ID: 990818794

View in Genome Browser
Species Human (GRCh38)
Location 5:59814502-59814524
Sequence CCTGCCAGTGAGTCACATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990818790_990818794 20 Left 990818790 5:59814459-59814481 CCAGCTTCCTAAGACACATGTCT 0: 1
1: 0
2: 1
3: 13
4: 151
Right 990818794 5:59814502-59814524 CCTGCCAGTGAGTCACATGCAGG 0: 1
1: 0
2: 0
3: 12
4: 160
990818791_990818794 13 Left 990818791 5:59814466-59814488 CCTAAGACACATGTCTAGAATAT 0: 1
1: 0
2: 1
3: 36
4: 327
Right 990818794 5:59814502-59814524 CCTGCCAGTGAGTCACATGCAGG 0: 1
1: 0
2: 0
3: 12
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990818794 Original CRISPR CCTGCCAGTGAGTCACATGC AGG Intronic
900073674 1:794345-794367 TCTCCCAGGGATTCACATGCAGG - Intergenic
900127179 1:1073779-1073801 CTTGCCAGTGAGTCCCAGACAGG + Intronic
902226011 1:14996819-14996841 CCTCCCAGTGCCCCACATGCAGG - Intronic
903807272 1:26014326-26014348 ACAGCCAGTGAGTAACAGGCTGG - Intergenic
903867938 1:26411928-26411950 CCGGCCAGGGAAGCACATGCCGG + Intronic
907823290 1:57991430-57991452 CCTGCCCCTGAGTCACCTCCTGG + Intronic
912241548 1:107915414-107915436 CCAGCCAGTAAATCACATGGGGG - Intronic
915594711 1:156889850-156889872 CCTGCCAGGAAGGCAGATGCAGG - Intergenic
915902994 1:159859826-159859848 CCTGCCACTGAGTCAGTGGCAGG + Intronic
916025943 1:160833580-160833602 CTGGCCAGTCAGTCACCTGCTGG - Intronic
916303942 1:163307507-163307529 CCTTCCACTGGGTCCCATGCCGG + Intronic
918340742 1:183566244-183566266 ACTGCCATTGAGTCACTTACAGG + Intronic
920739414 1:208566225-208566247 CTAGCCAGTGAGTCACATGGAGG + Intergenic
922269534 1:224019252-224019274 TCTCCCAGGGATTCACATGCAGG - Intergenic
922998418 1:229985235-229985257 CCTGGCTGTGAGTGACATGGTGG - Intergenic
923246108 1:232134052-232134074 TCTGCCTGAGAGGCACATGCAGG + Intergenic
923258640 1:232245076-232245098 CCTGCTACTGTGTCAAATGCTGG - Intergenic
923379911 1:233406616-233406638 CCTGTCAGTGAGTACCAGGCTGG + Intergenic
924776097 1:247115211-247115233 CATGCGAGTGAGTGTCATGCTGG + Intergenic
1063433192 10:6008853-6008875 CCTGCCAGTGATTTTCATGGAGG - Intergenic
1067224361 10:44365841-44365863 GCTGCCAGTCAGCCCCATGCTGG - Intergenic
1067373961 10:45710433-45710455 CTTGCCATTGTGTAACATGCAGG - Intergenic
1067379728 10:45761829-45761851 CTTGCCATTGTGTAACATGCAGG + Intronic
1067717970 10:48704267-48704289 CCTGCCTGTGACTCCCATCCTGG + Intronic
1067887427 10:50102484-50102506 CTTGCCATTGTGTAACATGCAGG + Intronic
1072230552 10:93410832-93410854 CCTGTCAGTCATTCACATCCTGG + Intronic
1076211149 10:128645995-128646017 ACTGCCTGTGTGCCACATGCTGG - Intergenic
1076383073 10:130038376-130038398 CCTGCAAGGGAGCCACAGGCTGG - Intergenic
1078673587 11:13388208-13388230 CTTTAGAGTGAGTCACATGCAGG - Exonic
1079205066 11:18407646-18407668 TTTCCCAGTGAGTCACATCCTGG + Exonic
1079242043 11:18728299-18728321 CTTGCCAGTGCCTCACAGGCTGG + Exonic
1079768520 11:24426888-24426910 CTTGCCAGTGAGTAACATTATGG + Intergenic
1083615152 11:64022436-64022458 CCTGCCAGCTGGTCAGATGCTGG - Intronic
1084672078 11:70613091-70613113 TGTGCCATGGAGTCACATGCTGG + Intronic
1084844327 11:71887584-71887606 CCTGCCAGTGAGGCAAAAACAGG + Intronic
1086965231 11:93020429-93020451 CCTTCCAGTGATTCATAGGCAGG - Intergenic
