ID: 990821408

View in Genome Browser
Species Human (GRCh38)
Location 5:59844767-59844789
Sequence TTATGTATGGAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 295}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990821402_990821408 -8 Left 990821402 5:59844752-59844774 CCCATGATTAGGTTATTATGTAT 0: 1
1: 0
2: 2
3: 35
4: 237
Right 990821408 5:59844767-59844789 TTATGTATGGAGAAGGTGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 295
990821400_990821408 21 Left 990821400 5:59844723-59844745 CCTAATCACGAACAGGATGAACA 0: 1
1: 0
2: 0
3: 8
4: 79
Right 990821408 5:59844767-59844789 TTATGTATGGAGAAGGTGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 295
990821403_990821408 -9 Left 990821403 5:59844753-59844775 CCATGATTAGGTTATTATGTATG 0: 1
1: 0
2: 2
3: 28
4: 308
Right 990821408 5:59844767-59844789 TTATGTATGGAGAAGGTGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990821408 Original CRISPR TTATGTATGGAGAAGGTGGA GGG Intronic
900768343 1:4520453-4520475 TCATATATGGTGGAGGTGGAGGG - Intergenic
900768388 1:4520693-4520715 TCATGTGTGGTGTAGGTGGAGGG - Intergenic
900768393 1:4520717-4520739 TCATGTATGGTGGAGGTGGAGGG - Intergenic
900768426 1:4520861-4520883 TCATGTATGGTGGAGGTGGAGGG - Intergenic
900768457 1:4521005-4521027 TCACGTATGGTGGAGGTGGAGGG - Intergenic
900973358 1:6003437-6003459 CTAAGAGTGGAGAAGGTGGACGG - Intronic
902162538 1:14542944-14542966 TTGGGTATGGAAAAGATGGAAGG + Intergenic
902343169 1:15797854-15797876 TCATGTCTGGACAAGGGGGAGGG + Intergenic
903841200 1:26242151-26242173 TAGGGTATGGAGTAGGTGGATGG + Intronic
904111172 1:28127653-28127675 TAGTGTATGGAGAAGGGGCATGG + Intergenic
904401297 1:30258269-30258291 TGATCTCTGGAGAAGGGGGATGG - Intergenic
905502235 1:38448992-38449014 TTCTCCATGGAGAAGGTGGCTGG + Intergenic
905580438 1:39080161-39080183 TCATGTAGGGAGAAAGCGGATGG - Intergenic
906952290 1:50344726-50344748 TGCTGGATGGAGAAGGGGGAGGG + Intergenic
907143877 1:52214525-52214547 GAATGTATGTAGTAGGTGGATGG + Intronic
907157409 1:52347108-52347130 TTTTTTATGGAGAAGGAGAAAGG - Intronic
907183215 1:52588863-52588885 GTATGTATGCAAAAGTTGGAGGG + Intergenic
908625851 1:66040844-66040866 TAAAGTATGGAGAAAGGGGAGGG + Intronic
908920117 1:69180125-69180147 TGAGTTATGGTGAAGGTGGAGGG - Intergenic
908992622 1:70111814-70111836 TTATGTATGGAGATGGGGGTGGG - Intronic
911519370 1:98910131-98910153 TTTTGTATGGAGAAGGCAAAGGG - Intronic
914726326 1:150330663-150330685 TTTTTTATGGAGAATGGGGATGG + Intronic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
919463305 1:197903237-197903259 GAATTGATGGAGAAGGTGGAGGG + Intronic
919663810 1:200273224-200273246 CTATCTATGGAGGAGGTGAATGG - Intergenic
919858750 1:201724416-201724438 TAAAGTAGGGAGAAGATGGAGGG - Intronic
920813095 1:209305388-209305410 CTAGGTATGGAGAATGTGAAAGG - Intergenic
923049202 1:230378920-230378942 TGATGTATGTACAAGGTGAAAGG + Intronic
