ID: 990825826

View in Genome Browser
Species Human (GRCh38)
Location 5:59896432-59896454
Sequence GTGTGCTGGATTAGCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990825826_990825832 7 Left 990825826 5:59896432-59896454 CCAGGAGAGCTAATCCAGCACAC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 990825832 5:59896462-59896484 CAGGCTCCATGAAGCAGGATAGG 0: 1
1: 0
2: 3
3: 32
4: 205
990825826_990825833 8 Left 990825826 5:59896432-59896454 CCAGGAGAGCTAATCCAGCACAC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 990825833 5:59896463-59896485 AGGCTCCATGAAGCAGGATAGGG No data
990825826_990825829 2 Left 990825826 5:59896432-59896454 CCAGGAGAGCTAATCCAGCACAC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 990825829 5:59896457-59896479 AGACCCAGGCTCCATGAAGCAGG 0: 1
1: 0
2: 1
3: 34
4: 253
990825826_990825835 15 Left 990825826 5:59896432-59896454 CCAGGAGAGCTAATCCAGCACAC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 990825835 5:59896470-59896492 ATGAAGCAGGATAGGGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990825826 Original CRISPR GTGTGCTGGATTAGCTCTCC TGG (reversed) Intronic
901931849 1:12601032-12601054 GTCTGCAGGATTAGCTCTGGAGG + Intronic
906492470 1:46279093-46279115 GTGAGATGGATTAGATATCCAGG + Intronic
907968490 1:59357082-59357104 GTGTTGTGGATTTTCTCTCCAGG + Intronic
910297911 1:85670181-85670203 GTGGGCTGGATTTGGCCTCCTGG - Intronic
915814031 1:158948254-158948276 GTGTGCAAGATTATCTCTACTGG - Intronic
917045416 1:170854411-170854433 CTGTCATGGATTAACTCTCCAGG + Intergenic
917470164 1:175319729-175319751 GAGTCCTGGTTTGGCTCTCCTGG + Exonic
917734333 1:177906898-177906920 CTGTGCTGGACCAGCTCTCCAGG + Intergenic
919150087 1:193685405-193685427 GAGTGCTGGATCAGCTCCCTAGG + Intergenic
920490761 1:206412996-206413018 GTATGATGGATTACCTCTTCGGG - Intronic
924624261 1:245686697-245686719 CCGTGCTGGAGTAGCACTCCAGG - Exonic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1074136559 10:110632400-110632422 GTGTGCTGGATTTACTCTAAAGG + Intergenic
1076619276 10:131776701-131776723 TTGTGCTGGAGTGGCTCTCGTGG - Intergenic
1078441783 11:11374134-11374156 GAGTGGTGGATTAGCTTCCCAGG - Intronic
1085692229 11:78673122-78673144 GTGTGCTGGCCTAGCAGTCCAGG - Intronic
1097971082 12:65633820-65633842 GTGGACTGAATTGGCTCTCCTGG - Intergenic
1098422348 12:70313781-70313803 GTGTGCTGGATTTGTCCTGCAGG + Intronic
1098569793 12:71975408-71975430 GTGGGCTGGATTTGGCCTCCAGG + Intronic
1100697577 12:97112112-97112134 GTGTGGAGGACTAGCTCTCTGGG + Intergenic
1100980710 12:100160074-100160096 GTGTGTGAGATTATCTCTCCTGG - Intergenic
1103334944 12:120182376-120182398 GTGCGCTGGATAAGCTCCCAGGG + Intronic
1105428542 13:20316397-20316419 CAGTTCTGTATTAGCTCTCCTGG - Intergenic
1107533724 13:41308560-41308582 GTGTGCTTGCTCAGTTCTCCGGG + Intergenic
1113146660 13:107215460-107215482 GTTTGCTAGATGAGCTCTCTTGG - Intronic
1113732436 13:112651083-112651105 GAGTGATGGACTAGCTCACCAGG - Intronic
1117479286 14:56127243-56127265 GTGTCATGCATTAGCTCTCCTGG - Intronic
1123538413 15:21261967-21261989 GTGTGTTGGATGTGCTATCCGGG - Intergenic
1126119623 15:45240220-45240242 GTCACCTGGATTAGCACTCCAGG + Intergenic
1130226553 15:82063195-82063217 GTGAGCTGGAAAAGCTCTCCAGG - Intergenic
1132739113 16:1402247-1402269 GTGTGCTGAGTTCGTTCTCCTGG + Intronic
1137370184 16:47897701-47897723 GTTTGCTGGAGTTGCACTCCAGG - Intergenic
1138417373 16:56879234-56879256 GTCTGGTGGGTCAGCTCTCCTGG - Intronic
1138831046 16:60374795-60374817 GTGTGCTGGATTATCTTTGTGGG + Intergenic
1139674378 16:68513025-68513047 TTGGACTGGCTTAGCTCTCCTGG - Intergenic
1140353300 16:74283176-74283198 CTGTCATGGATTAGCTCACCAGG - Intergenic
1143891589 17:10106460-10106482 GTGTTCTTCATTAGCTCTCCCGG - Intronic
1144755473 17:17677934-17677956 GTGGGCTGGGCTAGCTCTCCTGG - Intergenic
1145351658 17:22089643-22089665 GTGTGTTGGATGTGCTATCCGGG - Intergenic
1145403865 17:22569385-22569407 GTGTGTTGGATGTGCTATCCGGG - Intergenic
1145723067 17:27090443-27090465 GTGTGTTGGATGTGCTATCCGGG + Intergenic
1147057707 17:37846889-37846911 GTGTGCTGGCCCAACTCTCCAGG + Intergenic
1152193450 17:78902550-78902572 CTGGGCTGGGTCAGCTCTCCAGG + Intronic
1153511284 18:5855715-5855737 ATGTGCTGCCTAAGCTCTCCAGG - Intergenic
1154494376 18:14944964-14944986 GTGAGCTGGAGTAGCTGGCCAGG + Intergenic
1156635280 18:39020427-39020449 GTGTGATGGATTAGCAATCAAGG + Intergenic
1158501306 18:58004379-58004401 GTGGCCATGATTAGCTCTCCTGG + Intergenic
1163778031 19:19229318-19229340 GTGTGATGGACTGGCTTTCCAGG + Intronic
1166161504 19:40956977-40956999 GTCACCTGGATTAGCACTCCAGG - Intergenic
924990614 2:309612-309634 GTGTGCTGGGGTGGCTCTCCAGG + Intergenic
933419235 2:82025528-82025550 GTCACCTGGATTAGCACTCCAGG - Intergenic
937397944 2:121555121-121555143 GTGTGCAGCGTGAGCTCTCCAGG - Intronic
941844404 2:170119069-170119091 GTGTGCGAGATCATCTCTCCTGG + Intergenic
942093788 2:172519044-172519066 GTGTGCAAGATCATCTCTCCTGG + Intergenic
948513821 2:238490363-238490385 GTGTGCTGGGATAGCACACCTGG - Intergenic
1169487516 20:6045734-6045756 GTGGTCTGGATTAGCTCAGCTGG + Intronic
1169641470 20:7757193-7757215 GTGTTCTCTATTAGGTCTCCAGG - Intergenic
1173980658 20:47221391-47221413 GTGTGCTCGAGGAGCTCCCCTGG + Exonic
1176341480 21:5701054-5701076 GTGAGATGGATTAACTTTCCAGG + Intergenic
1176473734 21:7133207-7133229 GTGAGATGGATTAACTTTCCAGG + Intergenic
1176503347 21:7623402-7623424 GTGAGATGGATTAACTTTCCAGG - Intergenic
1179808364 21:43854432-43854454 ATGTGCTGGATTTGCTTCCCGGG - Intergenic
1203240745 22_KI270733v1_random:15521-15543 GTGAGATGGATTAACTTTCCAGG + Intergenic
949575962 3:5339470-5339492 CTGAACTTGATTAGCTCTCCAGG + Intergenic
951586419 3:24219765-24219787 TTGTGCCTAATTAGCTCTCCAGG - Intronic
953428126 3:42812578-42812600 GTTTGCTTGCTTACCTCTCCAGG + Intronic
956089719 3:65653008-65653030 TCTTGCTGGATAAGCTCTCCTGG - Intronic
956742564 3:72286702-72286724 GTGGGCAGGATAATCTCTCCTGG - Intergenic
958162383 3:89833369-89833391 GTGTCTTGGAGTTGCTCTCCTGG - Intergenic
960752088 3:120966561-120966583 GTTTGCTGGAATTCCTCTCCAGG + Intronic
961441840 3:126958028-126958050 GTGTGCTGGCTTGGCCTTCCTGG + Intronic
961861593 3:129920902-129920924 GGGTGCTGGATGAGTCCTCCTGG + Intergenic
962418925 3:135210172-135210194 GTGCTCTGTATTAACTCTCCAGG - Intronic
964420151 3:156493698-156493720 GTAAGCTGGATCAGCTCTTCAGG + Intronic
966144437 3:176793792-176793814 ATGTGCTGGTTTCTCTCTCCAGG - Intergenic
968875078 4:3262393-3262415 GTGTGCTGGCTTTGCGCTCGTGG + Intronic
969628093 4:8318275-8318297 GTGTGCTGGATGTGGTCTGCAGG - Intergenic
971712422 4:30132456-30132478 GTGTGATGGAATAGCATTCCAGG + Intergenic
974210259 4:58763852-58763874 GTGGGCTGGATTTGCCCTGCAGG - Intergenic
974788618 4:66656008-66656030 GTGTTCTGGATTAGCTAAACTGG + Intergenic
977863287 4:101993032-101993054 GTGGTCTGGATTAGCTGTCCAGG - Intronic
978744269 4:112174245-112174267 GTTTTCTGGGTTACCTCTCCTGG - Intronic
980288549 4:130813546-130813568 GTGTGCTGGTGTGGCTCTCATGG + Intergenic
981000611 4:139825401-139825423 GAGTGCTGGATAAGGACTCCAGG + Intronic
983661017 4:170131026-170131048 GTCACCTGGATTAGCACTCCAGG + Intergenic
986597141 5:9435675-9435697 GTGGGCTGGATTTGGCCTCCAGG - Intronic
989028617 5:37093540-37093562 GTGTGCAAGATCATCTCTCCTGG + Intergenic
990825826 5:59896432-59896454 GTGTGCTGGATTAGCTCTCCTGG - Intronic
992889972 5:81195091-81195113 GTGCCATGGATTCGCTCTCCTGG + Intronic
997792415 5:136772624-136772646 GTGTGATGGATTAGCCCCCTGGG - Intergenic
998504024 5:142657624-142657646 GTGTGGTGGACCAGGTCTCCTGG - Intronic
1001382329 5:171312679-171312701 GTGCGCTGCATTTGCTCCCCAGG - Intergenic
1004979203 6:21003727-21003749 TTGTGCTGGATCAGTTATCCAGG - Intronic
1008222915 6:48876387-48876409 GTCACCTGGATTAGCACTCCAGG - Intergenic
1012427852 6:99133980-99134002 GTTTGCTTTATTAGCTCTCCTGG - Intergenic
1014489896 6:122049563-122049585 GAGTGCTGCATTTGCTCTGCGGG - Intergenic
1016712049 6:147185248-147185270 GTGTGCTGTATTAACTCTGGGGG + Intergenic
1017641544 6:156498909-156498931 GTGTCCTGCATGAGCTCTTCAGG - Intergenic
1018678681 6:166244899-166244921 GTGAGCTGCACCAGCTCTCCTGG + Intergenic
1019045849 6:169145288-169145310 TTGTGCTGAATAAGCTCTTCTGG + Intergenic
1022385401 7:29894061-29894083 GTGGGCTGGATTTGGTCTGCTGG + Intronic
1035462282 7:159049452-159049474 ATCTGCTGCTTTAGCTCTCCGGG + Intronic
1040596431 8:48841859-48841881 GGATGCTGTATGAGCTCTCCAGG - Intergenic
1041402699 8:57461981-57462003 GTGTGCAAGATCATCTCTCCTGG + Intergenic
1046517725 8:115285135-115285157 GTGGGATGTATTAGCTTTCCTGG - Intergenic
1051393536 9:16592780-16592802 ATGTGCTGCATTATGTCTCCTGG - Intronic
1052915928 9:33924333-33924355 ATGTGCTGGTTCTGCTCTCCTGG - Intronic
1053389934 9:37727421-37727443 GTGGGCTGGATTTGCTCCACAGG + Intronic
1057859284 9:98626877-98626899 CTGTGCTGGTTCAGCCCTCCAGG - Intronic
1061304032 9:129722431-129722453 TTCTCCTGGATGAGCTCTCCTGG + Exonic
1185826518 X:3256465-3256487 GTGTGCTGGGTTAACTCTTTTGG - Intergenic
1187017772 X:15347248-15347270 GGGTGCTGGATTAGATCTTTGGG + Exonic
1188542102 X:31262333-31262355 GTGTGTTGGTTTTGCTCTCTAGG - Intronic
1189728976 X:43999080-43999102 GTATTCTGGATTGGCTCTCAAGG - Intergenic
1191634197 X:63358688-63358710 GTGTGCAAGATAAGCTCTCCTGG - Intergenic
1195161462 X:102175869-102175891 GTGTGCAAGATCATCTCTCCCGG - Intergenic
1200961223 Y:8997794-8997816 GTCTCCTGGATTAGCACTCCAGG - Intergenic
1201867320 Y:18669172-18669194 GTCACCTGGATTAGCACTCCAGG - Intergenic
1202127727 Y:21583045-21583067 GTCACCTGGATTAGCACTCCAGG - Intergenic