102472399 12:113166932-113166954 AGTTAAGAGCAGAGGATGCCGGG + Intronic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103396526 12:120611420-120611442 AGTTACCTGCAGAACATGTCAGG - Intergenic
1104985490 12:132594258-132594280 AGTTAAGAGCAGAGATTGCCAGG + Intergenic
1105033330 12:132900520-132900542 AATTATCTGCAGACAATGTCAGG + Intronic
1106438102 13:29741540-29741562 AGTGCACTGCAGAGATGGACAGG - Intergenic
1106610056 13:31270216-31270238 AGATTCCTGCAGAGAATGAGAGG - Intronic
1106906595 13:34415854-34415876 AGTAACCTGCAGAGCATCACAGG + Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108371985 13:49779336-49779358 CGTTAACTATAGAGAATGAAGGG - Intronic
1110356326 13:74571929-74571951 AATTTTCTGCAGAGAATGCCAGG - Intergenic
1110688352 13:78401965-78401987 AGTGGACTGCAGAAAAGGACTGG - Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111843389 13:93477501-93477523 GGAAAACTGAAGAGAATGACTGG + Intronic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1113248962 13:108429847-108429869 AGTAAACTGCAGATTATGAGGGG - Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115354653 14:32434547-32434569 AGTGACCTGCAGAGCAAGACAGG + Intronic
1115998974 14:39222858-39222880 AGTCAACTGCTCAGATTGACTGG + Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117001597 14:51376285-51376307 AGTTATCTGCAGAAGATCACAGG - Intergenic
1117101640 14:52354707-52354729 AGGTGACTGCAAAGAATTACTGG - Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1117734808 14:58757601-58757623 ATTTTACTGCAGAGAATGTATGG - Intergenic
1117980286 14:61336170-61336192 AGTTAACTTCAGAAAAGGGCTGG - Intronic
1118485799 14:66213548-66213570 GGATTACTGCAGAGAATGAATGG - Intergenic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119107566 14:71938866-71938888 AGTTACCTGCAGAAGATGACAGG + Intronic
1119555773 14:75551222-75551244 AGATAAATGCAGAGGATGGCAGG - Intergenic
1120004036 14:79336573-79336595 AATTAACTTCAGATACTGACAGG - Intronic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120252202 14:82071496-82071518 ACAGATCTGCAGAGAATGACAGG - Intergenic
1120979897 14:90280226-90280248 AGTTAACGGTTGAGAAGGACTGG - Intronic
1121634622 14:95445614-95445636 AGTCTTCTGCAGAGAGTGACAGG - Intronic
1123908503 15:24943681-24943703 AGTTAACTACAGAGGATAGCAGG + Intronic
1126898839 15:53290146-53290168 AGTTAGCAGCAGAGAATGTCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1128484386 15:68070520-68070542 ACTTTACTTCAGTGAATGACAGG + Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1132852024 16:2029080-2029102 ACTGCACGGCAGAGAATGACGGG + Intronic
1133711887 16:8409474-8409496 AGTTAGCTGCAGAGAAGTCCAGG - Intergenic
1135471733 16:22737207-22737229 GTTTAACTGTTGAGAATGACAGG + Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1136736173 16:32469607-32469629 AGTTCACAGCAGAGAGTGAGAGG - Intergenic
1138818600 16:60231347-60231369 AGTAAATTGCAGAGAAGCACAGG + Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1140051267 16:71483542-71483564 AGATTACTGGAGAGAATGGCAGG - Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1203016899 16_KI270728v1_random:359967-359989 AGTTCACAGCAGAGAGTGAGAGG + Intergenic
1203035234 16_KI270728v1_random:633125-633147 AGTTCACAGCAGAGAGTGAGAGG + Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156064455 18:33122746-33122768 AAGTAACTGCAGCTAATGACTGG + Intronic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156991492 18:43414079-43414101 AGATAACTGTTGAGAAGGACGGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1159657313 18:71047571-71047593 ATTTAAAAGCAGAGATTGACAGG - Intergenic
1161009188 19:1951974-1951996 AGAAAACAGCAGAGAATGGCCGG - Intronic
1163051196 19:14685397-14685419 AGTCAACAGCAGAGAAGGAAGGG + Intronic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1165383072 19:35494717-35494739 AGATGACTTCAGAGAAGGACAGG + Intronic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925813545 2:7724888-7724910 AGATAAAGGGAGAGAATGACTGG + Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930320859 2:49853217-49853239 AGTTAAATGCAGAAAATTAAAGG - Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
934187337 2:89758721-89758743 AGTTCACAGCAGAGAGTGAGAGG - Intergenic
934305739 2:91820565-91820587 AGTTAACTGGAGAAGATGACCGG - Intergenic
