ID: 990827817

View in Genome Browser
Species Human (GRCh38)
Location 5:59922044-59922066
Sequence AGGGAGAGTGCAGCGACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 531
Summary {0: 1, 1: 6, 2: 21, 3: 130, 4: 373}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990827807_990827817 14 Left 990827807 5:59922007-59922029 CCACGTGGCACAGAGAGTGAATC 0: 1
1: 0
2: 16
3: 59
4: 182
Right 990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG 0: 1
1: 6
2: 21
3: 130
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990827817 Original CRISPR AGGGAGAGTGCAGCGACTGG GGG Intronic
900002192 1:20878-20900 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
900021914 1:191402-191424 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
900767735 1:4516445-4516467 AAGGCGAGTGCAGGCACTGGAGG - Intergenic
902600490 1:17537559-17537581 AGGGAGAGGTCAGGGAATGGAGG + Intergenic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906315993 1:44786728-44786750 AGGGAGAGTGGAGAGCCTGGGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907500485 1:54875973-54875995 GGGGAGAGTCCAGCCAATGGAGG + Exonic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909583164 1:77260783-77260805 AGCGAGGGGGCAGGGACTGGGGG - Intergenic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910800391 1:91139059-91139081 AAGGAGAGTCCAGAGAGTGGTGG + Intergenic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
915604450 1:156941827-156941849 GGAGAGAGTGCAGGGTCTGGAGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916119061 1:161511924-161511946 AGGGAGGGAGCAGCGATGGGGGG + Intronic
916498423 1:165365860-165365882 GGGCAGAGAGCAGGGACTGGAGG - Intergenic
917154578 1:171983108-171983130 AGGGAGAGGGCAGCTACAGAGGG - Intronic
917300675 1:173570832-173570854 AGGGAGACCACAGCAACTGGGGG - Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
917720791 1:177784767-177784789 AGGAAGAGGGCAGCTACTGCAGG + Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919012934 1:191988480-191988502 AGGGAGAACACAGCAACTGGGGG + Intergenic
919169705 1:193938553-193938575 GGGGAGAGTGCAGCAATTGTGGG + Intergenic
919767779 1:201138489-201138511 AGGGAGAGGGGAGGAACTGGTGG - Intronic
919941292 1:202288268-202288290 ATGGAGAGTGCTGGGAATGGAGG - Intronic
921032910 1:211349717-211349739 AGGGAGAGTGCAGAGTGTAGTGG + Intronic
921053477 1:211527134-211527156 GGGGAGAGAGCAGGGCCTGGGGG + Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922350318 1:224729856-224729878 AGGGACAGTGTAGCCTCTGGGGG - Intronic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
924459638 1:244247619-244247641 AGAGGGAGAGCAGAGACTGGGGG + Intergenic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1063948851 10:11203976-11203998 AGGCTGAGTGGAGAGACTGGGGG + Intronic
1064295674 10:14076975-14076997 AGGGAGAGGGAAGAGTCTGGAGG + Intronic
1064446466 10:15398348-15398370 AGGGAGAGTGAAGCAATTGGAGG + Intergenic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1067200926 10:44171601-44171623 AGGGAGAGGGCAGCCACCAGGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069076441 10:64042319-64042341 AGGGAGAGTGGAGTGAGTGCAGG - Intergenic
1069729679 10:70602620-70602642 AAGGAGAGAGCAGGGATTGGGGG - Intronic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1070804241 10:79261382-79261404 AGGGAGAGAGCAGGCGCTGGAGG + Intronic
1071966598 10:90858122-90858144 AGGGAGCGGGCAGCGGCCGGAGG - Intergenic
1072336605 10:94403251-94403273 AGGGCGCGGGCAGCGACTCGGGG + Exonic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1072634637 10:97169958-97169980 AGGGAGAGTCCAGCAACATGAGG - Intronic
1072990185 10:100185688-100185710 AGGGAGAGGGTAGAAACTGGAGG - Exonic
1073027270 10:100497182-100497204 AGGGAGTGTGGAGCGGCTGGTGG - Exonic
1073576691 10:104631798-104631820 AGGGAGACTGCAGAGCCTAGTGG - Intergenic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075536317 10:123275035-123275057 AGGGAGGGGGCAGGGGCTGGCGG + Intergenic
1076768415 10:132650268-132650290 AGGCAGAGGGCAGGGAATGGCGG - Intronic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1080489963 11:32751588-32751610 AAGGAGAGTGCAGCAATTGTGGG - Intronic
1081559878 11:44203807-44203829 AGGGCCAGTGCAGCGCATGGGGG - Intronic
1081825738 11:46049612-46049634 AAGGAGAGTGCTGTGACAGGTGG - Intronic
1083290040 11:61684742-61684764 AGGGGGTGTGGAGCGCCTGGTGG + Intronic
1083572408 11:63767836-63767858 AGGGAGAATGCACCGGCCGGAGG + Intronic
1084163693 11:67365161-67365183 AGGGTGACTGCAGCTGCTGGAGG + Exonic
1084948417 11:72651475-72651497 AGGGAGAGGCCAGGGTCTGGGGG + Intronic
1084959747 11:72710182-72710204 AGGGCCAGGGCAGGGACTGGAGG + Intronic
1085119474 11:73957930-73957952 AGGGAGAGTGCAGCGAGGCCCGG + Intronic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1085462267 11:76701260-76701282 AGGGAGAGTGCTGCTCCAGGAGG + Intergenic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085727525 11:78967165-78967187 AGGGAGAGTCCAGGGAGTTGTGG - Intronic
1085937734 11:81170144-81170166 AGGGAGAATTCAGAGAATGGAGG - Intergenic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1086404676 11:86489572-86489594 AGGGAGAGTGTGGCGGCTGAAGG - Intronic
1087370595 11:97279249-97279271 AGGGACAGTGCAGGGATTGGAGG + Intergenic
1088009722 11:104985679-104985701 AGGGAGAGTACAGCATCTGAGGG + Intergenic
1089998544 11:122932007-122932029 ATGGAGTATGCAGCGACTGCGGG + Intronic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090529440 11:127575530-127575552 AGGGAGAGTGCAGGAGATGGAGG + Intergenic
1091375607 12:22938-22960 CGGGAGTGTGCAGAGACTGGAGG - Intergenic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093581730 12:20791194-20791216 AGGGAAAGAACAGCAACTGGGGG - Intergenic
1094523795 12:31218825-31218847 GGGGAGCTTGCAGAGACTGGAGG - Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096975856 12:55698985-55699007 AGGGAGGGGGCAGGGGCTGGGGG - Intronic
1097508517 12:60506933-60506955 AGGAAGAACGCAGCGGCTGGGGG + Intergenic
1097899388 12:64857899-64857921 TGGGAGAGTGCAGTGACTAGAGG - Intronic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1098419114 12:70272740-70272762 AGGGAGAGTGAAGGGATTAGAGG - Intronic
1098982698 12:76974745-76974767 AGGGATAGAGCTGTGACTGGTGG + Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1101469841 12:104986270-104986292 GGGGAGAGGGCCGCGATTGGAGG - Intergenic
1104991298 12:132625234-132625256 AGGGAGTGAGCAGGGCCTGGAGG - Intronic
1106141061 13:27012066-27012088 AAGGAGAGTGAAGTGAATGGAGG + Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1107210756 13:37851829-37851851 AGGGAGAGCACAGCAACAGGTGG + Intronic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108057453 13:46498867-46498889 AGGAACAGTGGAGAGACTGGGGG - Intergenic
1109789474 13:67228517-67228539 AGGAAGCGTGCATGGACTGGAGG + Exonic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113897674 13:113776220-113776242 TGGGTGAGTGGAGCGACTTGGGG + Intronic
1114413897 14:22526123-22526145 AGAAAGAGTGCAGCGACAGATGG - Intergenic
1114558834 14:23577325-23577347 AGGGCGAGTACAGCGGCTGCTGG - Exonic
1114985249 14:28218210-28218232 AAGGAGAGTGCAGCAACTGCAGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1116888951 14:50249001-50249023 AGGGAGGGTACAGTGGCTGGGGG + Intronic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1118325119 14:64775223-64775245 CGGGAGGCTGCAGCGACTGAGGG - Exonic
1119495191 14:75071736-75071758 TGGGTGAGTGCAGCCACTGTGGG + Exonic
1121011377 14:90522197-90522219 AGGGAGCGAGCAGAGAATGGAGG - Intergenic
1121048206 14:90803209-90803231 GGGGAGAGTGGAACCACTGGAGG - Intronic
1121441986 14:93955284-93955306 TGGGAGAGTGCAGGGGCTGGTGG - Intronic
1122054283 14:99082013-99082035 AGGGACAGTGCAGGGGGTGGGGG + Intergenic
1122070358 14:99201865-99201887 AGGAAGAGTGCAGCTCCTTGGGG - Intronic
1122112947 14:99514554-99514576 GGGGACATTGCAGAGACTGGGGG + Exonic
1122115880 14:99526997-99527019 AGGGAGAGTGCAGAGAAAGCAGG + Intronic
1122628941 14:103098707-103098729 GGGGAGAGAGAAGCGAGTGGAGG + Intergenic
1126452453 15:48823566-48823588 AGGGAGAATGCAGTGCCTTGGGG - Intergenic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128945139 15:71814674-71814696 AGGCAGAGGGCAGCTACTGCAGG + Intronic
1129030751 15:72616017-72616039 AGGGAGAATGCAGCAACTGTGGG - Intergenic
1129198890 15:73986905-73986927 AGAGAGAGTGCATGGAGTGGAGG + Intronic
1129237463 15:74232348-74232370 AGGGAGACTACAGCGCCTTGGGG + Intergenic
1129477594 15:75796541-75796563 AGGGAGAATACAGCAACTGTGGG - Intergenic
1129556456 15:76515286-76515308 AGGGTGAGTGCAGTAACTGAAGG + Intronic
1129835661 15:78703818-78703840 AGGGAGAATGCAGCAACTGTGGG - Intronic
1130010937 15:80152727-80152749 AGGGAGGGAGGAGAGACTGGAGG + Intronic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1131131983 15:89906099-89906121 AGTGGGGGTGCAGAGACTGGAGG - Intronic
1132119754 15:99166668-99166690 AGAAAGAGAGCAGCGACTTGAGG - Intronic
1132451318 15:101970061-101970083 TGGGAGTGTGCAGAGACTGGAGG + Intergenic
1135620652 16:23952526-23952548 TGGGAGGGTGGGGCGACTGGAGG + Intronic
1136569951 16:31090743-31090765 AGGGAGAGTGGAGGGCCTGCTGG - Intronic
1136679124 16:31945057-31945079 AGGGAGATTGCAGCAACTGGGGG + Intergenic
1138561018 16:57801219-57801241 AGGGACATTGCAAAGACTGGGGG + Intronic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140306715 16:73809575-73809597 AGTGAAAGTGCATTGACTGGGGG + Intergenic
1140456848 16:75110777-75110799 AGGGAGAGCGCAGCTGCTGCAGG + Exonic
1140481640 16:75265668-75265690 GGGGAGAGCGCACCGGCTGGGGG - Intronic
1141485008 16:84333167-84333189 AGGAAGACTGCAGCCACTGGGGG + Intergenic
1141621446 16:85238589-85238611 AGGGGGAGTGCAGAGGCTGGCGG - Intergenic
1142130926 16:88431115-88431137 GGGGAAAGTCCAGCGACGGGCGG - Exonic
1144404474 17:14939502-14939524 AGGGAGAGGGGAGCGACGGAGGG + Intergenic
1145069085 17:19787910-19787932 AGGGAGAGTGCAGCAATTTGGGG + Intronic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1147661233 17:42118146-42118168 AGAGAGAAGGCAGGGACTGGGGG + Intronic
1147858825 17:43504151-43504173 GGGGAGAGTGCTGCGCATGGTGG + Intronic
1147914571 17:43878827-43878849 AGGGAGCAGGCAGCGCCTGGAGG - Intronic
1148124852 17:45231316-45231338 AGGGAGGCTGCAGAGGCTGGGGG + Intronic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1150445665 17:65225418-65225440 CGGGAGGGTGCAGCCCCTGGGGG + Exonic
1150587447 17:66531661-66531683 AGGGAGACAGCAGTGACAGGAGG - Intronic
1151715331 17:75828120-75828142 GGGGAGAGGGCAGTGCCTGGTGG + Intronic
1152122095 17:78425133-78425155 AGGGAATGTGCAGGGTCTGGAGG - Intronic
1153370271 18:4307645-4307667 GGGCAGAGTGCAGAGACTGCAGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1155296335 18:24387878-24387900 AGGGAAACTGCAGCTTCTGGTGG - Intronic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1155868599 18:30997396-30997418 AGGGAGAGAGGAGCAACAGGGGG + Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1160633945 19:62486-62508 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
1161045119 19:2130447-2130469 AGGCAGGGCGCAGCGACTCGGGG + Exonic
1161206235 19:3042455-3042477 AGGGGGAGGTCAGCGGCTGGGGG + Intronic
1161283903 19:3459232-3459254 GGGGAGAGTCCATGGACTGGGGG - Intronic
1162585486 19:11555664-11555686 AGGGAGAGAGGAGGGACAGGTGG + Intronic
1162739575 19:12766304-12766326 AGGGAGAGTGGAGCTAGGGGCGG + Intronic
1162792315 19:13069485-13069507 AGTGAGAGAGCAGACACTGGAGG + Intronic
1163468227 19:17481973-17481995 AGGGAGAGAGCAGCCACCCGTGG - Intronic
1163600742 19:18247815-18247837 AGGGAGGGTGCAGAGAGTGTGGG - Intronic
1163608334 19:18287976-18287998 AGGGAAAGTGCCCCGACTGCCGG + Intergenic
1165186042 19:34022675-34022697 AGGGAGAGACAAGAGACTGGTGG - Intergenic
1166408459 19:42540421-42540443 AGGGTGAGTGCGGCCACTGGAGG - Intronic
1167793469 19:51694446-51694468 AGGGAGGGAGCAGGGGCTGGGGG - Intergenic
925042771 2:746434-746456 AGGGAGCGTGCAGCTGCTGCTGG - Intergenic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
925306010 2:2848833-2848855 AGGGAGAGGGGAGGGCCTGGGGG + Intergenic
928495741 2:31829723-31829745 AGGGAGAGTGCTGCAATTGGAGG - Intergenic
928545055 2:32321965-32321987 AGGGACAGTGCAGCGGCAGTGGG - Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
929011119 2:37446066-37446088 TGGCAGAGTGCAGGGGCTGGGGG + Intergenic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
929924722 2:46198648-46198670 AGGCAGTGTGCAGCTACTCGGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930539856 2:52691433-52691455 AGGGAGTGTGCTGCCAATGGTGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
931248458 2:60510200-60510222 AGGGAGATGGAAGCCACTGGAGG - Intronic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
931908512 2:66869019-66869041 AGGGTGAGTGGACCTACTGGAGG - Intergenic
932426964 2:71643966-71643988 AGGAAGAGTTCATCGATTGGTGG + Exonic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
933351545 2:81158734-81158756 ATGGAGAGAGCAGTGACTGCGGG + Intergenic
933981842 2:87556701-87556723 GGGGAGAGTGGAGAGACAGGAGG + Intergenic
934745098 2:96754175-96754197 AGGAAGGCTGCAGGGACTGGTGG - Intergenic
934777228 2:96947182-96947204 AGGGAGGGTGCAGCCACTAGGGG + Intronic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
934935712 2:98463874-98463896 ACGGAGCGAGCAGAGACTGGAGG - Intronic
935437954 2:103056898-103056920 AGGGAGAGTGCCGTGACTAGGGG - Intergenic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
935835671 2:107050630-107050652 ATGGAGAGTGCAGCCACTGGGGG - Intergenic
936053265 2:109241680-109241702 AGAGGGACTGCAGGGACTGGGGG - Intronic
936311996 2:111394116-111394138 GGGGAGAGTGGAGAGACAGGAGG - Intergenic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936567533 2:113592542-113592564 TGGGAGTGTGCAGAGACTGGAGG + Intergenic
936641539 2:114317355-114317377 AAGGAGAGCTCAGCGACTGGGGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937613670 2:123893905-123893927 AGGGAGAGTGCAGATACTGGGGG - Intergenic
937628242 2:124068286-124068308 AGACAGAGCGCAGCAACTGGTGG + Intronic
938243168 2:129758689-129758711 AGGGAGAGTGCCGCTCTTGGTGG + Intergenic
938587636 2:132707207-132707229 GGGGAAAGTGCAGTGACTGTGGG + Intronic
938930492 2:136082410-136082432 AGGGTGAGTGCAAGGACAGGAGG - Intergenic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
940041517 2:149366562-149366584 AAGAAGAGTCCAGGGACTGGGGG + Intronic
940639566 2:156332607-156332629 AGGGAGGGAGCAGGGACAGGCGG + Exonic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941819295 2:169828162-169828184 GGGGAGGGTGCAGCCACAGGGGG + Intronic
942814413 2:180034675-180034697 AGGGAAAGTGCGGCAGCTGGGGG - Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
943913010 2:193592441-193592463 AGGGAGAGGACCGTGACTGGGGG + Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
944096050 2:195968931-195968953 AGGGACAGCGTAGTGACTGGGGG - Intronic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944660450 2:201917213-201917235 AGGGAGAGTGCAGACATTAGTGG + Intergenic
944688790 2:202140864-202140886 AGGGAGGGGGCAGCCAGTGGGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
946425415 2:219592764-219592786 GGGGAGAGTGGAGCGGCTGCTGG + Intergenic
947374919 2:229486019-229486041 AGGGTGAGAGCTGAGACTGGTGG - Intronic
947412800 2:229859245-229859267 AGGAAGAGTGGGGCCACTGGCGG - Exonic
947439854 2:230109767-230109789 AGGGAGGGTGGGGCAACTGGGGG - Intergenic
947860297 2:233353628-233353650 GGGGAGTGACCAGCGACTGGAGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948892671 2:240915016-240915038 AGGGAGGGCGCAGGGACTGTAGG - Intergenic
1170024264 20:11871986-11872008 AGGGAGTGTGCAGAAGCTGGGGG - Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1171343607 20:24449050-24449072 AGGGTGAGTGCAGGAGCTGGGGG - Intergenic
1171767867 20:29300249-29300271 AGGGAGAGAGCAGCGCGGGGCGG + Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1174253199 20:49234724-49234746 AGAGAGAGTGCAGGGACGAGGGG - Intronic
1174427357 20:50441589-50441611 AGGGAAAGTGCAAAGACTGTGGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176060321 20:63169659-63169681 AGGGAGGGTGCAGGGAGAGGAGG - Intergenic
1177105068 21:16945487-16945509 AGGAAGAGTGCAGAGACCGTGGG + Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1178365539 21:31986346-31986368 AGAGAGAGTGCAGGGGTTGGAGG - Intronic
1179520737 21:41942776-41942798 AGGGAGAGGCCAGCCCCTGGGGG - Intronic
1179811427 21:43873103-43873125 AGGGAGATGGCATCGAGTGGCGG + Intronic
1180032292 21:45220765-45220787 AGGGAGGGAGCAGCCACGGGCGG - Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180926743 22:19560224-19560246 GGGGAGGGGGCAGCAACTGGAGG + Intergenic
1181603355 22:23965290-23965312 GGGGAGAGGGCAGGGACAGGTGG - Intergenic
1181605159 22:23976017-23976039 GGGGAGAGGGCAGGGACAGGTGG + Intronic
1181725887 22:24810646-24810668 GGGGAGAATGCAGGGGCTGGTGG + Intronic
1184421577 22:44385461-44385483 AGGGGGAGTGCAGCCACTGTGGG - Intergenic
1185043113 22:48515753-48515775 AGGGACAGTGCGGGGACTTGGGG + Intronic
950801197 3:15552974-15552996 AGGGAGAGTGCCGTAACTGTGGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
952066559 3:29577719-29577741 AGGGAGAATACAGCAACTGGGGG - Intronic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952167661 3:30768591-30768613 AGGAAGAGTGGCGAGACTGGAGG + Intronic
953899494 3:46831706-46831728 AGGGAGATTGCACTGCCTGGGGG - Intronic
953912373 3:46899511-46899533 AGGGAGAGGGCAGCCCCTGGGGG + Intronic
954415680 3:50392195-50392217 GGGGAGGGTGCAGGGACTTGAGG - Intronic
954633902 3:52061214-52061236 GGTGAGAGTGCAGGGCCTGGGGG + Intergenic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956733411 3:72217446-72217468 AGTGAGATGGCAGCCACTGGAGG - Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958134867 3:89475888-89475910 ATGGAGACAGCAGCAACTGGGGG + Intronic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959335979 3:105066000-105066022 GGGGAGGGTGCAGGAACTGGAGG + Intergenic
959716769 3:109442442-109442464 AGGGAGACTGCAGCAATTGTGGG + Intergenic
959913841 3:111794297-111794319 AGAGAGGGTGCAGTGACTGCGGG - Intronic
960862915 3:122169500-122169522 AGGGAGAGTGCAGCAATTATGGG - Intergenic
961649061 3:128408454-128408476 TGGGAGTGTGCAGGGGCTGGAGG - Exonic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965264052 3:166518184-166518206 AGGGAAAGTGCAGTTACTGTGGG + Intergenic
965415299 3:168385161-168385183 AGGGAGAGCGCACTGAATGGGGG - Intergenic
968467716 4:760883-760905 GGGGAGACAGCAGCGACTGCAGG - Intronic
968762679 4:2450709-2450731 AGGGAGGGTGCAGGGCCTGTGGG - Intronic
969198733 4:5584808-5584830 GGAGAGAGTGCAGCGGATGGAGG - Exonic
969445377 4:7241923-7241945 AGTGGGAGTGCAGGGACAGGTGG + Intronic
969666086 4:8558272-8558294 AGGGACAGTGCTGGGACTCGTGG + Intergenic
969828916 4:9780229-9780251 AGGGTCAGGGCAGAGACTGGAGG + Intronic
971028137 4:22608381-22608403 AGGGAGAGTGGAGCCCCTGGCGG - Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973763206 4:54139672-54139694 AGGGAGAGCACAGCAACCGGGGG + Intronic
973852661 4:54976759-54976781 AGGGAAAATGCAGCAACTTGGGG + Intergenic
974266905 4:59597704-59597726 AAGGATAGTGCAGGGACTGTGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
977325803 4:95573082-95573104 AAGGAAAGTGCAGTGACTGGAGG - Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
980442487 4:132867115-132867137 AGGGAGAACACAGCAACTGGAGG + Intergenic
981762388 4:148208667-148208689 AGGCAGAGTGCAGAAACTGCTGG - Intronic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
981996046 4:150976809-150976831 TGGGAGAGTGCAGCGACTGTGGG + Intronic
982683486 4:158459943-158459965 AAGGAGAGTGCAGTGGCTGGGGG - Intronic
982899626 4:160981601-160981623 AGGCAGAGCACAGAGACTGGGGG - Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984634236 4:182093533-182093555 AGGCAGAGTGCAGAGACAGGTGG + Intergenic
985490264 5:174925-174947 ATGGACAGTGCGGCTACTGGAGG - Intronic
985595475 5:785742-785764 AGGGACAGAGCCGGGACTGGGGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
989133939 5:38134860-38134882 AGGCAGAGGGCAGCCACGGGAGG - Intergenic
989987450 5:50717858-50717880 AGGGAGAGAGAAGTGACTGATGG + Intronic
990267445 5:54092701-54092723 AGGGAGAGAGCAGCCTCTCGAGG - Intronic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993013630 5:82511206-82511228 AGGGAGACTGGAGAGGCTGGTGG + Intergenic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993233462 5:85270127-85270149 GGGGAGAGGGCAGGGGCTGGAGG - Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994217974 5:97159917-97159939 ATGAAGAGTGCAGTGACTGTGGG - Intronic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG + Intergenic
996675752 5:126172524-126172546 AGGGGGTGTGCTGCAACTGGGGG - Intergenic
996854202 5:127986939-127986961 AGGGAGAGTCCAAGGACTTGGGG + Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1001333590 5:170779628-170779650 AGGCTGAGTGTAACGACTGGTGG - Intronic
1001743483 5:174072170-174072192 AGGGAGAGGGCTGGGACAGGTGG - Intronic
1001808154 5:174606747-174606769 AGGGAGAGTGGAGAGAGAGGAGG - Intergenic
1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1003161130 6:3635724-3635746 AGGGAGAATCCACCGACAGGAGG + Intergenic
1003541892 6:7025441-7025463 AGGGTGGGTGCAGAGGCTGGTGG - Intergenic
1004425334 6:15503241-15503263 AGGCAGAGTGCAATGAGTGGAGG - Intronic
1007001767 6:38320078-38320100 GGGGAGAGTGCTGCGATTGTGGG - Intronic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1007267166 6:40605378-40605400 AGGGAGAGTGCAGCTATTGATGG - Intergenic
1008707661 6:54182318-54182340 AGGAAGAGCACAGCAACTGGGGG - Intronic
1008848623 6:55997266-55997288 AGGCTGGGTGCAGAGACTGGTGG - Intergenic
1008906258 6:56680724-56680746 AGGGAGAGTGAGGAGAGTGGAGG - Intronic
1008940396 6:57040183-57040205 AGGGAAAGCACAGCAACTGGAGG + Intergenic
1009045987 6:58237895-58237917 AGGGTGAATGAAGGGACTGGAGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011102965 6:83744386-83744408 AGGGAGAGGGCAGCAATGGGGGG - Intergenic
1011361231 6:86527016-86527038 GGGGTGAGTGAAGGGACTGGGGG - Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014275609 6:119384876-119384898 AGGAAGAGTGCAGCGACTGCGGG - Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016514861 6:144882561-144882583 AGGCAGAATCCAGAGACTGGAGG + Intergenic
1017751245 6:157492208-157492230 AGGGAGACTACAGTGGCTGGGGG - Intronic
1017924847 6:158901826-158901848 AGGGAGAGCACAGCAACTAGGGG - Intronic
1019144679 6:169969116-169969138 AGGGAGAGTGGAGTCTCTGGAGG + Intergenic
1019922986 7:4174615-4174637 CGGTAGAGTGCAGTCACTGGAGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1020624195 7:10557901-10557923 AGGGAAAGCACAGCAACTGGGGG + Intergenic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1022090192 7:27103025-27103047 AGGCAGAGGGCAGCCACCGGCGG - Intergenic
1022798037 7:33748577-33748599 AGAGAGAGTACAGGGAATGGAGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028299657 7:89181496-89181518 AGGGAGACTGCAGGGACCGTGGG - Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1031746638 7:125506473-125506495 AGGGAGAACACAGCAACTGGAGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1031991689 7:128202849-128202871 AGGGACAGTGCAGGATCTGGTGG + Intergenic
1032939028 7:136767577-136767599 AGAGAGAGCACAGCAACTGGGGG + Intergenic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1036662167 8:10715604-10715626 AGGAAGAGGGCGGCGGCTGGAGG - Intergenic
1037902115 8:22694501-22694523 AGGGGGAGGGCAGAGACTAGGGG - Intergenic
1038516674 8:28193467-28193489 AGGCAGAGTCCAGGGCCTGGTGG - Intergenic
1040315164 8:46257131-46257153 AGGGAGACTGCAGGGAATGCTGG + Intergenic
1040596090 8:48839167-48839189 AGGGAGATGGCAGCCAATGGAGG - Intergenic
1041081793 8:54221511-54221533 AGGGAGACTGCAGAGTCTGCAGG - Intergenic
1041289090 8:56291347-56291369 AAGGACAGTGCAGGGAGTGGTGG + Intergenic
1041415890 8:57608739-57608761 AGACAGAGTGCAATGACTGGGGG + Intergenic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044744738 8:95361370-95361392 AGGGGGAGGGCAGAGAATGGTGG + Intergenic
1045347871 8:101310879-101310901 GGGGAGAGTGAAGAGGCTGGAGG - Intergenic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1049271322 8:141697771-141697793 AGGGGGAGTGCTGGGCCTGGAGG + Intergenic
1049428686 8:142549365-142549387 AGCGGGAGTGCAGGGCCTGGAGG + Intergenic
1049428696 8:142549385-142549407 AGGGGGAGGGCAGGGCCTGGAGG + Intergenic
1049538619 8:143194768-143194790 AGGGCCAGTGCAGGGGCTGGTGG + Intergenic
1049873577 8:145000648-145000670 AGCACGAGGGCAGCGACTGGTGG + Intergenic
1049885000 9:20991-21013 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG + Intergenic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052169556 9:25376970-25376992 TGGGTGGGTGCAGGGACTGGGGG - Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1057549301 9:96040214-96040236 AGGAAGAGTGCAGAGGCTGGCGG - Intergenic
1057553634 9:96070454-96070476 ATGGAGACTGCAGAGACAGGAGG + Intergenic
1057895508 9:98905528-98905550 AGGGAGGGTGCAGCGAAGGAGGG - Intergenic
1057987415 9:99731496-99731518 AGTGCGTGTGCAGTGACTGGGGG + Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059841046 9:118216859-118216881 ATGGTGAGGGCAGAGACTGGAGG - Intergenic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1060520120 9:124289581-124289603 AGGCAGTGTGCAGGGGCTGGAGG + Intronic
1061006080 9:127929127-127929149 AGGGAAAGTGTAGAGACTCGAGG - Intronic
1061271674 9:129547239-129547261 AGGGAGAGTGCAGCCCATGGGGG - Intergenic
1061481621 9:130900284-130900306 AGGGCCAGCACAGCGACTGGTGG - Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1062194189 9:135264013-135264035 GGGGAGAGGGCAGGGAGTGGGGG - Intergenic
1062354315 9:136154512-136154534 TGGGAGAGCGGAGAGACTGGAGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186412134 X:9353362-9353384 AGGGTGAGTGGAGAGCCTGGGGG - Intergenic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188625199 X:32276065-32276087 AGGGACAGTACAGCTACTGGGGG + Intronic
1188715521 X:33455711-33455733 AGGGAGAGTGCAGCAATTCTGGG + Intergenic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1188945014 X:36290007-36290029 AGGGAGAATGGGACGACTGGGGG - Intronic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1189405609 X:40720355-40720377 AGGGAGAGAATAGTGACTGGGGG + Intronic
1189760227 X:44314580-44314602 AGAGAGAGTGGAGGGAATGGTGG - Intronic
1189884959 X:45533123-45533145 GGGGAGAGTACAGCAATTGGAGG + Intergenic
1190245275 X:48686783-48686805 AGGGAGAGCGGACCCACTGGAGG - Exonic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1190440129 X:50468992-50469014 AGGGAGAGTGCAGAGAAAGCAGG + Intronic
1190537135 X:51440588-51440610 AGGGACAGCACAGCAACTGGGGG + Intergenic
1191197061 X:57736027-57736049 TGGGAGAGTTTAGTGACTGGGGG + Intergenic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193138717 X:78002696-78002718 AGGTAGAGAGCAGCGAGTGGAGG + Intronic
1193650158 X:84122235-84122257 AGGGAAAGCTCAGCAACTGGGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194329120 X:92559648-92559670 AGGAATATTGCAGTGACTGGGGG + Intronic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194526369 X:94982843-94982865 TGGGAAAGTGCAGTGACTGTGGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194882685 X:99273459-99273481 AGGGAGAATACAGCAACTGGAGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195199244 X:102532133-102532155 AGGAAGAGTGCAGCAACTGGGGG + Intergenic
1195489469 X:105450215-105450237 AGGGCGAGTGCAGTGACTTGGGG - Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1196151635 X:112380968-112380990 ACGGGGAGTGGAGCCACTGGAGG + Intergenic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196270183 X:113700451-113700473 AGGGAGAGTGTAGCATCTGGGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1197072826 X:122321355-122321377 AAGGAGAGCACAGCAACTGGGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1198278062 X:135116200-135116222 AGGGAGAGTGCAGCAAGTGGGGG - Intergenic
1198292900 X:135256316-135256338 AGGGAGAGTGCAGCAAGTGGGGG + Intronic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG + Intergenic
1199814996 X:151389228-151389250 ATGGAGGGTGCAGGGACGGGAGG + Intergenic
1200370089 X:155715867-155715889 AGGGCAAGCACAGCGACTGGGGG - Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic