ID: 990825222

View in Genome Browser
Species Human (GRCh38)
Location 5:59892213-59892235
Sequence GACCAATTACAGCCATTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990825222_990825225 6 Left 990825222 5:59892213-59892235 CCTCAGAATGGCTGTAATTGGTC 0: 1
1: 0
2: 0
3: 5
4: 130
Right 990825225 5:59892242-59892264 TCATTTCCTTGGAGAAGCAGCGG 0: 1
1: 1
2: 2
3: 22
4: 364
990825222_990825223 -5 Left 990825222 5:59892213-59892235 CCTCAGAATGGCTGTAATTGGTC 0: 1
1: 0
2: 0
3: 5
4: 130
Right 990825223 5:59892231-59892253 TGGTCCTTTACTCATTTCCTTGG 0: 1
1: 0
2: 2
3: 19
4: 247
990825222_990825227 29 Left 990825222 5:59892213-59892235 CCTCAGAATGGCTGTAATTGGTC 0: 1
1: 0
2: 0
3: 5
4: 130
Right 990825227 5:59892265-59892287 TCAACTTCTACTAAAACTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990825222 Original CRISPR GACCAATTACAGCCATTCTG AGG (reversed) Intronic