934309295 2:91849217-91849239 AGTTCACAGCAGAGAGTGAGAGG + Intergenic
934327517 2:92032177-92032199 AGTTAACTGGAGAAGATGACCGG + Intergenic
934465906 2:94262756-94262778 AGTTAACTGGAGAAGATGACCGG + Intergenic
935148528 2:100413188-100413210 AGTTAATTACAGAAAATGCCAGG - Intronic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935643121 2:105309280-105309302 AGAGGACTGCAGAGAATGACGGG + Intronic
936665334 2:114588200-114588222 AAATAATTGGAGAGAATGACAGG + Intronic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940443303 2:153745506-153745528 AATTACCTGCCGAGAATGAGAGG - Intergenic
941526845 2:166616717-166616739 AATTAAATACAGAGAATGCCAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942951282 2:181724869-181724891 TGTTTACTGCAAAGAAAGACAGG - Intergenic
942987905 2:182163965-182163987 AGTTATCTGCAGATGATGCCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943299725 2:186183009-186183031 ATTTAACTTCAGAGTATGATAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
944416040 2:199480795-199480817 AGTTATCAGAAGAGAATGCCTGG - Intergenic
944529232 2:200651110-200651132 AGTTCAATGCAGAGAATTATTGG + Exonic
944880887 2:204011955-204011977 AATTCAATGCAGAGAAAGACAGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
946722258 2:222622092-222622114 AATTAACTGCTGTGAAAGACAGG + Intronic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1170008729 20:11697411-11697433 AGTTATCAGCAGCCAATGACTGG - Intergenic
1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG + Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176870521 21:14080129-14080151 GGTTATCTGCAGATAATGGCAGG - Intergenic
1177118763 21:17116411-17116433 AATTAACTGGAGAGAAAGAAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177934459 21:27325927-27325949 AGTTAAGTCAAGAGAATGAGAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180279825 22:10683393-10683415 AGTTAACTGGAGAACATGACCGG + Intergenic
1180391301 22:12285061-12285083 AGTTAACTCCAAAGAGTGAGGGG - Intergenic
1180408439 22:12579692-12579714 AGTTAACTCCAAAGAGTGAGGGG + Intergenic
1180536378 22:16396327-16396349 AGTTCACAGCAGAGAGTGAGAGG + Intergenic
1180587041 22:16901929-16901951 AGTTAACTGGAGAAGATGACCGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181420650 22:22795802-22795824 AGTTATCTGTAGAGGATGGCAGG - Intronic
1182650386 22:31846877-31846899 AGTTGACTCCAGAGAATGCGTGG - Exonic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951571105 3:24064220-24064242 AGTTAACTGCAGAGTGTGGCAGG + Intergenic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952870480 3:37895890-37895912 AGTGAACTGTAGTTAATGACAGG + Intronic
953321489 3:41976365-41976387 AATTATCCGCAGAGAATGAGGGG + Intergenic
954363312 3:50133748-50133770 AGTTACCTGCAGATGAGGACTGG - Intergenic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
955126890 3:56121577-56121599 ATTTAACTGCACAGAATGCCTGG - Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
960349526 3:116575671-116575693 AGTTATCTTCAGAAAATGGCAGG - Intronic
963630307 3:147723190-147723212 AGTTATCTGCAGAAGATTACAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965568159 3:170143342-170143364 AGTTAACTGTAGAGAATGCCAGG + Intronic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966578067 3:181525812-181525834 ATTTTCCTGCTGAGAATGACTGG - Intergenic
966734923 3:183180623-183180645 AGTTCACTGCAGAGAGAGGCAGG - Intronic
966976639 3:185090149-185090171 AGTTAAGGGCAGAGAATGACAGG - Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
970156743 4:13149701-13149723 AGGAAACTGCAAAGAATCACTGG - Intergenic
970569636 4:17367045-17367067 AGTTCATTGCATGGAATGACTGG + Intergenic
970645055 4:18110189-18110211 AGTGCACTGCAGAGTATAACAGG - Intergenic
970941614 4:21640944-21640966 AGTTATCTGCAGAGAGTGGCAGG - Intronic
971419907 4:26465742-26465764 AGGGAATTGCAGAGAATGAATGG - Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972379751 4:38508351-38508373 AGTTAACTACAGAGCATAAAGGG + Intergenic
972805913 4:42529297-42529319 AGTTACCTGCAGATTATGGCAGG - Intronic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973919462 4:55670265-55670287 AGTTCTCTGCAGACACTGACTGG + Intergenic
974289565 4:59912712-59912734 AGTTAACTGTAGAAGATGGCAGG - Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