924365630 1:243290421-243290443 TTTTCTATGGAGAAATTGGAGGG - Intronic
1065567699 10:27031518-27031540 CTAGGATTGGAGAAGGTGGAGGG + Intronic
1067561580 10:47308314-47308336 TTATGTGTGGAGCATGTTGAGGG + Intronic
1069707417 10:70467486-70467508 TCATGTGTGGAGAAGGGTGAAGG + Intergenic
1071506679 10:86236597-86236619 TGATGTATGCAGGTGGTGGAGGG - Intronic
1071872283 10:89808687-89808709 TGATGTATGGAGAAGTAGGTTGG - Intergenic
1073499334 10:103921747-103921769 TTCTGTAGGGGGAAAGTGGAGGG + Intergenic
1074079007 10:110152684-110152706 TTCTGAATGGGGAAGGAGGAAGG + Intergenic
1074993158 10:118730060-118730082 TTATGTATGGTGGAGGTGGCAGG + Intronic
1075189951 10:120297870-120297892 TTATGTTTGGAAAAGGTGGCCGG + Intergenic
1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG + Intergenic
1076404970 10:130205669-130205691 TTATGAAAGGAGCGGGTGGAAGG + Intergenic
1076648063 10:131967436-131967458 TTACATTTGGAGAATGTGGATGG - Exonic
1077345212 11:2045084-2045106 TAATGTATGGAGAATGAAGATGG - Intergenic
1079014562 11:16857525-16857547 TTCTGTCTGGAGAAAGGGGATGG - Intronic
1080117361 11:28636047-28636069 TTCTGTTTGGAAAAGGTTGATGG + Intergenic
1081209797 11:40318714-40318736 TTCTGTAAAGAGCAGGTGGAGGG - Intronic
1081841551 11:46205323-46205345 TAATGTCTGGAGAATGAGGAGGG + Intergenic
1083689454 11:64398163-64398185 TGATCTGTGCAGAAGGTGGAAGG + Intergenic
1084004581 11:66316273-66316295 GAATGTGTGGAGGAGGTGGATGG - Exonic
1085387059 11:76163532-76163554 TCATGCAGGGAGAGGGTGGAAGG - Intergenic
1085879395 11:80448114-80448136 GTATGTTTGGAGCAGGTGCAAGG - Intergenic
1085900568 11:80695056-80695078 CTATGTATGGAGAAGGAGGTGGG - Intergenic
1086466274 11:87056952-87056974 TTAAGTATGCAGAAGATGGCAGG + Intronic
1088498909 11:110462333-110462355 ATCTGTATGGAAAAGGGGGAAGG - Exonic
1090249569 11:125241983-125242005 GGATGGATGGTGAAGGTGGAGGG + Intronic
1090599250 11:128353406-128353428 TTATTCATGGAGGAAGTGGAAGG - Intergenic
1094468526 12:30780091-30780113 TTATTGATGCAGAAGGTGGCAGG - Intergenic
1095486595 12:42691310-42691332 TAATTTATGGATAAGGTGAAAGG + Intergenic
1095690391 12:45081949-45081971 TTGTGCATGGAGAAAATGGATGG + Intergenic
1096006648 12:48178754-48178776 TAATTTATGGAAAAGATGGAAGG + Intronic
1097325830 12:58276168-58276190 ATATGCTTGGAGAAGATGGAAGG - Intergenic
1098371418 12:69764311-69764333 TTGTATATGGTGAAGGGGGATGG + Intronic
1099015545 12:77339686-77339708 TAATGTATGAAGAAAGTGTATGG + Intergenic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1100713789 12:97284746-97284768 TGCTGGATGGAGAAGGTGCATGG - Intergenic
1101734256 12:107451330-107451352 ATCTGTATGGAGAATGTTGAAGG + Intronic
1102647199 12:114411393-114411415 TTATTTAAGGAGAAGGGGCATGG + Intergenic
1104729757 12:131098285-131098307 TGATGAAGGGAGAGGGTGGATGG + Intronic
1106658332 13:31771479-31771501 CTATGGATGGAGAGGGGGGATGG - Intronic
1106726272 13:32489382-32489404 TTATTTAAGGATAAGGTAGATGG - Intronic
1107104958 13:36633215-36633237 TTATTGAAGGACAAGGTGGAGGG + Intergenic
1107137979 13:36965163-36965185 TTAGGTTTTGACAAGGTGGAAGG + Intronic
1107425690 13:40290360-40290382 TTGTGTCTGCACAAGGTGGAGGG - Intergenic
1108495177 13:51017967-51017989 AAATGTATGGAGTGGGTGGAAGG - Intergenic
1109518654 13:63478316-63478338 TTATCTTTGGAGAAGATTGATGG - Intergenic
1109569011 13:64161780-64161802 CTATTTATGTAGAAGGTGAAGGG - Intergenic
1109747255 13:66641397-66641419 ATTTGTATGGAGAAAGTGCATGG + Intronic
1110640113 13:77813874-77813896 TTATGGAAGGAGTAAGTGGAGGG - Intergenic
1111701275 13:91693112-91693134 TAATGTCTGGAGCAGATGGACGG + Intronic
1111898099 13:94166602-94166624 TAATGTATGGTGCAGGGGGAGGG - Intronic
1112111881 13:96310393-96310415 TTGGGTTTGCAGAAGGTGGAAGG + Intronic
1112194397 13:97210952-97210974 TTGTGTATGGAGAAGAGGGGTGG + Intergenic
1112411334 13:99166140-99166162 CTATGCATGGAGATGGTTGAAGG + Intergenic
1113195252 13:107796671-107796693 TTATGATTGGTGAAGGAGGAAGG - Intronic
1115533820 14:34353853-34353875 GTATGTATGTATAAGCTGGAAGG + Intronic
1115980507 14:39046720-39046742 TCATGTGAGGAGTAGGTGGAAGG - Intronic
1116402217 14:44521733-44521755 TTCTGTATGGAGGAGAGGGAGGG + Intergenic
1118790322 14:69085731-69085753 TTTTGTAAAGAGAAGGTAGAGGG - Intronic
1119073597 14:71613003-71613025 TGAGGAATGGAGTAGGTGGAAGG + Intronic
1119146608 14:72320777-72320799 TAATATAAGGATAAGGTGGAAGG + Intronic
1119310236 14:73640194-73640216 TTTTTGGTGGAGAAGGTGGAAGG - Intergenic
1119659028 14:76437581-76437603 TTATGCCTGGAGCAGGTGAAAGG - Intronic
1120173590 14:81270903-81270925 TTATTTGGGGAGAAAGTGGAAGG + Intronic
1121705262 14:95988462-95988484 TGGGGTATGGAGAAGGTGGTGGG - Intergenic
1121913338 14:97812845-97812867 TTAAGTATGGAGAAATTTGAAGG + Intergenic
1121931971 14:97980309-97980331 TTATGTAGGGTGAAGGAGGTAGG + Intergenic
1202919474 14_KI270723v1_random:17813-17835 TTATGGATGGTGAAGTTGAATGG + Intergenic
1125792644 15:42380714-42380736 ATATATATGGGGAAGGTGGGGGG - Intronic
1126160191 15:45604805-45604827 TTATGTCAGGAGAAGATGGGAGG - Intronic
1126280196 15:46938508-46938530 TTGAGTAGGGAGAAGGTGTAAGG - Intergenic
1127172962 15:56322694-56322716 GTATGAATGGAGAAGGCAGATGG + Intronic
1127383792 15:58451432-58451454 TTATGAAGGGAGAAGGGGGTGGG - Intronic
1128659185 15:69485266-69485288 GGATGTATGGAGAAGAGGGAAGG + Intergenic
1130546865 15:84863164-84863186 TTATGTATGGGGCAGGGGGAAGG - Intronic
1130845267 15:87738186-87738208 CTATGTCTGGTAAAGGTGGAAGG + Intergenic
1130971346 15:88736161-88736183 TTATCTTTGGAAAAGGAGGAAGG + Intergenic
1132003350 15:98202579-98202601 TTAGTTATGGGGAAGGTGAAAGG - Intergenic
1133000229 16:2846990-2847012 TTATGTTAGGGGAAGGAGGAGGG - Intergenic
1133686980 16:8174771-8174793 TCAAGTATGTAGAAGGAGGATGG - Intergenic
1133797778 16:9060175-9060197 TTAAATATGGAGAAGAAGGAAGG + Intergenic