1093752470 12:22816708-22816730 CCTGCCATTCTTTCACATGCAGG - Intergenic
1096921768 12:55095061-55095083 TCTGCCTGAGAGTCACAGGCAGG + Intergenic
1097055322 12:56245592-56245614 ACTGCCTGTGAGTAACATGGGGG + Exonic
1099359884 12:81687078-81687100 CCTCCAAGTGAGTCTGATGCAGG + Intronic
1099369125 12:81808863-81808885 CATGTCAGTGTGTCAGATGCTGG + Intergenic
1108471004 13:50766817-50766839 CCTGCCAGTGATTCTGATACAGG + Intronic
1111336014 13:86824654-86824676 CCTTCCAGTGAGACAAAAGCTGG - Intergenic
1112989677 13:105496961-105496983 CCTGCAAGTGTGTCAGATTCTGG - Intergenic
1113376202 13:109766824-109766846 AGTGCCAGTGGGTCACATGCAGG - Intronic
1113543194 13:111124594-111124616 CCTGTCTGAGAGTCAGATGCAGG - Intronic
1121411010 14:93748365-93748387 CCTGGCCGTTTGTCACATGCGGG - Intronic
1121661589 14:95639294-95639316 CCTGCCAGGCAGTGTCATGCAGG + Intergenic
1122744267 14:103888719-103888741 CCTTCCAGTGAGTTACACGTGGG + Intergenic
1132222466 15:100115238-100115260 CCTGGCTGTGAGTCGGATGCAGG - Intronic
1135190237 16:20348599-20348621 CGTGCCATTGAGCCACATGGGGG + Exonic
1135522277 16:23186653-23186675 GCTGCCAGTGTGTCACTTTCGGG - Intronic
1137868740 16:51929223-51929245 CCTGTCAGTCAGCAACATGCTGG + Intergenic
1138279844 16:55764358-55764380 CCTGGCACTGAGCCGCATGCTGG - Intergenic
1138288652 16:55829290-55829312 CCTGGCACTGAGCCGCATGCTGG + Intronic
1139305782 16:65985076-65985098 TCTGGCAGTCAGTCACATTCTGG + Intergenic
1142148775 16:88503563-88503585 GCTGGCTGTGAGTCAGATGCAGG - Intronic
1142363176 16:89636770-89636792 TCTGCCTGTGAGTCCCAGGCCGG + Intronic
1145976331 17:28986307-28986329 CCTCCCAGGGAGTCCCAGGCTGG - Intronic
1147444085 17:40464262-40464284 CCTGCCAGAGAGGAACATGCTGG - Intergenic
1147790845 17:43013622-43013644 ACTGCCAGGGAGTGTCATGCTGG + Exonic
1152210554 17:79000902-79000924 CCTGGCAGTGCGTCAGGTGCTGG - Intronic
1155382401 18:25238622-25238644 CCTGCCACTGATTCAAATGAAGG + Intronic
1156309825 18:35911655-35911677 CTTGCCAGTGAGGCAAATCCAGG + Intergenic
1156355566 18:36337524-36337546 CCTTCCAAAGAGCCACATGCAGG - Intronic
1160225456 18:77008126-77008148 CCTGCCAGCGCGTCACACACTGG + Intronic
1160734143 19:654154-654176 CCTGCCACTGAAGCACAGGCTGG + Intronic
1163031187 19:14545316-14545338 CCCGCCAGGGAGCCTCATGCTGG + Intronic
1163725384 19:18920482-18920504 ACTGCCAGTGAGTGGCAGGCTGG - Intronic
1164683968 19:30154896-30154918 CCTGCCTGTGAGTTACACACCGG - Intergenic
1164784468 19:30919194-30919216 TCTGCCAGCCAGTCAGATGCTGG + Intergenic
1166099183 19:40560868-40560890 CCACCCTGGGAGTCACATGCTGG + Intronic
1166719868 19:44990681-44990703 CCTGGGAGTGAGGCACTTGCTGG - Intronic
1167489902 19:49786575-49786597 CCTGCCAGAGCGTAACACGCTGG - Intronic
1168233565 19:55048030-55048052 CCAGCCAGTGAGTCTCAACCAGG - Intronic
925971184 2:9107721-9107743 CCGGCCAGTGACTCACACGGCGG + Intergenic
926054375 2:9765772-9765794 CCTTGCAGAGGGTCACATGCTGG + Intergenic
926735376 2:16069802-16069824 CCGGCCAATGAGGCACAGGCTGG + Intergenic
926825484 2:16901706-16901728 CCTGCCAGTCAGTGGCCTGCTGG - Intergenic
927089649 2:19700738-19700760 CTTGCCAGTGGGGCACAGGCAGG - Intergenic
931638265 2:64359957-64359979 GCTGCCAGTGAGACACACTCAGG - Intergenic