976253669 4:83078822-83078844 GGATAACTGAAGTGAATGACTGG + Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978282927 4:107038047-107038069 AGTTAAATGCATAGAATCAAAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980617481 4:135249770-135249792 TGTTAACTACAGAAAATGAAAGG + Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981028241 4:140097671-140097693 AGTTAAGTGGACAGAATGATGGG + Intronic
981110193 4:140926104-140926126 CGGTAACTGCAGAGAATACCTGG + Intronic
981599135 4:146465764-146465786 TAAGAACTGCAGAGAATGACTGG - Intronic
982354484 4:154451268-154451290 AGTTGTCTGCAGAGAATGGCAGG - Intronic
982463646 4:155703431-155703453 AGTTAAGGGCAGAGAGTCACTGG + Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983008615 4:162517757-162517779 ACTTAACTGCAGAATATCACTGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983339033 4:166434439-166434461 AGTTATCTGCAGAGAATGGAAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983840423 4:172450864-172450886 GGTTAACATGAGAGAATGACTGG - Intronic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984587670 4:181581667-181581689 AGTTCACCGCACAGAATAACAGG - Intergenic
984914961 4:184714330-184714352 AGTGAACTGGAGAGAGGGACAGG + Intronic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987504385 5:18749824-18749846 AGTTAACTACAGAAGATGACAGG - Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988258173 5:28848511-28848533 AGTTACGTGCAGATAATGACAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
990817245 5:59799265-59799287 AGTTAACTGCAGAGAATGACTGG + Intronic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991272893 5:64806889-64806911 AGTTAACTTCAGAGACTCGCTGG - Intronic
991507213 5:67337857-67337879 AGTTAAATGAAGAAAATGTCAGG + Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995382344 5:111549125-111549147 AGTTAAGTGCTGAAAATGACTGG - Intergenic
995945477 5:117639788-117639810 AGCTGACTACAGAGGATGACAGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
998564130 5:143201072-143201094 AGTGAATTTCAGAGACTGACTGG + Intronic
999051113 5:148524755-148524777 AGTGAACTGCATAAAATGAGGGG - Intronic
1000621622 5:163492964-163492986 AGTTATCTGCATAGGATAACAGG + Intergenic
1001022019 5:168191135-168191157 AATAAACTGGAGAGAATGAGGGG - Intronic
1001108760 5:168877827-168877849 ACATAACTGCTGAGAAAGACAGG + Intronic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002808787 6:604894-604916 AGTTGAGTGCAGAGAATACCAGG - Intronic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1004074876 6:12335980-12336002 AGTTAATTGCAGAATAGGACAGG - Intergenic
1004168475 6:13277005-13277027 ATTTAACGGCTGAGAATCACAGG + Intronic
1004301906 6:14466223-14466245 AGGTGACTGCAGGGAAGGACTGG + Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1007079014 6:39085595-39085617 ATTTAACGGAAGAGAATGAGAGG - Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010014898 6:71093154-71093176 AGTTCAGTGCAGAGAGTGAAGGG - Intergenic
1010389203 6:75318007-75318029 AGATAACGGGAGAGACTGACTGG - Intronic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011821017 6:91254267-91254289 TGTTAACTGCACAGAAAGCCTGG + Intergenic
1012171957 6:96027682-96027704 AGTTCACTGCACAGAAGGAAAGG - Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013429694 6:110044335-110044357 TGTTAACCACAGAGTATGACAGG + Intergenic
1013573075 6:111449392-111449414 AGAGAACTGCAGAGACAGACAGG + Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015525005 6:134167751-134167773 AGTCAACAGCAGAGCATGACCGG + Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016576261 6:145572615-145572637 AGTTATCTGCAGAAAACGGCAGG + Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1018978774 6:168585381-168585403 TGTAAATTGCAGAGAATGAATGG - Intronic
1020397209 7:7729759-7729781 AGACCACAGCAGAGAATGACTGG - Intronic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021054179 7:16026687-16026709 AGTGGAATGCAGAGAAAGACGGG + Intergenic
1021289100 7:18821647-18821669 AATTATCTGCAGACACTGACTGG + Intronic
1023314398 7:38920457-38920479 ACTTATCTGCACAGAATGACAGG - Intronic
1023532139 7:41169044-41169066 AGTTAACTTCTGAGATTAACTGG - Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028043857 7:86091437-86091459 AGTTATCTGCAGAAAAGGGCTGG - Intergenic
1028131313 7:87177432-87177454 AGTTAACTCCACAGAAAAACTGG - Intronic