1135141585 16:19926695-19926717 TTTTGTATGGAGAGGGTGTTTGG + Intergenic
1136427453 16:30178588-30178610 TTCTCCATGGAGAAGGCGGAGGG + Intergenic
1136544152 16:30946636-30946658 TTATGTGGGAAGCAGGTGGAGGG + Intronic
1139308750 16:66010577-66010599 TTATCTAGGAGGAAGGTGGAGGG - Intergenic
1140122456 16:72095396-72095418 TAAAGTATGGAGAACATGGACGG + Intronic
1140878983 16:79180284-79180306 TTAAGTGTGCACAAGGTGGAAGG + Intronic
1141261245 16:82455674-82455696 TTATGTATACAGAAGCAGGAAGG - Intergenic
1143161297 17:4873177-4873199 ATATCTAGGGAGAATGTGGATGG - Intronic
1148107626 17:45127839-45127861 TCATGGGTGGAGAGGGTGGAAGG + Intronic
1148735886 17:49864637-49864659 TCATATTTGGAGAAGGTGGGAGG + Intergenic
1152496778 17:80678730-80678752 TAATGCATGAAGAAGGTGGAAGG + Intronic
1203164757 17_GL000205v2_random:83729-83751 TTATGGATGGTGAAGTTGAATGG + Intergenic
1153348752 18:4056132-4056154 TTATCTATGGGGAAGGGGGCAGG + Intronic
1153482260 18:5558545-5558567 TTAGGTATGTAGAAGGTGCATGG + Intronic
1153586487 18:6626059-6626081 CTCTGGATGGAGATGGTGGATGG + Intergenic
1156309353 18:35908215-35908237 TTAAGTCTGTAGCAGGTGGAGGG + Intergenic
1157585580 18:48799050-48799072 CTATGAGTGGAGAAGGTGAATGG + Intronic
1158049204 18:53194847-53194869 TTATGTATGCAAAGGGTAGATGG - Intronic
1159251814 18:65889251-65889273 TTCTTTTTGGAAAAGGTGGAAGG - Exonic
1159258413 18:65978318-65978340 TTTGTCATGGAGAAGGTGGAGGG - Intergenic
1159349251 18:67250406-67250428 TTCTGGATGATGAAGGTGGATGG + Intergenic
1159451356 18:68606086-68606108 ATATTTATTGAGAAGTTGGAGGG + Intergenic
1160071040 18:75628037-75628059 TCATGTCTGGAGCAGGAGGAAGG + Intergenic
1160203056 18:76810894-76810916 ATAGCTAAGGAGAAGGTGGAAGG - Intronic
1160676933 19:395977-395999 GGATGAATGGAGAAGGTTGATGG + Intergenic
1163878061 19:19892469-19892491 TTATGTTTGGAGAGGATTGAGGG - Exonic
1163961369 19:20696937-20696959 TTATGTATAGAAAAGTTGGAGGG - Intronic
1164190604 19:22913760-22913782 TTAAAGATGTAGAAGGTGGAAGG - Intergenic
1165817987 19:38654747-38654769 TTGTTTATGGAGAAAGGGGAGGG - Intronic
1167405944 19:49308731-49308753 TTAGCTATGGGGAAGGTAGAGGG + Intronic
1168455475 19:56504365-56504387 TTATTTCTGGAGAATGAGGATGG - Intergenic
926434144 2:12821509-12821531 TGATGTAAGAAGAAGGAGGAAGG - Intergenic
926839248 2:17060256-17060278 CTTTCTATTGAGAAGGTGGATGG + Intergenic
927366295 2:22300738-22300760 TTTTGATTTGAGAAGGTGGATGG + Intergenic
927470864 2:23375487-23375509 AAGTGTATGGAGAAGGTGCAGGG + Intergenic
929627499 2:43424576-43424598 TTATTCATGAAGAAAGTGGAAGG - Intronic
929748812 2:44688708-44688730 TTCTGTGTGGGGAAGGGGGAAGG - Intronic
930825318 2:55691580-55691602 TTATTTATGGAAAATATGGAGGG + Intronic
930986806 2:57598924-57598946 ACAGGTATGGAGAAGGTGAAAGG + Intergenic
931534565 2:63259222-63259244 TTATGTTTGGAGGACATGGATGG - Intronic
932446267 2:71783369-71783391 TTATGTATGTAGGAGTGGGATGG + Intergenic
933633547 2:84682615-84682637 GTATGCATGGCCAAGGTGGAGGG - Intronic
933779132 2:85789198-85789220 GTATGTATGCAGGAGGGGGATGG - Intergenic
934879340 2:97960344-97960366 TTAAACATGAAGAAGGTGGATGG - Intronic
935095964 2:99944537-99944559 TGATGAATGGAGAATGGGGAGGG + Intronic
935233314 2:101117917-101117939 TTCTGTATGGAGAAATTAGAAGG - Intronic
935851412 2:107224098-107224120 TTATTTTTGGAGAATGTGAATGG - Intergenic
938388473 2:130884912-130884934 TTATTGATGAAGAAGCTGGAGGG - Intronic
939921944 2:148126555-148126577 GTGTGTATGGAGAATATGGAAGG - Intronic
942288434 2:174445054-174445076 TTATTTATGGAGAACTTTGAGGG - Intronic
942511306 2:176705066-176705088 TTATATATGAATAAGGTGGTTGG + Intergenic
943428262 2:187763753-187763775 TTATGTATGTAGTGGGTTGATGG - Intergenic
944233346 2:197417917-197417939 TTCTGTGTGGAGAAGGTTGATGG - Intronic
944654635 2:201865353-201865375 TGGTGGATGGAGAAGGTGGAGGG - Intronic
945554236 2:211259486-211259508 TTATGTAAGGAAAAAATGGAGGG + Intergenic
945645490 2:212486675-212486697 TTCTGGATGGAGAAAGTGGTGGG + Intronic
946546337 2:220748667-220748689 ATTTGTATGAAGAAGGAGGAAGG + Intergenic
947594036 2:231399782-231399804 TTATTTATGAAGAATTTGGAGGG + Exonic
947867738 2:233412657-233412679 TTAAGACTGGAAAAGGTGGAAGG - Intronic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948458534 2:238118361-238118383 GAATGGATGGAGGAGGTGGATGG + Intronic
948458825 2:238119468-238119490 GAATGGATGGAGGAGGTGGATGG + Intronic
948458854 2:238119562-238119584 GAATGGATGGAGGAGGTGGATGG + Intronic
1170033975 20:11970670-11970692 ACATGAATGGAGAATGTGGATGG - Intergenic
1171528681 20:25836552-25836574 TGAAGCATGGAGAAGATGGAAGG + Intronic
1171548145 20:26019334-26019356 TGAAGCATGGAGAAGATGGAAGG - Intergenic
1171783435 20:29442104-29442126 TTATGGATGGTGAAGTTGAATGG + Intergenic
1173285000 20:41662331-41662353 AAATGTGTGGAGAGGGTGGATGG + Intergenic
1175616640 20:60405359-60405381 TTTGGAATGGAGAAGGGGGAAGG + Intergenic
1175693798 20:61086015-61086037 TCATGTTTGTAGAAGCTGGAGGG - Intergenic
1176407000 21:6375358-6375380 TTATGGATGGTGAAGTTGAATGG - Intergenic
1176728532 21:10465763-10465785 TTTTCTAGGGAGGAGGTGGAGGG + Intergenic
1178671221 21:34593380-34593402 TGATGTATTGAGAAGGTTGGAGG - Intronic
1180661691 22:17473058-17473080 TTGAGGGTGGAGAAGGTGGAAGG + Intronic
1181574685 22:23786434-23786456 AGAGGAATGGAGAAGGTGGAAGG + Intergenic
1181612868 22:24030712-24030734 TTCTTTATGGAGGAGGTGGGAGG + Intronic
1182973264 22:34597731-34597753 CTATGTTTGAAGAAGGTGAAAGG + Intergenic
1184673151 22:46026188-46026210 GTATATCTGGAGAAGCTGGAAGG + Intergenic
949388637 3:3534921-3534943 TTATTTAAGGAGAATGAGGAAGG - Intergenic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
949949112 3:9214654-9214676 CCATGGATGGAGAAGCTGGAAGG + Intronic
951320555 3:21239146-21239168 TTATGGATGCAAAATGTGGATGG - Intergenic
951673822 3:25214878-25214900 GTAAGAATGGAGAAAGTGGATGG - Intronic
953282363 3:41571722-41571744 TTAAATTTGGAGAAGTTGGAGGG - Intronic
954839638 3:53499084-53499106 TTTTGTGTGGAGTAGGTGGGAGG + Intronic
955607363 3:60720173-60720195 TTCTGTATCGGGAAGGAGGATGG - Intronic
957733327 3:84172944-84172966 TTATGTATGTAGAGTCTGGAAGG + Intergenic
959429304 3:106232919-106232941 TAATGTATGCAGCAGGAGGAAGG + Intergenic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
961242089 3:125419946-125419968 TTATGCATGTATAAGCTGGAAGG - Intergenic
961979655 3:131063550-131063572 TCATGAATAGAGGAGGTGGATGG + Intronic
963348473 3:144124624-144124646 TTCGGTATGGAGAAGGTCCAGGG + Intergenic
963523515 3:146386720-146386742 TTATATATGTAGAAAGTGGGTGG + Intergenic
964222217 3:154359891-154359913 TTATGGATGAAGGTGGTGGAAGG + Intronic
965253345 3:166370073-166370095 TTATGCATTGAGGAGGAGGAGGG - Intergenic
966903386 3:184503802-184503824 TGATGCAGGCAGAAGGTGGAAGG + Intronic
967218496 3:187229741-187229763 CTAGGTAGGGAGAAGGTGGAAGG - Intronic
967334886 3:188333255-188333277 TTATATTTGGAGAATTTGGAAGG + Intronic
967336695 3:188352088-188352110 TTAAGTCAGGAGAAGGAGGAAGG - Intronic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
972961272 4:44455123-44455145 TTATAAATGTAGAATGTGGATGG + Intergenic
974424539 4:61723851-61723873 TTAGGTATGGAGAAAGGGTAAGG - Intronic
976697184 4:87929608-87929630 TTATGTGTAGAGAAGGAAGAGGG + Intergenic
978420412 4:108526764-108526786 GAATATGTGGAGAAGGTGGAAGG - Intergenic
980171886 4:129299176-129299198 TTATGTAAGAAGAAGGTTTATGG + Intergenic
980732749 4:136843943-136843965 TTATTTTTGTATAAGGTGGAAGG + Intergenic
984592438 4:181631704-181631726 TTTTGTATAGCAAAGGTGGAGGG - Intergenic
985168615 4:187124478-187124500 TTCTGTGTGCAGGAGGTGGACGG - Intergenic
989736221 5:44710134-44710156 TTTTGTGTGGGGAAGGTGGAAGG - Intergenic
990821408 5:59844767-59844789 TTATGTATGGAGAAGGTGGAGGG + Intronic
991637663 5:68722493-68722515 TAATGCATGGAGGAGGAGGAAGG + Intergenic
992040095 5:72822372-72822394 GTATGTATTGAGAAGGTTGTAGG + Intronic
993807585 5:92431518-92431540 TTTTGTATGGAGAACATTGAAGG - Intergenic
994155807 5:96503324-96503346 CTATGTAAGGTGAAGGTGAAAGG + Intergenic
997206505 5:132053478-132053500 TCAGGTGTAGAGAAGGTGGAAGG + Intergenic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
998166269 5:139846177-139846199 TTCAGTATGGAGAAGGCAGATGG - Intergenic
998569337 5:143243448-143243470 TTATGGATGCAGAAAGTGGAGGG - Intergenic
1000924448 5:167176867-167176889 ATCTGGATGGAGAACGTGGATGG + Intergenic
1001640425 5:173240010-173240032 TTAATTATGGAGGAGGGGGAAGG - Intergenic
1002091159 5:176807320-176807342 TCATGTCAGGAGAAGGAGGAGGG - Intergenic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1005267413 6:24126431-24126453 TTATGCATGAAGAAGGAGGAAGG - Intronic
1007116192 6:39345004-39345026 TGCTATATGGAGAAGCTGGATGG - Intronic
1008745022 6:54659149-54659171 TTATGTATCTAAGAGGTGGAAGG - Intergenic
1011412540 6:87081094-87081116 TTATGCATGGAAAAAGTAGAAGG - Intergenic
1011464724 6:87643480-87643502 TTATTTGTGGAGAAGCTGAATGG + Intronic
1011931129 6:92715025-92715047 ATATGTATAGAGAGGGTGCAGGG - Intergenic
1012816534 6:104029248-104029270 TTATGTATAGAGAAAGTGGTTGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1016808313 6:148235208-148235230 ATGTGTATGGTGGAGGTGGATGG + Intergenic
1016942676 6:149496430-149496452 TGTTGTATGGAGGAGGTGGGAGG - Intergenic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1018221212 6:161581586-161581608 TTACTTATGGACAAGGTGAAGGG + Intronic
1018379147 6:163241707-163241729 TTTTGAATGGAGAAGGTAGGAGG + Intronic
1018785809 6:167107039-167107061 TAATGTGTGGGGATGGTGGAGGG + Intergenic
1018963257 6:168463843-168463865 TGATGTCTGGAGAACTTGGATGG + Intronic
1019351631 7:556762-556784 GTGTGTTTGGAGAAGGTGAAAGG - Intronic
1020452976 7:8340884-8340906 TTTTGTAGGGAGAATGAGGATGG + Intergenic
1021209316 7:17826220-17826242 TTGTGTATGGAGGGGATGGAGGG - Intronic
1021253926 7:18366157-18366179 TTATATAGAGATAAGGTGGAGGG + Intronic
1021809466 7:24389441-24389463 TTGTGTTGGGAGAAGGGGGAAGG - Intergenic
1022320353 7:29281970-29281992 TTATTTATGGAGGAGGCGGGAGG - Intronic
1028697225 7:93728570-93728592 TTATGAATGGTGAATGTGAATGG + Intronic
1029738791 7:102479724-102479746 TTATTTTTGGAGATGGTGGGGGG + Intergenic
1029755916 7:102573380-102573402 TTATTTTTGGAGATGGTGGGGGG + Intronic
1029773858 7:102672453-102672475 TTATTTTTGGAGATGGTGGGGGG + Intergenic
1030112759 7:106040681-106040703 TTATAGATGGTGCAGGTGGAGGG - Intergenic
1030172410 7:106616542-106616564 GTAGGTATGGAGAGGGTGGGAGG + Intergenic
1030865652 7:114699057-114699079 TGGTGAAGGGAGAAGGTGGAAGG - Intergenic
1032282805 7:130518470-130518492 TTTGGTATGGAGCAGGTGGGTGG + Intronic
1033116788 7:138632574-138632596 TGGGGGATGGAGAAGGTGGAGGG + Intronic
1035400038 7:158558725-158558747 TGATGTATCCAGAAGGTGCAAGG - Intronic
1036119387 8:5999342-5999364 TTATGTATGTGAAAGCTGGAGGG + Intergenic
1037329280 8:17727856-17727878 TTATGTAGGGAAAATCTGGAAGG + Intronic
1037641442 8:20747609-20747631 TAATGTTTGTATAAGGTGGAAGG - Intergenic
1037900522 8:22685619-22685641 TGAAGTAGGGAGAAGGTGGAGGG - Intergenic
1038081688 8:24144573-24144595 TTATGTTTTAAGAAGATGGATGG + Intergenic
1038251683 8:25911042-25911064 TGGTGGATGGAGAGGGTGGAGGG - Intronic
1038807558 8:30809361-30809383 TTATGTATCAACAAGGAGGATGG + Intronic
1040746346 8:50647040-50647062 TAATGTTTGTAGAAGGTGTAAGG - Intronic
1041110737 8:54480125-54480147 TTCTGTCTGGAGCTGGTGGAGGG - Intergenic
1041535795 8:58924321-58924343 GTATGTATGGAGAGAGGGGATGG - Intronic
1043438690 8:80258154-80258176 CTATGTATGGAGGTGGGGGAAGG - Intergenic
1043509032 8:80931709-80931731 TTATGAAGGGAAAGGGTGGAGGG - Intergenic
1043921856 8:85992029-85992051 TTAAGTGTGGAGAAAGGGGATGG + Intronic
1044281392 8:90361139-90361161 TTATGGAAGGAAAAGGTTGAGGG - Intergenic
1044580007 8:93815758-93815780 TAACGTCTGGAGAGGGTGGATGG - Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045563172 8:103285702-103285724 TCATTAATGGAAAAGGTGGAGGG + Intergenic
1046705405 8:117444456-117444478 TTGTGTTTGGAGAAGGTGGAAGG + Intergenic
1047660946 8:127035969-127035991 TTATGTAATGAGTAGGTGTAGGG - Intergenic
1047931987 8:129737636-129737658 TAATGTTTGTATAAGGTGGAAGG - Intergenic
1048662054 8:136615711-136615733 TTTTGTATGGAGAAGATTAATGG - Intergenic
1048951530 8:139500876-139500898 TTGTGAATGGAGGAGGAGGAAGG + Intergenic
1053796661 9:41732781-41732803 TGAAGCATGGAGAAGATGGAGGG + Intergenic
1054148522 9:61582080-61582102 TGAAGCATGGAGAAGATGGAGGG - Intergenic
1054185074 9:61944856-61944878 TGAAGCATGGAGAAGATGGAGGG + Intergenic
1054468276 9:65513175-65513197 TGAAGCATGGAGAAGATGGAGGG - Intergenic
1054653435 9:67643640-67643662 TGAAGCATGGAGAAGATGGAGGG - Intergenic
1056237490 9:84609652-84609674 CTATGTATGCAGCTGGTGGATGG + Intergenic
1056471379 9:86907311-86907333 TGATATAAGGAGGAGGTGGAGGG + Intergenic
1056923949 9:90816575-90816597 TTATATCTGTACAAGGTGGAAGG + Intronic
1057602971 9:96474976-96474998 TAATGAAAGGAGAAGATGGAAGG - Intronic
1058852785 9:109028569-109028591 ACATGTATGGCAAAGGTGGATGG + Intronic
1059401678 9:114074374-114074396 TGATGTATGGAGAGGATAGATGG - Intronic
1060241036 9:121903413-121903435 ATATGTATGGCAAAGCTGGATGG + Intronic
1061947437 9:133916570-133916592 ATATGGATGGAGAAGGGGAAAGG + Intronic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1186683468 X:11900199-11900221 TTTTGTCTGAAGAAGGGGGAAGG + Intergenic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1187069778 X:15877139-15877161 ATATTCATGGAGAAGTTGGAAGG + Intergenic
1187467680 X:19541459-19541481 TAATGTATGAAGAAGATGTAGGG - Intronic
1188409689 X:29856058-29856080 CTATGTATGGAAATGGTGCATGG - Intronic
1188450718 X:30306259-30306281 TTGGGTGGGGAGAAGGTGGAGGG - Intronic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1190801882 X:53796710-53796732 TGAAGTAAGGGGAAGGTGGAGGG - Intergenic
1192587626 X:72331930-72331952 TTAGGGATGGTGAAGGAGGAGGG - Intronic
1194737196 X:97526599-97526621 TTAGAGATGGAGAAGGTAGAAGG - Intronic
1196141258 X:112265795-112265817 TTATGCATGGAGGAGGAGGAAGG - Intergenic
1196261889 X:113592868-113592890 TTAAGACTGGAGAAGGTGAAAGG - Intergenic
1197222107 X:123924244-123924266 TAAAATATGGAGCAGGTGGAGGG - Intergenic
1197339076 X:125243787-125243809 GTATGTAGGGAGTAGGTAGAAGG + Intergenic
1197849153 X:130838519-130838541 TTAGGAATGGAGAAGGGGAAGGG - Intronic
1198927731 X:141817715-141817737 GTATGTATGTAGGAGGTAGAGGG + Intergenic
1199449166 X:147960009-147960031 TTATGTGGGGAGAAAGGGGAAGG + Intergenic
1201255117 Y:12099819-12099841 TTGTGGATGGAGACAGTGGAGGG + Intergenic