932587864 2:73043451-73043473 CATGCCAGTGCTTCACATGCAGG - Intronic
932749611 2:74363086-74363108 CCTGGCAGTGAGTTACCAGCTGG - Exonic
933944764 2:87276401-87276423 CCTGCCTGTTGGTCACATTCTGG + Intergenic
934611033 2:95736626-95736648 CTTGCCAGTTTGTCACATGCAGG + Intergenic
936335447 2:111585178-111585200 CCTGCCTGTTGGTCACATTCTGG - Intergenic
936544372 2:113378201-113378223 CTTGCCAGTTTGTCACATGCAGG + Intergenic
937683487 2:124669533-124669555 ATTGCCATTCAGTCACATGCTGG + Intronic
938399426 2:130976558-130976580 CCAGCCAGTGATTCACAGGGAGG + Intronic
940879181 2:158929392-158929414 CCTGAAAGTGAATCACATTCAGG - Intergenic
943912354 2:193584605-193584627 CCTGCCATTGGGTGACATGTAGG + Intergenic
947133889 2:226957215-226957237 ACTGACAGTGGGTAACATGCAGG + Intronic
948061480 2:235045783-235045805 CCTCCCAGAGAGTCACAGCCAGG + Intronic
1170576301 20:17664229-17664251 CCTGCCTGTGCGTCACTTGGTGG - Intronic
1171419475 20:25008214-25008236 CCTGCCACTGTGCCACGTGCAGG + Intronic
1172639595 20:36432710-36432732 CCTGCCAGAGACCCACCTGCAGG - Exonic
1175731780 20:61359087-61359109 GCTGCCAGGGAGTGAAATGCGGG - Intronic
1176233007 20:64041593-64041615 CCTCCCAGTGCGGCACATGGAGG - Intronic
1176253878 20:64140492-64140514 CCAGCCCGTGAGTCACAGGTGGG - Intergenic
1179123480 21:38570274-38570296 CTTGCCTGTGTGGCACATGCTGG - Intronic
1179558455 21:42195466-42195488 CCTGACTGTCAGTCACAGGCCGG + Intergenic
1180056988 21:45364118-45364140 CCTGCCAGTGAGTCACTCTCGGG + Intergenic
1181293695 22:21818084-21818106 CCTGTCAGTGATTCAGATGGAGG + Intronic
1185012240 22:48320788-48320810 CCTGCCTGGGAGTCCCAGGCAGG - Intergenic
949891272 3:8735062-8735084 CCCTCCAGTGACTCAGATGCTGG - Intronic
955341499 3:58128907-58128929 CCTCCCAGAGAGCCAAATGCCGG + Intronic
955726049 3:61933952-61933974 TCTGCAAGTGAGCCACATGTGGG + Intronic
957125997 3:76161514-76161536 CAAACCAGTGAGTCACATGAAGG + Intronic
959716818 3:109442735-109442757 CCAGCTTGTGAGTCACACGCTGG + Intergenic
961073599 3:123961399-123961421 CCTGCCGGTGGGTGACAAGCCGG - Exonic
961654734 3:128435091-128435113 GCTGCCAGGGAGTCACAGCCAGG - Intergenic
968891604 4:3372280-3372302 CCTGCCAGGGAGGCTCAAGCTGG - Intronic
970234421 4:13944383-13944405 TCTGCCAGTCAGTGACCTGCCGG - Intergenic
971655460 4:29338578-29338600 CATGCCAGTGACTCAAATGCAGG - Intergenic
972085782 4:35213095-35213117 CCTGCCAGAGATTTAAATGCAGG + Intergenic
972447340 4:39157763-39157785 CCTACCAGTGAGTGCCAGGCTGG + Intergenic
983939152 4:173523245-173523267 CCTGCCTGTGAGTCCCACCCAGG - Intergenic
985619599 5:947229-947251 TCTGCCTGTGAGTTCCATGCTGG - Intergenic
990818794 5:59814502-59814524 CCTGCCAGTGAGTCACATGCAGG + Intronic
992331168 5:75718368-75718390 ACTGCCAGTGATTCTGATGCAGG + Intergenic
999384734 5:151146065-151146087 CCTGCAAGTGAGTCCCAGGGTGG - Intronic
1001278331 5:170366960-170366982 CCAGCCAAGGAGTCACCTGCAGG - Intronic
1001677227 5:173528675-173528697 GCAGCCATGGAGTCACATGCTGG + Intergenic
1002870946 6:1166882-1166904 TCTGCCAGTCAGGCACACGCAGG - Intergenic
1003338367 6:5196235-5196257 CCTGCAAGACAGTCACATGAGGG - Intronic
1003461409 6:6332115-6332137 ACAGACAGTGAGTCACTTGCTGG - Intergenic
1004366536 6:15017895-15017917 CCTGCCAGTGAGTCTGAATCTGG - Intergenic
1006501061 6:34459093-34459115 CCTGCCAATGTGTCATATTCTGG + Intergenic
1007375238 6:41451901-41451923 CCTGCCAGTCACCCAGATGCTGG + Intergenic
1014816470 6:125940982-125941004 GTTGGCAGTGAGTCACATTCTGG + Intergenic
1017410820 6:154165958-154165980 CCTGCCAATAATTAACATGCAGG + Intronic
1018765848 6:166932236-166932258 CCTCCGAGTAGGTCACATGCTGG - Intronic
1018977422 6:168575938-168575960 CCTGCCTGTCGGCCACATGCTGG + Intronic
1019161832 6:170074094-170074116 CCCTGCAGTGACTCACATGCAGG - Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019415115 7:923523-923545 CCGGCCTCTGAGTCACAGGCTGG + Intronic
1019994541 7:4715652-4715674 CCTGCCAGTCAGTCACAGCAGGG - Intronic
1020277241 7:6632150-6632172 CCTGCCAGTGAGACACACGAAGG + Intergenic
1024288188 7:47778448-47778470 AACGCCAGTGAGTCACATGGAGG + Intronic
1026852672 7:73734976-73734998 CCTGCCAGGGAGTGCCTTGCTGG + Intergenic
1026982326 7:74534107-74534129 CCTGTCACTGAGTAAGATGCAGG + Intronic
1027410649 7:77914121-77914143 CCAGGCATTGAGTCACATGCTGG + Intronic
1027925624 7:84459140-84459162 CATGACAGTAAGTCACATGTTGG - Intronic
1028366963 7:90043473-90043495 CATGTCTCTGAGTCACATGCTGG + Intergenic
1029186435 7:98742112-98742134 CCTCACAGTGAGTCCCATGGGGG + Intergenic
1032285959 7:130538640-130538662 CCTGCCAGTACGTTCCATGCAGG - Intronic
1033247083 7:139726736-139726758 CCTTCCAGTTAATCCCATGCAGG - Intronic
1033666493 7:143445623-143445645 GCTGCCAATGAGTCACTTGCAGG + Intergenic
1034050386 7:147977898-147977920 CCTGCCAGTGAGCCAAGTGGTGG + Exonic
1035608383 8:944578-944600 CCACCCACTGAGTCACCTGCAGG - Intergenic
1037296365 8:17405271-17405293 CCTCCCAGTGTTTCATATGCTGG + Intronic
1038411406 8:27362289-27362311 CCTGCCTGTGAGTCACGCCCAGG - Intronic
1041703703 8:60821786-60821808 CCAGATAGTGAGTCACAGGCTGG - Exonic
1042891367 8:73614976-73614998 CCTGCCAATGAGTAAGATGTGGG + Intronic
1046362946 8:113185893-113185915 CTTGCAAGTGAGACAGATGCTGG - Intronic
1049363524 8:142225444-142225466 CCTGCCAGGTGCTCACATGCGGG + Intronic
1053013090 9:34646575-34646597 CCAGTCAGTCAGTCACGTGCTGG + Intronic
1054716277 9:68560326-68560348 CCTGCCAGTTATTACCATGCAGG - Intergenic
1055101486 9:72470289-72470311 CTTGCCACTGAGTCACATGGAGG + Intergenic
1055706805 9:79014391-79014413 TATGCCAATGAGTCACATGATGG + Intergenic
1055789659 9:79910218-79910240 CCTGCCAGTGACTACCTTGCGGG + Intergenic
1057218982 9:93245528-93245550 CCCGCCAGTTAGGCAGATGCTGG + Intronic
1057329357 9:94098285-94098307 ACTGACAGTGAGACACTTGCTGG - Exonic
1062027620 9:134347744-134347766 CCTGCCAGTGAGCCCCACTCTGG - Intronic
1185669868 X:1799351-1799373 CCTTCCACTGAGCCAGATGCTGG + Intergenic
1186123436 X:6386940-6386962 CCTGACAGTTACTCTCATGCAGG - Intergenic
1187767078 X:22654419-22654441 ACTCCCAGTGATTCAGATGCTGG + Intergenic
1190885447 X:54527536-54527558 CCTCCCAGTGATTCTGATGCTGG + Intergenic
1192360283 X:70434711-70434733 CCTCCCCGTGCGTCGCATGCTGG - Intergenic
1194182125 X:90724920-90724942 CCTTCCTTTGAGTCACTTGCAGG + Intergenic
1198127504 X:133660554-133660576 CATGGCAGTGAGTCAGAAGCTGG + Intronic
1198680890 X:139181116-139181138 CCAGACTGTGAGTCACATGAGGG - Intronic
1198764247 X:140064708-140064730 CGTCCCAGTGAGTCCCATGGAGG - Intergenic