1029589043 7:101495104-101495126 CGTTATCTGCTGAGAATGTCAGG + Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031337575 7:120554867-120554889 AGGTAACTGCAAAGAAGGAAAGG - Intronic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1033271502 7:139936834-139936856 AGGTGATTGCAGTGAATGACTGG + Intronic
1037251747 8:16903342-16903364 ATTTCACAGCAGAGAATGACAGG - Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038416407 8:27399452-27399474 AGTTGACAGCAGAGAATGAAGGG + Intronic
1038577036 8:28713853-28713875 AGCTAACAGCAAAGAATGAGAGG - Intronic
1039620840 8:38996213-38996235 AGGTAAGAGCAGAGGATGACCGG + Exonic
1040857289 8:51961303-51961325 AGTTCCCTGCACAGAGTGACAGG + Intergenic
1041492637 8:58451834-58451856 AGATAACTGAATAGAATGAATGG - Intergenic
1041691333 8:60690864-60690886 ACTGAGCTGCAGAAAATGACAGG - Intronic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042680847 8:71381367-71381389 AGGTTAATGCAGAGACTGACAGG - Intergenic
1043143102 8:76616159-76616181 AGTACACTGAAGATAATGACAGG - Intergenic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044212310 8:89563969-89563991 AGTTCACTGCAGAGATAAACAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1048681764 8:136850585-136850607 AGGCAACTGCAGAGAGTGAAAGG + Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050970754 9:11869676-11869698 AGTTAACTGCAGTTTATGGCAGG - Intergenic
1051796096 9:20872325-20872347 GGTTGACTGCACAGAAGGACAGG + Intronic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1053407752 9:37892240-37892262 AGCTGTCTGGAGAGAATGACAGG + Intronic
1053695960 9:40639533-40639555 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054307207 9:63438751-63438773 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054405940 9:64762743-64762765 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054439566 9:65248230-65248252 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054490841 9:65773709-65773731 AGTTAACTGGAGAAGATGACCGG - Intergenic
1055863527 9:80784478-80784500 AATAAACTGCAGATAATGACAGG - Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1057004945 9:91548846-91548868 AATTATCTGCAGAGGATGAGAGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1061033025 9:128098284-128098306 AGTTAACTGCAGGGAGGGAGCGG + Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1202778407 9_KI270717v1_random:13146-13168 AGTTAACTGGAGAAGATGACCGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1190229876 X:48574083-48574105 GGTTAACATCAGAGAATGGCAGG + Intergenic
1190255269 X:48757773-48757795 AGTTATCTGCAGAGAATAGCAGG - Intergenic
1190479511 X:50861988-50862010 AGTTCATTGCAGAGACTGCCAGG + Intergenic
1190527882 X:51346279-51346301 AGTTATATGCAGAGCATGGCAGG + Intergenic
1191631292 X:63324848-63324870 ATTTATCTTCAGATAATGACAGG - Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191921585 X:66262423-66262445 AGTCATCTGCTGAGAATGAAAGG + Intronic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194155338 X:90380963-90380985 AGTCATCTTCAGAGAATGACAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194521079 X:94919407-94919429 AGTTATCTGCAAAAGATGACAGG - Intergenic
1194649419 X:96497840-96497862 AGTTATCTGTAGATAATGGCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195939663 X:110157592-110157614 TGACAACTGCTGAGAATGACAGG + Intronic
1196088901 X:111717458-111717480 AGCTAACTTCCAAGAATGACTGG - Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197044411 X:121978294-121978316 AGTTACCTGCAGAATATGGCAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG + Intergenic
1197534714 X:127673447-127673469 AGCTAACCACAGAGAATGGCAGG - Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1199008504 X:142730855-142730877 AGTTATCTCCAGAGGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200112543 X:153749156-153749178 AGTTCACAGCAGAGAGTGAGAGG + Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200501688 Y:3957896-3957918 AGTCATCTTCAGAGGATGACAGG + Intergenic
1201193721 Y:11471449-11471471 AGTTAACTGGAGAAGATGACAGG + Intergenic
1201765801 Y:17572653-17572675 GGTTATCTGCAGATAATGGCAGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1201835751 Y:18333336-18333358 GGTTATCTGCAGATAATGGCAGG + Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic